The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	36609	48922	1914862		Synechococcus_phage(28.57%)	8	NA	NA
WP_015055883.1|36609_40335_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	1.5e-38
WP_010921773.1|40495_41950_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
WP_010921774.1|41977_43000_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	1.1e-63
WP_010921775.1|43167_43722_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
WP_011285343.1|43905_45453_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.3	8.3e-44
WP_010921776.1|45510_46635_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_010921777.1|46887_48153_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48430_48922_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	336789	342823	1914862		Streptococcus_phage(100.0%)	9	NA	NA
WP_010921930.1|336789_337425_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
WP_010921931.1|337442_338318_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_010921932.1|338336_338576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985838.1|338980_339304_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_029714023.1|339308_340172_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	6.5e-115
WP_002985833.1|340198_340591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010921934.1|340637_341267_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|341565_341922_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_010921936.1|341995_342823_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	1.4e-127
>prophage 3
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	445138	451789	1914862	portal	Streptococcus_phage(66.67%)	12	NA	NA
WP_002985621.1|445138_445348_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	61.5	1.3e-16
WP_010921999.1|445337_446183_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_010922001.1|446986_447211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160338849.1|447210_448104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015055928.1|448119_448296_+	prophage LambdaSa04	NA	M1PSF2	Streptococcus_phage	86.2	3.2e-21
WP_002991611.1|448350_448653_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011285435.1|448652_448958_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010922005.1|448976_449249_+	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	48.1	1.2e-06
WP_010922006.1|449353_449806_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	84.9	4.4e-62
WP_011285436.1|449871_450186_+	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	64.5	4.9e-20
WP_011285437.1|450602_450941_+	Fic family protein	NA	NA	NA	NA	NA
WP_029714029.1|450964_451789_+	asparagine ligase	NA	M1PB22	Moumouvirus	33.1	8.1e-22
>prophage 4
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	514861	603163	1914862	terminase,tail,head,capsid,tRNA,protease,portal	Streptococcus_phage(58.73%)	96	NA	NA
WP_015055933.1|514861_515986_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_101485534.1|516054_517152_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002985455.1|517171_517864_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_002990498.1|517856_518786_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010922050.1|519095_519794_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.4	1.1e-77
WP_011285458.1|519961_520576_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011285459.1|520579_520726_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010922051.1|520833_523335_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.1	1.3e-203
WP_002985439.1|523669_524863_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002985437.1|524883_526230_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_002985434.1|526643_527534_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_002985431.1|527530_528508_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	2.1e-138
WP_002985428.1|528504_529416_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
WP_029714044.1|529592_531008_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.2	7.9e-110
WP_002985420.1|531131_531437_-	membrane protein	NA	NA	NA	NA	NA
WP_002985417.1|531446_532211_-	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	64.5	2.0e-83
WP_002985414.1|532570_532729_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	88.5	7.1e-20
WP_001008979.1|532827_533469_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_002985407.1|533520_533709_+	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	63.3	2.6e-13
WP_029714046.1|533757_534519_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	61.5	3.6e-85
WP_011889039.1|534659_534842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985395.1|534928_535066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985392.1|535067_535253_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	2.0e-21
WP_002990076.1|535735_536122_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	47.3	1.1e-24
WP_010922205.1|536102_536336_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|536332_536473_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|536481_536688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922475.1|536743_537076_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	78.7	2.2e-42
WP_010922474.1|537075_538065_+	recombinase RecT	NA	A0A286QMX3	Streptococcus_phage	44.2	5.8e-59
WP_010922473.1|538061_538262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020837672.1|538254_539052_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	82.3	3.4e-126
WP_020837403.1|539228_539570_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	1.1e-12
WP_029714370.1|539566_540079_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	74.4	3.4e-63
WP_002990061.1|540065_540260_+	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.7e-11
WP_020837669.1|540256_540670_+	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	4.9e-36
WP_029714366.1|540666_540951_+	hypothetical protein	NA	A3F628	Streptococcus_phage	90.4	3.6e-38
WP_029714365.1|540954_541182_+	hypothetical protein	NA	A0A1S5S8R7	Streptococcus_phage	47.8	6.2e-09
WP_164875335.1|541184_541343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029714363.1|541361_541565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046735274.1|541962_542598_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	66.5	2.0e-84
WP_011017866.1|542870_543311_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_029714361.1|543865_544777_+	DNA adenine methylase	NA	A0A126HDT5	Lactococcus_phage	64.5	4.3e-101
WP_002987543.1|544902_545280_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|545331_545517_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_029714359.1|545752_546094_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	89.8	9.6e-54
WP_002985371.1|546261_546729_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985368.1|546731_546962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029714357.1|546965_548720_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
WP_002985365.1|548716_548887_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|548879_549104_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_011017578.1|549137_550358_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_029714356.1|550335_551001_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.7	6.0e-92
WP_029714355.1|551024_552209_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.3	2.3e-163
WP_021341088.1|552353_552656_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	2.6e-42
WP_029714354.1|552652_553000_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_021340627.1|552996_553374_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
WP_002985347.1|553370_553796_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
WP_014411858.1|553812_554421_+|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	70.5	2.3e-74
WP_014411857.1|554473_554800_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	73.1	6.0e-37
WP_014411856.1|554829_554997_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	87.3	2.9e-19
WP_029714351.1|555009_558933_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.8	1.0e-239
WP_014411854.1|558932_559640_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.1	1.7e-92
WP_046735273.1|559636_561781_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	98.3	0.0e+00
WP_029714406.1|561777_562797_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	95.8	8.3e-178
WP_046735272.1|562809_564696_+	gp58-like family protein	NA	Q938J9	Temperate_phage	82.6	2.6e-209
WP_011018112.1|564707_565136_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	78.6	1.9e-54
WP_029714007.1|565138_565756_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	87.8	1.0e-77
WP_011018110.1|565766_566066_+	hypothetical protein	NA	Q938J6	Temperate_phage	93.8	1.9e-42
WP_011184796.1|566062_566248_+	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
WP_046735271.1|566360_567563_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	94.8	2.7e-228
WP_011017840.1|567702_568227_+	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054729.1|568214_569081_+	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_002986907.1|569149_569506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986905.1|569507_569981_-	hypothetical protein	NA	A3F671	Streptococcus_phage	92.3	1.6e-78
WP_029714005.1|570020_570260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029714004.1|570537_571956_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_029714003.1|572107_573655_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_010922098.1|573802_574525_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011285463.1|574543_575743_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|575839_576100_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_010922100.1|576214_577156_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985303.1|577549_577999_+	flavodoxin	NA	NA	NA	NA	NA
WP_010922101.1|578174_578459_+	chorismate mutase	NA	NA	NA	NA	NA
WP_011285464.1|578451_579714_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	50.5	8.4e-95
WP_002985298.1|579828_580176_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011285465.1|581178_581748_+	hydrolase	NA	NA	NA	NA	NA
WP_010922104.1|581748_583701_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	1.5e-143
WP_029714002.1|584068_585793_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|585924_586383_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|586609_587917_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_029714000.1|591706_597886_+	DUF1542 domain-containing protein	NA	NA	NA	NA	NA
WP_002985285.1|598750_598912_+	TOMM family cytolysin streptolysin S	NA	NA	NA	NA	NA
WP_010922108.1|599133_600084_+	streptolysin S biosynthesis dehydrogenase SagB	NA	NA	NA	NA	NA
WP_010922109.1|600080_601139_+	streptolysin associated protein SagC	NA	NA	NA	NA	NA
WP_029713999.1|601158_602517_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_002985272.1|602491_603163_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	663085	673688	1914862		Streptococcus_phage(57.14%)	9	NA	NA
WP_029713995.1|663085_665296_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_002985142.1|665403_666567_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|666563_667250_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_010922139.1|667343_668510_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.4	1.8e-38
WP_010922140.1|668570_668912_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_010922141.1|669132_670485_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
WP_002990257.1|670572_671841_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_010922142.1|671870_672311_-	membrane protein	NA	NA	NA	NA	NA
WP_011285480.1|672545_673688_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	31.7	7.8e-15
>prophage 6
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	798208	889357	1914862	terminase,integrase,transposase,tail,capsid,tRNA,protease,portal,holin	Streptococcus_phage(81.48%)	105	845883:845899	890873:890889
WP_111705325.1|798208_798352_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010922241.1|798578_800996_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002992006.1|801228_802218_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.2	8.2e-13
WP_010922242.1|802326_803118_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011285501.1|803117_804461_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_010922244.1|804567_805419_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002984857.1|805415_806372_+	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_010922245.1|806425_807781_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010922246.1|807914_808556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922247.1|808618_809749_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_011285504.1|809758_810511_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_010922249.1|810510_811275_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_010922250.1|811274_811907_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_011285506.1|812386_816493_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_002989953.1|816492_817362_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_002989951.1|817358_817700_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_010922252.1|817689_818352_+	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_029713988.1|818559_819756_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F610	Streptococcus_phage	96.7	1.5e-223
WP_029713987.1|820151_820907_-	helix-turn-helix transcriptional regulator	NA	M1NS52	Streptococcus_phage	64.4	4.3e-78
WP_022554802.1|821065_821212_+	hypothetical protein	NA	A0A1S5S7K5	Streptococcus_phage	60.4	2.1e-05
WP_029713986.1|821386_821968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713985.1|822206_822434_+	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	1.2e-12
WP_029713984.1|822476_823196_+	ORF6C domain-containing protein	NA	A3F617	Streptococcus_phage	79.5	1.6e-106
WP_029713983.1|823270_823483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713982.1|823479_823686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022554795.1|823942_824200_+	hypothetical protein	NA	A3F618	Streptococcus_phage	95.3	7.0e-41
WP_029713981.1|824354_824543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713980.1|824529_825876_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.0	2.3e-207
WP_029713979.1|825862_826609_+	phage protein	NA	A0A1P8VVR3	Streptococcus_phage	97.2	3.7e-135
WP_029713978.1|826609_827431_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	94.9	1.2e-147
WP_029713977.1|827430_827661_+	hypothetical protein	NA	C5J991	Streptococcus_phage	52.8	1.0e-14
WP_153276856.1|827671_827836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093974717.1|827822_828314_+	MazG-like family protein	NA	A0A1P8VVP1	Streptococcus_phage	79.8	1.2e-70
WP_080033899.1|828322_828616_+	DUF1372 family protein	NA	A0A1X9I624	Streptococcus_phage	50.5	1.1e-21
WP_029713973.1|828738_828978_+	DUF3310 domain-containing protein	NA	A3F631	Streptococcus_phage	94.8	2.6e-37
WP_029713972.1|828970_829303_+	hypothetical protein	NA	A0A1S5SCX1	Streptococcus_phage	54.6	5.9e-32
WP_003057301.1|829295_829517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713971.1|829513_829906_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	71.7	5.3e-48
WP_029713970.1|829919_830198_+	hypothetical protein	NA	A3F632	Streptococcus_phage	96.7	9.6e-44
WP_029713969.1|830194_830539_+	helix-turn-helix transcriptional regulator	NA	A3F633	Streptococcus_phage	95.0	1.4e-49
WP_027970299.1|830541_830943_+	hypothetical protein	NA	A3F635	Streptococcus_phage	93.2	3.4e-66
WP_029713968.1|831100_831676_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	94.8	2.7e-101
WP_029713967.1|831830_832127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713966.1|832150_832396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029713964.1|832637_833024_+	hypothetical protein	NA	A3F638	Streptococcus_phage	93.0	3.6e-65
WP_029713963.1|833016_833322_+	HNH endonuclease	NA	A3F639	Streptococcus_phage	97.0	5.0e-54
WP_029713962.1|833464_833782_+|terminase	P27 family phage terminase small subunit	terminase	A3F640	Streptococcus_phage	99.0	1.3e-49
WP_029713961.1|833794_835525_+|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	97.4	0.0e+00
WP_027970293.1|835705_836893_+|portal	phage portal protein	portal	A3F643	Streptococcus_phage	97.5	2.1e-220
WP_029713960.1|836873_837680_+|protease	Clp protease ClpP	protease	A3F644	Streptococcus_phage	97.8	3.9e-146
WP_029713959.1|837696_838830_+|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	96.0	1.3e-200
WP_164875336.1|838840_839014_+	hypothetical protein	NA	A3F646	Streptococcus_phage	91.2	1.9e-21
WP_029713958.1|839013_839322_+	hypothetical protein	NA	A3F647	Streptococcus_phage	92.2	1.4e-43
WP_029713957.1|839314_839677_+	hypothetical protein	NA	A3F648	Streptococcus_phage	95.8	1.6e-59
WP_011017387.1|839678_840077_+	HK97 gp10 family phage protein	NA	A3F649	Streptococcus_phage	100.0	2.9e-70
WP_029713956.1|840069_840450_+	hypothetical protein	NA	A3F650	Streptococcus_phage	97.6	8.2e-62
WP_029713955.1|840461_841046_+|tail	tail protein	tail	A3F651	Streptococcus_phage	90.2	6.2e-93
WP_029713954.1|841141_841444_+	hypothetical protein	NA	A3F652	Streptococcus_phage	96.0	2.4e-48
WP_029713952.1|841668_845769_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	76.5	0.0e+00
WP_029713951.1|845781_846552_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	87.9	1.4e-129
845883:845899	attL	TTTTAAAACAATCAAAA	NA	NA	NA	NA
WP_029713950.1|846548_848600_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	85.2	0.0e+00
WP_011017394.1|848596_849604_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	64.9	9.9e-115
WP_011017395.1|849613_851518_+	gp58-like family protein	NA	Q938J9	Temperate_phage	83.7	1.1e-210
WP_002988448.1|851529_851958_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_046735270.1|851960_852599_+	hypothetical protein	NA	A3F662	Streptococcus_phage	52.7	2.0e-44
WP_011017397.1|852610_852883_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_029714020.1|852879_853107_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	2.2e-30
WP_029714018.1|853229_854435_+	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	82.0	5.0e-198
WP_011054446.1|854550_854907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054447.1|854964_855204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054448.1|855467_855719_-	hypothetical protein	NA	A3F666	Streptococcus_phage	96.4	2.8e-42
WP_011054449.1|855859_856006_-	hypothetical protein	NA	A3F667	Streptococcus_phage	97.9	4.0e-17
WP_011054450.1|856159_856369_+	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	100.0	1.2e-30
WP_029714017.1|856567_856750_+	hypothetical protein	NA	A3F673	Streptococcus_phage	71.7	1.0e-17
WP_010922253.1|857503_859336_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_029714016.1|859593_860412_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010922255.1|860597_861035_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010922256.1|861149_862169_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002989935.1|862375_862801_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002984845.1|862819_863311_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_002984844.1|863327_864137_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002989931.1|864133_864961_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_011285511.1|865096_866746_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	8.0e-13
WP_010922260.1|866749_867538_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015055942.1|867531_868578_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010922263.1|869356_869923_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011285513.1|869938_870628_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_010922265.1|870722_872120_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010922266.1|872221_874018_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002989923.1|874202_874805_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_010922267.1|874929_876339_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_010922268.1|876406_877783_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_010922269.1|878115_878616_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002984819.1|878680_879046_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002984809.1|881231_881927_+	relaxase	NA	NA	NA	NA	NA
WP_002984807.1|882077_882764_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.3	4.5e-18
WP_002984805.1|882756_884103_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002984803.1|884250_884391_+	lantibiotic streptin	NA	NA	NA	NA	NA
WP_010922273.1|884505_885123_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	39.1	1.0e-08
WP_010922274.1|885204_885894_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.2	1.6e-52
WP_010922275.1|885899_886649_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_010922276.1|886651_887374_+	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_010922277.1|887565_887784_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002984780.1|888274_888406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285518.1|888973_889357_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLI2	Bacillus_phage	37.8	8.9e-08
890873:890889	attR	TTTTAAAACAATCAAAA	NA	NA	NA	NA
>prophage 7
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	1027428	1103152	1914862	terminase,tail,integrase,capsid,tRNA,portal,holin	Streptococcus_pyogenes_phage(64.62%)	92	1060780:1060839	1099691:1099786
WP_002989678.1|1027428_1028313_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010922363.1|1028428_1029769_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002989673.1|1029865_1030822_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_010922364.1|1030832_1031429_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_010922365.1|1031520_1034157_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010922366.1|1034171_1034873_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	8.3e-36
WP_002984482.1|1034990_1035533_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010922367.1|1035675_1036317_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002994467.1|1036479_1036968_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|1036978_1037179_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|1037219_1037759_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|1037771_1037960_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_011285553.1|1037970_1038558_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|1038618_1038867_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002989648.1|1039230_1041549_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
WP_011285555.1|1042077_1043400_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_010922370.1|1043519_1044755_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011285556.1|1045123_1045897_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_010922372.1|1046266_1047103_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002984457.1|1047118_1047748_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
WP_002992417.1|1047757_1048399_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|1048504_1048840_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_010922374.1|1049035_1050850_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_002984449.1|1051025_1051583_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|1051800_1053303_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010922375.1|1053365_1054379_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_010922376.1|1054458_1057569_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
WP_010922377.1|1057753_1058125_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|1058124_1058823_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_010922378.1|1058832_1059618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285558.1|1059744_1060359_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	1.1e-50
1060780:1060839	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_011285559.1|1060949_1061138_-	hypothetical protein	NA	J7KIW4	Streptococcus_phage	82.3	3.4e-21
WP_009880239.1|1061358_1062114_+	streptococcal pyrogenic exotoxin SpeA	NA	A0A097PAT7	Streptococcus_pyogenes_phage	100.0	2.2e-143
WP_009880240.1|1062235_1062895_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
WP_009880241.1|1062894_1063116_-	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
WP_011054795.1|1063125_1063899_-	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
WP_011054796.1|1063909_1064512_-	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
WP_011285561.1|1064523_1065288_-	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	98.4	8.0e-149
WP_011285562.1|1065289_1065622_-|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	99.1	7.4e-51
WP_015055952.1|1065621_1065945_-	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
WP_011285564.1|1066094_1066442_-	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	99.1	6.5e-58
WP_015055954.1|1066452_1068315_-	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.4	0.0e+00
WP_011285566.1|1068319_1071760_-|tail	phage tail protein	tail	A0A097PBF5	Streptococcus_pyogenes_phage	98.7	0.0e+00
WP_009880250.1|1071760_1073245_-|tail	phage tail family protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	99.8	4.3e-292
WP_011054802.1|1073245_1075051_-|tail	tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
WP_009880253.1|1075043_1075502_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
WP_009880254.1|1075474_1075792_-	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
WP_009880255.1|1075804_1076311_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
WP_009880256.1|1076322_1076733_-	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
WP_009880257.1|1076734_1077130_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.8e-59
WP_011285567.1|1077126_1077438_-	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	98.1	1.0e-49
WP_029714010.1|1077434_1077773_-	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	98.2	5.2e-52
WP_009880260.1|1077786_1078080_-	Rho termination factor N-terminal domain-containing protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
WP_009880261.1|1078092_1078983_-	hypothetical protein	NA	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
WP_009880262.1|1079001_1079571_-	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	98.4	8.5e-71
WP_011285568.1|1079815_1080085_-	hypothetical protein	NA	Q938K9	Temperate_phage	85.2	5.6e-33
WP_011285569.1|1080091_1081000_-|capsid	minor capsid protein	capsid	A0A097PBF2	Streptococcus_pyogenes_phage	98.2	6.7e-86
WP_029714009.1|1080968_1082294_-|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	97.2	2.1e-237
WP_009880266.1|1082293_1083568_-|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	100.0	1.1e-251
WP_011285571.1|1083557_1083938_-	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
WP_011054810.1|1084547_1084982_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
WP_011018131.1|1085267_1085534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285572.1|1085530_1086055_-	DUF1642 domain-containing protein	NA	J7KK91	Streptococcus_phage	51.1	2.3e-38
WP_011018133.1|1086057_1086690_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_011018134.1|1086691_1086976_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
WP_002995952.1|1086972_1087143_-	hypothetical protein	NA	Q938M0	Temperate_phage	87.1	7.9e-09
WP_002995955.1|1087139_1087376_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
WP_011284873.1|1087617_1087974_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_011285574.1|1087970_1088411_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
WP_011106686.1|1088410_1088614_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011285575.1|1088619_1089045_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	82.3	2.8e-55
WP_046735269.1|1089037_1089712_-	ERF family protein	NA	Q938M8	Temperate_phage	97.3	1.5e-103
WP_011018142.1|1089712_1090195_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011018143.1|1090216_1090471_-	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_011285579.1|1090451_1090805_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
WP_011285581.1|1090945_1091728_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	96.9	3.9e-143
WP_009881060.1|1091714_1092545_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5S918	Streptococcus_phage	54.7	6.4e-67
WP_023610888.1|1092558_1092873_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	95.2	2.7e-50
WP_011054584.1|1093019_1093316_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	100.0	2.1e-49
WP_029714276.1|1093352_1093616_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	98.9	3.6e-40
WP_011017884.1|1093670_1094180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017885.1|1094310_1094520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992770.1|1094629_1094830_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
WP_011054589.1|1094903_1095290_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_011284881.1|1095278_1095488_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011284882.1|1095541_1096141_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011285583.1|1096170_1096329_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
WP_011285584.1|1096685_1097510_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	91.6	1.2e-131
WP_011285585.1|1097545_1098439_+	P63C domain-containing protein	NA	A0A1I9LJQ0	Stx_converting_phage	47.5	1.2e-68
WP_011054595.1|1098559_1099648_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
WP_002989605.1|1100010_1100631_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1099691:1099786	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
WP_010922381.1|1100887_1103152_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 8
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	1195696	1259402	1914862	terminase,tail,integrase,capsid,tRNA,portal,holin	Streptococcus_phage(66.04%)	80	1223457:1223476	1256787:1256806
WP_010922429.1|1195696_1196725_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_010922430.1|1196731_1197952_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_010922431.1|1198065_1198656_-	serine hydrolase	NA	NA	NA	NA	NA
WP_010922432.1|1198652_1198901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922433.1|1198885_1199113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922434.1|1199279_1199885_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	5.1e-58
WP_010922435.1|1199981_1201022_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010922436.1|1201092_1203336_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.7	9.8e-54
WP_002983967.1|1203316_1203979_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011285604.1|1204178_1204919_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_032459874.1|1204955_1205813_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002989164.1|1205802_1206081_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_010922439.1|1206104_1208105_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	7.6e-66
WP_002989158.1|1208232_1209852_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_002989155.1|1210158_1211703_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
WP_029714299.1|1211950_1212646_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_010922441.1|1212725_1214117_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002989146.1|1214307_1215354_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_029714296.1|1215454_1216051_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011285608.1|1216097_1216289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002989141.1|1216849_1217629_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002989140.1|1217752_1218295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983930.1|1218455_1218977_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002983928.1|1219083_1219779_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_010922443.1|1220017_1220953_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	1.3e-65
WP_029714293.1|1221252_1223115_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	4.6e-89
1223457:1223476	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_029714291.1|1223645_1223828_-	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_011285611.1|1224056_1224857_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011017966.1|1225127_1225562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922446.1|1225631_1226837_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	84.3	5.9e-207
WP_003058873.1|1226952_1227180_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_002987582.1|1227176_1227452_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_010922447.1|1227461_1228079_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.0e-77
WP_010922448.1|1228081_1228513_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	97.9	3.8e-71
WP_010922449.1|1228524_1230309_-	hypothetical protein	NA	Q938J9	Temperate_phage	47.5	6.3e-96
WP_023079488.1|1230323_1231325_-	hyaluronidase HylP	NA	Q938K0	Temperate_phage	71.6	2.3e-127
WP_010922451.1|1231324_1233283_-|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.2	5.3e-96
WP_010922452.1|1233279_1233975_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
WP_010922453.1|1233971_1236329_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	6.5e-141
WP_010922454.1|1236328_1236700_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	2.9e-35
WP_010922455.1|1236714_1236978_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_010922456.1|1236988_1237582_-|tail	tail protein	tail	M1PKG8	Streptococcus_phage	62.5	3.5e-59
WP_000573598.1|1237593_1237929_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_010922457.1|1237929_1238166_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	2.5e-21
WP_011285617.1|1238158_1238497_-	hypothetical protein	NA	M1PFF8	Streptococcus_phage	70.3	2.2e-42
WP_010922459.1|1238456_1238879_-	phage Gp19/Gp15/Gp42 family protein	NA	A0A0B5A2F6	Streptococcus_phage	70.8	3.7e-47
WP_010922460.1|1238888_1239089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922461.1|1239088_1240000_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.3	9.9e-114
WP_010922462.1|1240024_1240486_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011285619.1|1240566_1241982_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
WP_010922464.1|1242091_1242358_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	86.4	7.3e-33
WP_015055972.1|1242350_1242530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922466.1|1242579_1242804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922467.1|1242809_1244303_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_010922468.1|1244295_1245564_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_002994106.1|1245560_1245917_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_010922469.1|1246065_1246410_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
WP_010922470.1|1246518_1246938_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
WP_010922070.1|1247205_1247841_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
WP_002988369.1|1247842_1248112_-	hypothetical protein	NA	A7J287	Streptococcus_phage	71.9	9.6e-25
WP_002988366.1|1248195_1248708_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	78.0	2.3e-67
WP_020837403.1|1248704_1249046_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	1.1e-12
WP_011285624.1|1249223_1249391_-	hypothetical protein	NA	A0A1S5SEF3	Streptococcus_phage	51.9	3.3e-07
WP_011285625.1|1249400_1250198_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	84.5	6.0e-131
WP_011285626.1|1250194_1251124_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	72.2	1.1e-91
WP_002988359.1|1251126_1251456_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
WP_011017565.1|1251511_1251718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1251726_1251867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985387.1|1251863_1252097_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_011017564.1|1252077_1252464_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922477.1|1252967_1253153_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_010922478.1|1253154_1253466_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922479.1|1253735_1253948_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922480.1|1254148_1254904_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922481.1|1254915_1255434_+	HIRAN domain-containing protein	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_003051793.1|1255557_1256700_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1256788_1257064_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1256787:1256806	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_010922482.1|1257162_1257750_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002992620.1|1257727_1258570_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989125.1|1258562_1259402_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
>prophage 9
NZ_LN831034	Streptococcus pyogenes strain NCTC8198 chromosome 1	1914862	1326258	1402151	1914862	terminase,tail,integrase,capsid,tRNA,portal,holin	Temperate_phage(50.91%)	80	1389575:1389592	1416756:1416773
WP_029714133.1|1326258_1328907_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.5	1.1e-149
WP_002989022.1|1328908_1329472_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002989018.1|1330072_1330468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983750.1|1330485_1330740_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_002983746.1|1331218_1331971_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_010922517.1|1332026_1333100_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.6	7.3e-31
WP_002983743.1|1333534_1333840_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002983741.1|1333841_1334180_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010922518.1|1334232_1334988_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002983735.1|1335222_1336101_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011285649.1|1336238_1339655_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_010922520.1|1339674_1341159_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010922521.1|1341158_1342883_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	5.8e-14
WP_010922522.1|1342872_1343478_-	YesL family protein	NA	NA	NA	NA	NA
WP_002995654.1|1343783_1345229_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002988998.1|1345309_1346236_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011285651.1|1346245_1347196_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011285652.1|1347391_1348270_+	ROK family protein	NA	NA	NA	NA	NA
WP_010922527.1|1348880_1350323_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_010922528.1|1350346_1352041_-	beta-N-acetylglucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_002983707.1|1352091_1353132_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011285655.1|1353264_1354551_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_010922530.1|1354565_1357271_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_010922531.1|1357371_1358727_-	transcriptional regulator RocA	NA	NA	NA	NA	NA
WP_010922532.1|1359391_1360747_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.7	1.7e-72
WP_011184907.1|1360937_1361120_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
WP_011285611.1|1361357_1362158_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011017966.1|1362430_1362865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017840.1|1363768_1364293_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011888700.1|1364432_1365638_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.5	1.8e-203
WP_011184730.1|1365749_1366205_-|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
WP_011888699.1|1366214_1366847_-	hypothetical protein	NA	Q938J7	Temperate_phage	48.6	3.2e-42
WP_002983467.1|1366849_1367281_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_014635603.1|1367292_1369179_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.6	2.0e-217
WP_011017589.1|1369191_1370202_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	75.8	7.8e-136
WP_014635605.1|1370198_1372343_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	95.1	0.0e+00
WP_011888697.1|1372339_1373056_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	99.2	1.2e-135
WP_029714384.1|1373052_1376313_-	tape measure protein	NA	Q938K3	Temperate_phage	99.1	0.0e+00
WP_011888696.1|1376302_1376884_-	bacteriophage Gp15 family protein	NA	Q938K4	Temperate_phage	94.3	1.0e-100
WP_011888695.1|1376887_1377322_-	hypothetical protein	NA	Q938K5	Temperate_phage	97.9	4.2e-70
WP_011018120.1|1377365_1377827_-	hypothetical protein	NA	Q938K6	Temperate_phage	78.8	1.9e-60
WP_011888694.1|1377826_1378225_-|capsid	minor capsid protein	capsid	Q79S87	Temperate_phage	98.5	6.5e-70
WP_010922083.1|1378221_1378578_-|capsid	minor capsid protein	capsid	Q79S88	Temperate_phage	100.0	4.5e-62
WP_011888693.1|1378577_1378910_-|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	99.1	6.2e-58
WP_011888692.1|1378899_1379316_-	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	9.6e-56
WP_010922080.1|1379369_1380188_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_002986827.1|1380191_1380800_-	hypothetical protein	NA	Q938K8	Temperate_phage	93.1	4.9e-93
WP_011888689.1|1380931_1381198_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_010922077.1|1381284_1381512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029714379.1|1381511_1383005_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	79.6	3.4e-212
WP_021775314.1|1383009_1384461_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	8.3e-272
WP_010922074.1|1384525_1385737_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_010922073.1|1385819_1386296_-	hypothetical protein	NA	Q938L4	Temperate_phage	68.4	4.9e-48
WP_011888687.1|1388438_1388873_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	1.7e-71
WP_002987493.1|1389156_1389327_-	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_011888686.1|1389323_1389803_-	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
1389575:1389592	attL	CATCTTCTTCAACTTTTT	NA	NA	NA	NA
WP_011888685.1|1389807_1390440_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
WP_011018134.1|1390441_1390726_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
WP_002995952.1|1390722_1390893_-	hypothetical protein	NA	Q938M0	Temperate_phage	87.1	7.9e-09
WP_002995955.1|1390889_1391126_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
WP_011284873.1|1391367_1391724_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_011285574.1|1391720_1392161_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
WP_011106686.1|1392160_1392364_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011285575.1|1392369_1392795_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	82.3	2.8e-55
WP_029714396.1|1392787_1393462_-	ERF family protein	NA	Q938M8	Temperate_phage	97.8	3.1e-104
WP_011018142.1|1393462_1393945_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011018143.1|1393966_1394221_-	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_011285579.1|1394201_1394555_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
WP_011888684.1|1394695_1395478_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	97.3	1.0e-143
WP_014635613.1|1395464_1396226_-	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	100.0	7.5e-131
WP_011017881.1|1396319_1396457_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011888682.1|1396487_1396739_-	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	97.6	2.6e-40
WP_011054585.1|1396809_1396995_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1397161_1397401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888681.1|1397498_1398218_-	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
WP_014635614.1|1398245_1398458_-	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011888679.1|1398655_1398997_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_023605207.1|1398980_1399367_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	1.9e-53
WP_014635616.1|1399381_1400803_+	DUF4041 domain-containing protein	NA	M1PLF9	Streptococcus_phage	74.1	1.0e-136
WP_011018152.1|1400984_1402151_+|integrase	tyrosine-type recombinase/integrase	integrase	C5J953	Streptococcus_phage	42.4	2.4e-80
1416756:1416773	attR	CATCTTCTTCAACTTTTT	NA	NA	NA	NA
