The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	1345175	1425530	6852809	transposase,tail,lysis,plate,tRNA,holin	uncultured_Caudovirales_phage(25.0%)	83	NA	NA
WP_017844616.1|1345175_1345646_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_079442950.1|1345670_1346780_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.1	5.4e-21
WP_026139754.1|1346776_1347697_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.0	4.2e-19
WP_046384544.1|1348130_1350239_+	molybdopterin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_046384543.1|1350325_1350664_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017844621.1|1350835_1351306_-	bacterioferritin	NA	NA	NA	NA	NA
WP_026139755.1|1351507_1351726_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_017844622.1|1351971_1352574_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_079442951.1|1352690_1353716_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017844623.1|1353995_1354667_-	ribonuclease T	NA	NA	NA	NA	NA
WP_017844624.1|1354663_1355710_-	dihydroorotase	NA	NA	NA	NA	NA
WP_046384542.1|1355866_1356775_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017844626.1|1356904_1358122_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_017844627.1|1358734_1359367_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_017844628.1|1359454_1359634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046384541.1|1359741_1360380_-	endonuclease III	NA	NA	NA	NA	NA
WP_046384540.1|1360405_1360900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079442952.1|1360892_1361477_-	RnfABCDGE type electron transport complex subunit G	NA	NA	NA	NA	NA
WP_079442953.1|1361473_1362433_-	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
WP_079442954.1|1362419_1363382_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_017844634.1|1363378_1363951_-	NADH:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_079442955.1|1364054_1366106_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046384535.1|1366277_1367372_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_003222178.1|1367870_1368194_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079442956.1|1368336_1370928_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.9	5.6e-29
WP_026139757.1|1371126_1371861_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.7	3.7e-119
WP_017844641.1|1372571_1372916_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	85.3	2.7e-48
WP_046384534.1|1372936_1373452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079442957.1|1373455_1374067_+|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	53.3	1.6e-43
WP_017844644.1|1374076_1374409_+|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	65.5	1.7e-34
WP_079442958.1|1374405_1375401_+|plate	baseplate J/gp47 family protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.5	2.3e-111
WP_046384531.1|1375397_1376036_+|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	50.6	3.6e-38
WP_079442959.1|1376032_1376566_+|tail	phage tail protein	tail	B0ZSG1	Halomonas_phage	57.4	2.5e-48
WP_079442960.1|1376648_1377401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079442961.1|1377410_1377647_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_167379480.1|1377732_1377906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017844650.1|1377908_1379075_+|tail	tail protein	tail	B0ZSG8	Halomonas_phage	56.7	3.6e-124
WP_017844651.1|1379074_1379581_+|tail	phage major tail tube protein	tail	Q6R4W3	Vibrio_virus	34.5	1.3e-22
WP_046384528.1|1379633_1380206_+|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	39.8	2.8e-29
WP_079442962.1|1380333_1381506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079442963.1|1381505_1381889_+|tail	phage tail protein	tail	B0ZSH2	Halomonas_phage	58.3	1.7e-35
WP_017844656.1|1381881_1382094_+|tail	tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
WP_079442964.1|1382106_1383117_+|tail	phage tail protein	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.5	3.3e-102
WP_079442965.1|1383139_1383697_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	75.4	1.5e-75
WP_079442966.1|1383684_1384185_+|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	52.5	6.8e-32
WP_017844660.1|1384266_1384767_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	86.1	2.1e-73
WP_017844661.1|1384850_1385909_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.7	3.1e-111
WP_079442967.1|1385917_1386385_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_046384508.1|1386445_1387558_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_046384507.1|1387937_1388378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026139758.1|1388576_1389296_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017844666.1|1389548_1390199_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_017137081.1|1390274_1390637_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_046384505.1|1390640_1391567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017844669.1|1391692_1392472_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_046384504.1|1392589_1393285_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_017844671.1|1393288_1393750_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.0e-37
WP_017844672.1|1393818_1394529_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_046384503.1|1394600_1395074_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169850727.1|1395189_1396518_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_046384501.1|1396843_1398745_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.3	1.7e-75
WP_079442968.1|1398970_1400077_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_017844677.1|1400348_1400534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046384499.1|1400593_1402219_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_017844679.1|1402574_1403999_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010563467.1|1404081_1404891_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_057005800.1|1404880_1405804_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079442969.1|1405805_1406840_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	4.0e-26
WP_017844682.1|1406960_1408112_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169881156.1|1408185_1409643_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017844684.1|1409775_1410687_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017844685.1|1410855_1411566_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_057005795.1|1411934_1412546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152031988.1|1412542_1413982_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046384494.1|1414200_1415823_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_046384493.1|1415822_1416335_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_079442971.1|1416331_1417591_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_079442972.1|1417583_1418285_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_079442973.1|1418281_1420561_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	28.0	3.3e-09
WP_046384489.1|1420557_1421568_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	40.3	7.6e-06
WP_046384488.1|1421619_1422621_+	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	34.7	1.4e-15
WP_098100956.1|1422861_1423956_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_024073787.1|1424027_1425530_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.4	9.4e-85
>prophage 2
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	1501196	1507457	6852809		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_017844765.1|1501196_1501946_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	1.8e-65
WP_169850588.1|1501987_1502623_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	7.8e-41
WP_079442991.1|1502832_1503669_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
WP_017844767.1|1503774_1504779_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_002554837.1|1504969_1505179_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_017844768.1|1505578_1506145_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.8	5.6e-75
WP_017844769.1|1506252_1506459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079442992.1|1506692_1507457_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	1.1e-09
>prophage 3
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	1619640	1624720	6852809		uncultured_Caudovirales_phage(100.0%)	7	NA	NA
WP_079443033.1|1619640_1620720_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	64.1	3.0e-101
WP_017844874.1|1620945_1621368_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	91.4	2.5e-67
WP_017844875.1|1621388_1622102_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	97.9	7.7e-130
WP_007247285.1|1622149_1622620_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	95.5	1.0e-77
WP_017844876.1|1622636_1623920_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	99.3	4.5e-229
WP_017844877.1|1623944_1624301_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	90.4	3.1e-55
WP_079443034.1|1624297_1624720_-	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	95.7	5.7e-72
>prophage 4
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	1776323	1808534	6852809	tail,holin,head,terminase,capsid,plate,tRNA,integrase,portal	Pseudomonas_virus(67.65%)	44	1772342:1772356	1795936:1795950
1772342:1772356	attL	CCACGGCACGCCGAG	NA	NA	NA	NA
WP_017848890.1|1776323_1777250_-	transaldolase	NA	A0A127KNC6	Cyanophage	34.8	5.3e-14
WP_079443079.1|1777458_1778469_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_079443080.1|1778572_1779724_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	62.7	1.1e-133
WP_079443081.1|1779698_1779974_-	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	62.8	2.9e-24
WP_079443082.1|1779985_1780237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443083.1|1780233_1780551_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	54.4	6.5e-12
WP_079443084.1|1780613_1780823_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	68.3	7.0e-15
WP_079443085.1|1780822_1781086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443086.1|1781144_1781456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174630503.1|1781518_1784317_-	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	61.8	0.0e+00
WP_079443088.1|1784328_1784574_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	55.1	3.9e-17
WP_079443089.1|1784645_1785020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443090.1|1785016_1785310_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	47.9	6.8e-16
WP_079443091.1|1785306_1785780_-	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	64.7	3.0e-53
WP_079443092.1|1785809_1786022_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	5.8e-09
WP_079444994.1|1786108_1786429_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	53.5	2.4e-22
WP_079443093.1|1786439_1786787_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_161493716.1|1786918_1787080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443094.1|1787129_1788398_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	81.2	1.4e-193
WP_079443095.1|1788394_1788835_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	74.0	2.2e-58
WP_079443096.1|1788840_1791822_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	37.2	4.1e-156
WP_078049802.1|1791811_1791931_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	79.5	2.2e-10
WP_079443097.1|1791939_1792275_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	56.4	2.5e-22
WP_079443098.1|1792325_1792841_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	74.9	1.0e-70
WP_079443099.1|1792898_1794074_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	75.4	3.0e-171
WP_079443100.1|1794185_1794575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443102.1|1796021_1796639_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	74.2	2.3e-82
1795936:1795950	attR	CCACGGCACGCCGAG	NA	NA	NA	NA
WP_079443103.1|1796638_1797550_-|plate	baseplate J/gp47 family protein	plate	Q9ZXK8	Pseudomonas_virus	74.1	7.6e-122
WP_079443104.1|1797546_1797891_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	67.3	1.3e-37
WP_079443105.1|1797887_1798466_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	61.9	1.1e-57
WP_079443106.1|1798534_1799254_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_079443107.1|1799343_1799802_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	62.5	1.8e-47
WP_079443108.1|1799791_1800274_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	66.2	3.0e-45
WP_079443109.1|1800364_1800814_-	peptidase	NA	Q9ZXL5	Pseudomonas_virus	53.0	4.8e-29
WP_079443110.1|1800810_1801014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443111.1|1801010_1801853_-	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	69.7	4.4e-100
WP_174630454.1|1801849_1802173_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	57.7	5.5e-27
WP_079443112.1|1802218_1802431_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	78.8	1.7e-24
WP_079443113.1|1802430_1802892_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	60.8	6.2e-48
WP_079443114.1|1802994_1803696_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	70.4	4.4e-85
WP_079443115.1|1803699_1804707_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	61.8	2.4e-121
WP_079443116.1|1804747_1805578_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	54.0	2.5e-71
WP_079443117.1|1805733_1807491_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	80.5	7.2e-286
WP_079443118.1|1807490_1808534_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	75.4	3.7e-141
>prophage 5
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	2868619	2880431	6852809		Bacillus_phage(50.0%)	7	NA	NA
WP_079443611.1|2868619_2869648_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.0	4.7e-27
WP_046383761.1|2869890_2870721_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057004789.1|2871139_2872018_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.7	6.8e-11
WP_079443612.1|2872468_2875276_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.7	2.7e-24
WP_079443613.1|2875265_2876378_+	response regulator	NA	W8CYM9	Bacillus_phage	30.9	3.1e-08
WP_079443614.1|2876374_2877073_-	response regulator	NA	W8CYM9	Bacillus_phage	36.3	9.6e-16
WP_079443615.1|2877053_2880431_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.3	1.1e-35
>prophage 6
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	3454589	3530952	6852809	integrase,plate	Cronobacter_phage(33.33%)	57	3495087:3495103	3540988:3541004
WP_017849100.1|3454589_3454994_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_079443809.1|3454997_3456713_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_079443810.1|3456676_3457684_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_079443811.1|3457684_3460417_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	4.9e-92
WP_079443812.1|3460453_3463081_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_079443813.1|3463123_3465718_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_079443814.1|3465710_3466673_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_079443815.1|3466669_3467317_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_026140301.1|3467325_3467730_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_032804928.1|3467765_3468368_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_079443816.1|3468431_3469814_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046383451.1|3469810_3470479_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_079443817.1|3470478_3474420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443818.1|3474416_3477599_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	3.2e-50
WP_079443819.1|3477591_3478239_+	response regulator	NA	NA	NA	NA	NA
WP_079443820.1|3478489_3479362_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_057004126.1|3479516_3480461_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_079443821.1|3480464_3480851_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_079443822.1|3480921_3481806_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_057004129.1|3481815_3483681_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_079443823.1|3483948_3484221_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_079443824.1|3484486_3484924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443825.1|3485025_3485421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046383463.1|3485795_3486335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079445015.1|3488558_3490286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443827.1|3490662_3492396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443828.1|3493113_3494511_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_079443829.1|3494518_3495262_+	hypothetical protein	NA	NA	NA	NA	NA
3495087:3495103	attL	CGGCAGAGAAGTTTTTC	NA	NA	NA	NA
WP_079443830.1|3495887_3499772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443831.1|3499835_3500252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443832.1|3500480_3500801_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_079443833.1|3501757_3502174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443834.1|3502185_3502710_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079443835.1|3502922_3503108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152032014.1|3503125_3504121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443837.1|3504117_3505773_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_079443838.1|3505986_3507087_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_079443839.1|3507083_3509381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152032015.1|3509494_3510466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443841.1|3510528_3511383_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_079443842.1|3511424_3513140_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_152032016.1|3513140_3513704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443844.1|3514061_3515315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443845.1|3515380_3516244_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_079443846.1|3516351_3516819_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_079443847.1|3516808_3517411_-	7-cyano-7-deazaguanine synthase	NA	A0A126HGA1	Vibrio_phage	27.3	6.8e-10
WP_079443848.1|3517407_3518109_-	DNA lyase	NA	NA	NA	NA	NA
WP_079443849.1|3518105_3519488_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_079443850.1|3519545_3520715_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_079443851.1|3521352_3524415_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_152032017.1|3524453_3524654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443852.1|3524745_3525042_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079443853.1|3525127_3525577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443854.1|3525682_3526078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443855.1|3526086_3528180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443856.1|3528166_3529687_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079443857.1|3529698_3530952_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3540988:3541004	attR	GAAAAACTTCTCTGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	3678805	3713591	6852809	integrase,tail,head,lysis,terminase,capsid,plate,holin,portal	uncultured_Caudovirales_phage(35.0%)	48	3670674:3670688	3719000:3719014
3670674:3670688	attL	GGCACGGGTGGCGCC	NA	NA	NA	NA
WP_079443916.1|3678805_3680020_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	38.0	1.0e-57
WP_079445018.1|3680090_3680594_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	63.4	1.7e-43
WP_079443918.1|3680907_3681417_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	63.9	1.2e-52
WP_079443919.1|3681478_3681928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443920.1|3681932_3683150_-	hypothetical protein	NA	B5TK77	Pseudomonas_phage	61.8	1.4e-17
WP_079443921.1|3683149_3683758_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.2	1.5e-81
WP_079443922.1|3683745_3684786_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	73.0	8.3e-141
WP_079443923.1|3684775_3685174_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	65.9	4.3e-45
WP_079443924.1|3685170_3685683_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	76.2	1.0e-67
WP_079443925.1|3685679_3686795_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	64.5	4.0e-125
WP_079443926.1|3686798_3688109_-	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	50.1	4.0e-116
WP_079443927.1|3688105_3690229_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	49.5	3.8e-116
WP_079443928.1|3690359_3690656_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	73.5	1.6e-33
WP_079443929.1|3690652_3691000_-|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	78.3	2.6e-46
WP_079443930.1|3691058_3692555_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	81.9	3.8e-235
WP_079443931.1|3692554_3692737_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	71.7	6.5e-17
WP_079443932.1|3692733_3693324_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	56.1	9.1e-60
WP_079443933.1|3693381_3693903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443934.1|3693895_3694258_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	43.9	7.4e-20
WP_079443935.1|3694260_3694812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443936.1|3694815_3695130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443937.1|3695178_3696498_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	54.9	3.6e-125
WP_079443938.1|3696560_3697505_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	56.4	4.5e-93
WP_079443939.1|3697501_3698773_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	59.1	6.0e-141
WP_167379486.1|3698775_3698949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443940.1|3698945_3700769_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	39.3	1.2e-110
WP_079443941.1|3700731_3701265_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_079443942.1|3701417_3701786_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	52.3	4.4e-28
WP_079443943.1|3701785_3702076_-|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	42.2	3.0e-08
WP_025856644.1|3702068_3702434_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	36.3	5.5e-07
WP_079443944.1|3702693_3703182_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.9	7.1e-26
WP_079443945.1|3703165_3703564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079443946.1|3703814_3705308_-	hypothetical protein	NA	A0A2H4JF22	uncultured_Caudovirales_phage	37.3	1.4e-61
WP_079443947.1|3705308_3706346_-	PriCT-2 domain-containing protein	NA	H9C0J7	Bdellovibrio_phage	43.1	3.5e-22
WP_079443948.1|3706342_3706546_-	TraR/DksA C4-type zinc finger protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	66.2	4.3e-17
WP_079443949.1|3706538_3707027_-	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	64.3	6.0e-41
WP_152032021.1|3707166_3707415_-	helix-turn-helix domain-containing protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	70.7	1.0e-20
WP_079443951.1|3707521_3708277_+	helix-turn-helix domain-containing protein	NA	A0A2H4J8A8	uncultured_Caudovirales_phage	44.2	2.1e-53
WP_079443952.1|3708418_3708625_+	hypothetical protein	NA	A0A2H4JG20	uncultured_Caudovirales_phage	63.2	4.5e-14
WP_079443953.1|3708898_3709174_+	hypothetical protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	72.8	7.8e-30
WP_079443954.1|3709170_3709548_+	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	72.7	4.2e-42
WP_025856656.1|3709544_3709787_+	pyocin activator PrtN family protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	70.0	1.2e-23
WP_079443955.1|3709841_3710189_+	hypothetical protein	NA	C5IHK2	Burkholderia_virus	41.0	6.8e-15
WP_079443956.1|3710240_3711062_+	DUF2303 family protein	NA	I6WAZ8	Burkholderia_virus	42.0	7.7e-41
WP_065908170.1|3711139_3711490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079443957.1|3711486_3712287_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	32.7	2.1e-11
WP_079443958.1|3712286_3712523_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	71.4	3.4e-26
WP_079443959.1|3712526_3713591_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	60.0	5.8e-113
3719000:3719014	attR	GGCACGGGTGGCGCC	NA	NA	NA	NA
>prophage 8
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	4285186	4295214	6852809	protease,tRNA	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
WP_017848028.1|4285186_4286011_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	70.8	2.2e-104
WP_046382918.1|4286314_4286917_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_079445028.1|4287046_4287541_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_079444184.1|4287655_4288837_-	CoA transferase	NA	NA	NA	NA	NA
WP_079444185.1|4288995_4289388_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	81.5	5.9e-55
WP_079444186.1|4289389_4289740_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	67.5	6.9e-39
WP_017848034.1|4289739_4290018_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.6	3.1e-26
WP_017848035.1|4290014_4290350_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	2.3e-44
WP_046382915.1|4290346_4291348_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	87.8	4.8e-170
WP_057004419.1|4291436_4292432_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_079444187.1|4292538_4293933_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_017848039.1|4293933_4295214_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.2	3.7e-98
>prophage 9
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	4659122	4712251	6852809	tail,lysis,terminase,capsid,integrase	Pseudomonas_phage(58.49%)	74	4658913:4658962	4711442:4711491
4658913:4658962	attL	ATATGGTCGGGACGGAGTGATTCGAACACTCGACCCCTAGCACCCCATGC	NA	NA	NA	NA
WP_079444331.1|4659122_4659629_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	75.5	8.9e-56
WP_079444332.1|4659625_4660135_-	glycoside hydrolase family 104 protein	NA	M1TAR2	Escherichia_phage	66.0	3.2e-53
WP_079444333.1|4660194_4660734_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	36.3	5.5e-11
WP_079444334.1|4661545_4662205_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	68.5	1.3e-83
WP_079444336.1|4662530_4666298_-|tail	phage tail protein	tail	A0A1B0VMH5	Pseudomonas_phage	76.6	0.0e+00
WP_079444337.1|4666357_4666969_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	79.3	6.1e-83
WP_079444338.1|4667031_4667382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444339.1|4667467_4667953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152032036.1|4668154_4669087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152032037.1|4669171_4669420_+	hypothetical protein	NA	A0A0S2SY68	Pseudomonas_phage	39.1	4.1e-06
WP_079444341.1|4669473_4670277_-	C40 family peptidase	NA	A0A1B0VP68	Pseudomonas_phage	88.0	2.3e-138
WP_079444342.1|4670279_4671032_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	96.0	1.3e-143
WP_010567892.1|4671041_4671380_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	83.0	2.8e-53
WP_079444343.1|4671379_4674460_-|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	43.0	3.4e-206
WP_079444344.1|4674487_4674793_-	DUF1799 domain-containing protein	NA	A0A1B0VMG9	Pseudomonas_phage	58.3	2.0e-26
WP_046382986.1|4674810_4675191_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_046382985.1|4675200_4675860_-|tail	phage tail protein	tail	A0A0S2SYG8	Pseudomonas_phage	69.1	1.2e-79
WP_046382984.1|4675899_4676328_-	hypothetical protein	NA	A0A2H4J5P1	uncultured_Caudovirales_phage	77.5	1.6e-53
WP_079444345.1|4676324_4676921_-	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	52.8	7.1e-52
WP_046382982.1|4676917_4677286_-	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	97.5	3.9e-61
WP_046382981.1|4677303_4677807_-	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	90.4	1.8e-80
WP_046382980.1|4677865_4678456_-	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	70.3	9.1e-68
WP_046382979.1|4678502_4679465_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	92.2	1.4e-166
WP_046382978.1|4679477_4680206_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	97.1	5.0e-124
WP_052735775.1|4680306_4680915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444346.1|4680938_4682027_-|capsid	minor capsid protein	capsid	A0A1B0VMF3	Pseudomonas_phage	96.7	8.9e-194
WP_046382976.1|4682001_4683420_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	96.6	8.7e-274
WP_046382975.1|4683416_4684718_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.1	7.2e-150
WP_046382974.1|4684704_4685166_-	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	73.4	1.8e-47
WP_079445031.1|4685197_4685821_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	93.2	2.4e-111
WP_079444347.1|4685912_4686245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079444348.1|4686253_4686445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444349.1|4686494_4686839_-	hypothetical protein	NA	A0A193GYR7	Enterobacter_phage	41.9	1.6e-08
WP_079444350.1|4686835_4687174_-	MFS transporter	NA	A0A088FVG2	Escherichia_phage	47.3	5.8e-19
WP_079444351.1|4687367_4687694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444352.1|4687702_4687888_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	86.8	4.9e-12
WP_046382968.1|4688354_4688903_-	hypothetical protein	NA	A0A0H5AWB8	Pseudomonas_phage	69.1	7.9e-66
WP_046382967.1|4688899_4689496_-	recombination protein NinG	NA	A0A0U1VZM0	Pseudomonas_phage	67.9	4.0e-71
WP_046382966.1|4689492_4689963_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	60.9	7.3e-52
WP_046382965.1|4689959_4690757_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	66.5	5.0e-93
WP_079444353.1|4690743_4691721_-	phage replication protein	NA	A0A1B0VME0	Pseudomonas_phage	69.6	1.1e-115
WP_079444354.1|4691897_4692320_-	phage regulatory CII family protein	NA	A0A2D1GNM7	Pseudomonas_phage	47.9	1.4e-30
WP_024075251.1|4692402_4692582_-	Cro/Cl family transcriptional regulator	NA	R9TPV3	Vibrio_phage	48.9	5.6e-05
WP_079444355.1|4692691_4693348_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.7	3.9e-43
WP_079444356.1|4693430_4694174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079444357.1|4694170_4695007_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_079445033.1|4695180_4695429_+	superinfection immunity protein	NA	NA	NA	NA	NA
WP_079444358.1|4695510_4695837_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_167379489.1|4696110_4696302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444359.1|4696554_4696773_+	hypothetical protein	NA	A0A2H4J177	uncultured_Caudovirales_phage	79.1	2.0e-20
WP_079444360.1|4697819_4698068_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_046382951.1|4698490_4698904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444361.1|4699107_4699299_+	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	92.1	7.0e-30
WP_079444362.1|4699320_4699506_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_079444363.1|4699525_4699792_+	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	73.4	7.3e-25
WP_046382948.1|4699769_4700000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046382947.1|4699996_4700224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079445034.1|4700326_4701430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079444364.1|4701483_4702473_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	54.9	2.4e-65
WP_079444365.1|4702472_4703135_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	37.3	1.0e-30
WP_079444366.1|4703137_4703380_+	hypothetical protein	NA	A0A2H4J1H1	uncultured_Caudovirales_phage	61.2	4.0e-14
WP_079444367.1|4703376_4703841_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	88.1	1.1e-73
WP_079444368.1|4703922_4704408_+	hypothetical protein	NA	A0A1B0VMB5	Pseudomonas_phage	83.8	5.5e-71
WP_079444369.1|4704465_4704867_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	54.7	1.6e-31
WP_079444370.1|4704940_4705135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444371.1|4705211_4706699_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	47.5	9.5e-106
WP_079444372.1|4707011_4707596_+	hypothetical protein	NA	R4W375	Alteromonas_phage	27.9	7.5e-14
WP_079444373.1|4707592_4708276_+	hypothetical protein	NA	A0A2I7RIF7	Vibrio_phage	28.6	1.8e-14
WP_079444374.1|4708562_4708871_+	hypothetical protein	NA	A0A2H4J7B8	uncultured_Caudovirales_phage	65.3	2.0e-34
WP_079444375.1|4709273_4709630_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	69.4	1.8e-39
WP_079444376.1|4709672_4709891_+	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	68.1	7.1e-18
WP_079444377.1|4710177_4711362_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	90.6	2.8e-209
WP_003174972.1|4711611_4711968_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
4711442:4711491	attR	ATATGGTCGGGACGGAGTGATTCGAACACTCGACCCCTAGCACCCCATGC	NA	NA	NA	NA
WP_002553164.1|4711948_4712251_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
>prophage 10
NZ_CP018420	Pseudomonas veronii strain R02 chromosome, complete genome	6852809	6319925	6373188	6852809	holin,protease	Tupanvirus(20.0%)	45	NA	NA
WP_017847866.1|6319925_6320426_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_079444835.1|6320598_6321504_+	acyltransferase	NA	NA	NA	NA	NA
WP_017847868.1|6321507_6321711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017847869.1|6322014_6322491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381820.1|6322557_6323130_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_161493734.1|6323128_6323725_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_079444836.1|6324017_6325217_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.7	3.2e-11
WP_017847874.1|6325404_6326262_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_046487905.1|6326439_6327072_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_046381816.1|6327181_6330199_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_017847877.1|6330195_6330498_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_003209185.1|6330513_6331764_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_017847878.1|6331786_6333040_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	2.8e-98
WP_079444837.1|6333291_6334020_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_017847880.1|6334110_6335151_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_079444838.1|6335210_6337028_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079444839.1|6337305_6338751_+	cytosine permease	NA	NA	NA	NA	NA
WP_079444840.1|6338747_6339563_+	carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
WP_017847881.1|6339566_6340667_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_017847882.1|6340949_6342242_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_046487910.1|6342927_6343698_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_079444842.1|6343713_6344934_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_079444843.1|6344933_6346877_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_079444844.1|6347049_6349110_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_079444845.1|6349126_6349657_-	hydrocarbon binding protein	NA	NA	NA	NA	NA
WP_017849539.1|6349708_6350686_-	dipeptidase	NA	NA	NA	NA	NA
WP_017849538.1|6350905_6351307_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_046381805.1|6351347_6352310_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_079444846.1|6352512_6352929_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_046487921.1|6353886_6355065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079444847.1|6355133_6356078_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017844926.1|6356271_6357216_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_057003928.1|6357303_6358191_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_079444848.1|6358277_6359243_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_057003930.1|6359256_6359754_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_017844930.1|6359851_6360115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017844931.1|6360209_6361313_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017844932.1|6361836_6363213_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_046381797.1|6363628_6364576_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015886271.1|6364645_6365491_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_046381796.1|6365487_6366666_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.1	1.3e-25
WP_079444849.1|6366840_6368832_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	2.0e-18
WP_017844937.1|6369165_6369759_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_017844938.1|6369869_6371342_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046381793.1|6371484_6373188_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.1	1.0e-50
