The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	859783	913031	2305354	tRNA,transposase	Bacillus_phage(11.76%)	53	NA	NA
WP_106381554.1|859783_860606_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	1.1e-13
WP_021114059.1|860647_860989_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035494232.1|862570_862969_+	MliC family protein	NA	NA	NA	NA	NA
WP_021114060.1|862977_864030_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_021114061.1|864125_864713_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082259123.1|864883_866542_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	35.1	4.5e-80
WP_082259124.1|866672_867680_+	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_082259125.1|867882_868866_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.3	1.0e-07
WP_021119219.1|868867_869347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043896724.1|869371_869725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021119221.1|869726_870470_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_082259126.1|870552_871488_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_010786301.1|871626_872352_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.4	1.4e-14
WP_021119225.1|872467_873754_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_021112752.1|873810_874635_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	2.5e-31
WP_021112732.1|874908_875349_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_106379919.1|875348_875879_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005713118.1|876184_876514_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_021114066.1|876588_877134_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_082259127.1|877158_878940_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	59.1	6.7e-207
WP_082259128.1|878936_879407_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_043896273.1|879581_880145_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	35.6	1.5e-27
WP_082259129.1|880144_881761_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_021112748.1|881940_882963_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_035524442.1|883171_883753_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_021112760.1|883759_884971_+	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	28.4	4.1e-06
WP_035524439.1|885237_888144_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.5	3.7e-21
WP_035489990.1|888220_889864_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010786182.1|889882_890143_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_021114075.1|890827_891646_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_021112761.1|891649_892204_-	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_021112716.1|892203_892734_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_021114076.1|892741_893047_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005713086.1|893039_893495_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_080651487.1|893547_894669_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	2.8e-110
WP_021114078.1|894798_895404_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_021114079.1|895381_896353_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	31.3	2.3e-12
WP_021112759.1|896385_896583_+	cation transporter	NA	NA	NA	NA	NA
WP_082259130.1|896803_897667_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_021116197.1|897781_898753_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_082259131.1|899876_901733_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.7	7.6e-36
WP_021112720.1|901831_903580_-	DNA primase	NA	A0A1S5RG24	Helicobacter_phage	32.7	1.3e-45
WP_005712190.1|903723_903939_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_052317703.1|904108_904513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021114232.1|905891_906539_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	4.1e-13
WP_106379859.1|907086_907392_-|transposase	transposase	transposase	Q716C2	Shigella_phage	57.7	4.0e-27
WP_071610673.1|907446_907872_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.8	8.4e-07
WP_021118421.1|907910_908234_-|transposase	transposase	transposase	Q716C1	Shigella_phage	44.9	3.7e-15
WP_082259132.1|908286_909552_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_021114409.1|909558_910419_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_021114408.1|910504_911458_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_082259133.1|911972_912635_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_082259134.1|912650_913031_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	1183069	1192197	2305354	transposase	uncultured_virus(33.33%)	10	NA	NA
WP_010785899.1|1183069_1183453_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	3.8e-51
WP_010785898.1|1183613_1183937_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	45.8	8.3e-23
WP_082259176.1|1183946_1184468_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005714644.1|1184522_1185542_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.5	5.2e-95
WP_082259177.1|1185647_1186283_+	DUF2625 family protein	NA	NA	NA	NA	NA
WP_082259178.1|1186452_1188309_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	43.2	2.4e-106
WP_010785894.1|1188403_1188745_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010785893.1|1188744_1188939_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_082259179.1|1189071_1190280_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	5.1e-49
WP_071610098.1|1190346_1192197_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-33
>prophage 3
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	1450922	1463907	2305354	tail,capsid,terminase	Mannheimia_phage(72.73%)	11	NA	NA
WP_021113519.1|1450922_1451393_+	DUF4102 domain-containing protein	NA	G9L697	Escherichia_phage	53.9	1.0e-37
WP_082259215.1|1452477_1453713_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	79.2	1.0e-193
WP_082259216.1|1453722_1455120_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	64.8	3.8e-165
WP_021113613.1|1455076_1456726_+|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	64.6	1.9e-200
WP_021111144.1|1456725_1456944_+	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	75.0	1.9e-26
WP_021113612.1|1456943_1457363_+	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	63.2	7.4e-40
WP_082259217.1|1457484_1461135_+	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	35.8	2.4e-134
WP_082259218.1|1461167_1461881_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	55.5	8.4e-68
WP_021113608.1|1461877_1462291_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PH90	Moraxella_phage	53.7	7.1e-35
WP_021113607.1|1462337_1462514_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	8.5e-14
WP_082259425.1|1463208_1463907_+	hypothetical protein	NA	A0A0M3LQ61	Mannheimia_phage	51.8	4.9e-52
>prophage 4
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	1535916	1543093	2305354		uncultured_Mediterranean_phage(16.67%)	6	NA	NA
WP_082259249.1|1535916_1538745_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	5.0e-305
WP_021113523.1|1539047_1539590_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	55.7	4.2e-43
WP_082259251.1|1539750_1541238_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	1.1e-82
WP_026916465.1|1541247_1542468_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	9.7e-40
WP_005712616.1|1542531_1542804_-	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	42.5	2.2e-08
WP_005712614.1|1542814_1543093_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	50.0	5.3e-18
>prophage 5
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	1754965	1763085	2305354	tRNA	Ostreococcus_lucimarinus_virus(14.29%)	8	NA	NA
WP_021113652.1|1754965_1756228_-	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	35.5	2.5e-59
WP_021113653.1|1756247_1756928_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_021112442.1|1757237_1758221_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	7.1e-33
WP_021113654.1|1758376_1760764_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.4e-05
WP_021113655.1|1760780_1761077_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	1.2e-12
WP_021113656.1|1761128_1761641_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	40.0	4.1e-16
WP_021113657.1|1761830_1762484_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.0	1.1e-34
WP_005710639.1|1762500_1763085_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
>prophage 6
NZ_CP020085	Glaesserella parasuis strain CL120103 chromosome, complete genome	2305354	2036576	2206518	2305354	plate,tRNA,transposase,head,protease,tail,capsid,holin,terminase,integrase	Haemophilus_phage(49.49%)	169	2138664:2138692	2204887:2204915
WP_021114518.1|2036576_2037827_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.9	8.3e-119
WP_005711766.1|2037833_2038415_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.9e-62
WP_010787002.1|2038515_2038905_+	SufE family protein	NA	NA	NA	NA	NA
WP_015940024.1|2040117_2040738_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_021114514.1|2040907_2041927_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_021113155.1|2042003_2043002_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_082259365.1|2043130_2045470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113178.1|2048241_2049276_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FAD3	Synechococcus_phage	41.0	6.5e-69
WP_021113163.1|2049463_2050411_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005713875.1|2050412_2050697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021114413.1|2051421_2054238_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.2	6.1e-77
WP_021114412.1|2054742_2056110_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_021114411.1|2056247_2057186_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_021113949.1|2058943_2060035_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_021113950.1|2060131_2060716_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_021112506.1|2061025_2061925_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_082259366.1|2062042_2063878_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_021111109.1|2064160_2064415_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_082259367.1|2064427_2066233_+	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_082259368.1|2066241_2067546_+	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_005712406.1|2067670_2067991_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_082259432.1|2068066_2068708_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	2.5e-26
WP_035521965.1|2068894_2070322_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005712400.1|2070372_2070576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082259369.1|2070600_2072487_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.4	6.6e-112
WP_021113958.1|2072677_2074117_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_005712395.1|2074236_2074713_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_016057747.1|2075345_2076065_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	100.0	3.2e-131
WP_005822937.1|2076260_2076530_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	100.0	7.6e-46
WP_082259370.1|2076539_2078516_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	F6MII5	Haemophilus_phage	99.4	0.0e+00
WP_016057749.1|2078525_2078948_+	hypothetical protein	NA	F6MII6	Haemophilus_phage	100.0	1.5e-69
WP_016057750.1|2079031_2079913_+	AAA family ATPase	NA	F6MII7	Haemophilus_phage	100.0	8.0e-161
WP_005711959.1|2079920_2080112_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	100.0	3.9e-28
WP_035494590.1|2080113_2080407_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	95.9	6.1e-49
WP_042905508.1|2080418_2080943_+	host-nuclease inhibitor Gam family protein	NA	F6MIJ0	Haemophilus_phage	99.4	9.8e-90
WP_157833079.1|2081242_2081434_+	ANR family transcriptional regulator	NA	F6MIJ1	Haemophilus_phage	85.5	1.5e-24
WP_173479957.1|2081444_2081618_+	hypothetical protein	NA	F6MIJ2	Haemophilus_phage	98.2	2.6e-23
WP_082259371.1|2081632_2081944_+	hypothetical protein	NA	F6MIJ3	Haemophilus_phage	94.2	4.5e-50
WP_035494643.1|2081936_2082524_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	57.3	8.2e-61
WP_016057756.1|2082525_2082903_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	100.0	1.4e-66
WP_082259372.1|2083069_2083633_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	95.2	1.5e-96
WP_082259373.1|2083613_2084036_+	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	97.1	4.3e-72
WP_082259374.1|2084136_2084577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035494654.1|2084760_2085441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711943.1|2085579_2086005_+	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	100.0	1.1e-75
WP_082259375.1|2086083_2086626_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	98.9	1.1e-104
WP_005711941.1|2086764_2086995_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	100.0	1.1e-34
WP_035491006.1|2086991_2087345_+	DUF2681 domain-containing protein	NA	F6MIK1	Haemophilus_phage	94.9	5.6e-49
WP_082259376.1|2087507_2087768_+	hypothetical protein	NA	F6MIK4	Haemophilus_phage	95.1	1.8e-12
WP_016528480.1|2087764_2088019_+	hypothetical protein	NA	F6MIK5	Haemophilus_phage	97.6	4.7e-21
WP_005711932.1|2088019_2088529_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	100.0	3.6e-89
WP_035512043.1|2088631_2090248_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	98.9	0.0e+00
WP_082259377.1|2090334_2091960_+	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	96.4	6.0e-311
WP_035522915.1|2091946_2093269_+|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	76.2	2.5e-182
WP_016057769.1|2093410_2093827_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	100.0	1.9e-72
WP_082259433.1|2094065_2095142_+|protease	phage protease	protease	B7SDN9	Haemophilus_phage	98.0	3.2e-196
WP_082259378.1|2095141_2096065_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SDP1	Haemophilus_phage	97.7	1.8e-171
WP_082259379.1|2096120_2096474_+	transcriptional regulator	NA	B7SDP3	Haemophilus_phage	89.7	1.6e-51
WP_051617433.1|2096476_2096953_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	95.6	1.9e-79
WP_005711909.1|2097585_2097765_+	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	93.2	1.4e-24
WP_157888992.1|2097773_2099189_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	98.1	7.1e-252
WP_005711906.1|2099198_2099573_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	99.2	7.3e-63
WP_005711904.1|2099572_2099929_+	hypothetical protein	NA	F6MIK9	Haemophilus_phage	100.0	1.9e-60
WP_020997281.1|2099958_2100153_+	hypothetical protein	NA	F6MIL0	Haemophilus_phage	100.0	6.7e-20
WP_082259381.1|2100198_2102562_+|tail	phage tail tape measure protein	tail	F6MIL1	Haemophilus_phage	94.9	0.0e+00
WP_082259382.1|2102562_2103918_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	95.8	2.4e-249
WP_005711897.1|2103922_2105047_+	hypothetical protein	NA	F6MIL3	Haemophilus_phage	97.3	4.2e-199
WP_005711896.1|2105043_2105694_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	86.1	2.5e-95
WP_021115447.1|2105798_2106149_+	phage GP46 family protein	NA	F6MIL5	Haemophilus_phage	99.1	1.2e-59
WP_082259383.1|2106160_2107222_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	96.6	3.4e-190
WP_078208787.1|2107218_2107797_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	97.9	2.6e-107
WP_082259384.1|2109879_2110446_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.6	1.6e-98
WP_026916661.1|2110438_2110906_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	100.0	6.0e-91
WP_016057790.1|2111055_2111169_+	Com family DNA-binding transcriptional regulator	NA	F6MIM1	Haemophilus_phage	100.0	9.2e-14
WP_005714585.1|2111223_2112057_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	100.0	6.2e-163
WP_005714586.1|2112097_2112358_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	97.7	1.6e-40
WP_078208690.1|2113524_2113692_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_016527528.1|2113828_2114635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	1.5e-20
WP_021113961.1|2114638_2116594_-	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	9.5e-13
WP_021111125.1|2116593_2117547_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021113962.1|2117722_2119306_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021111127.1|2119525_2119993_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.2	2.7e-46
WP_005712106.1|2120074_2120911_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_021109841.1|2121005_2121410_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015939630.1|2121921_2123448_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_021113963.1|2123565_2125467_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_021113964.1|2125463_2126000_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010786219.1|2125996_2126389_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_021113965.1|2126381_2127128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021113966.1|2127194_2128217_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	2.5e-25
WP_021113967.1|2128218_2129871_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_021113968.1|2130032_2131058_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021113969.1|2131684_2133082_+	heme-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021113970.1|2133262_2133532_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_021113971.1|2133663_2134983_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	35.2	1.2e-30
WP_021113972.1|2135165_2137040_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021113973.1|2137508_2138612_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.1	1.0e-51
2138664:2138692	attL	TAACGGACACACGCAGTGTGTCCCTACAA	NA	NA	NA	NA
WP_021113974.1|2138702_2139347_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.5	9.4e-42
WP_021113975.1|2139477_2140677_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.2	2.4e-99
WP_042905789.1|2140769_2141231_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.8	1.3e-42
WP_082259385.1|2141342_2142134_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	1.8e-10
WP_021113978.1|2142133_2143069_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
WP_005712153.1|2143262_2143481_+	YgjV family protein	NA	NA	NA	NA	NA
WP_005712157.1|2143759_2145181_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_005712159.1|2145308_2146163_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.5	1.8e-32
WP_082259386.1|2146565_2147621_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	36.8	1.1e-58
WP_078208700.1|2147524_2147830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062924288.1|2148147_2148363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113984.1|2148567_2149368_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.3	5.6e-12
WP_012621817.1|2149935_2150154_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	77.8	5.2e-21
WP_157834279.1|2150446_2150614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113985.1|2150839_2151106_+	CRISPR associated Cas2 family protein	NA	NA	NA	NA	NA
WP_021113986.1|2151102_2151339_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	41.0	2.4e-11
WP_021112699.1|2152070_2152277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021118903.1|2152305_2152740_-	hypothetical protein	NA	Q7Y5W7	Haemophilus_phage	60.4	2.5e-38
WP_021113989.1|2152749_2153637_-	hypothetical protein	NA	Q7Y5W6	Haemophilus_phage	32.1	5.8e-26
WP_021113990.1|2153740_2154409_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHY1	Moraxella_phage	27.1	2.4e-16
WP_021113991.1|2154551_2154767_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	55.6	5.0e-08
WP_021118902.1|2154787_2155033_+	bacteriophage CII family protein	NA	A0A0M3LTF5	Mannheimia_phage	62.5	9.7e-16
WP_021110739.1|2155754_2156540_+	replication protein	NA	A0A0M3LS90	Mannheimia_phage	71.3	2.7e-27
WP_082259387.1|2156539_2157211_+|holin	holin	holin	D0UIL4	Aggregatibacter_phage	37.2	1.1e-37
WP_078208831.1|2157211_2157772_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	54.0	4.8e-50
WP_080698141.1|2158073_2158523_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	60.0	5.3e-44
WP_021113997.1|2158556_2158970_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	55.5	1.4e-38
WP_005715063.1|2158996_2159179_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	74.6	4.5e-18
WP_035522926.1|2159426_2160005_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	55.1	9.9e-51
WP_035522928.1|2159994_2160456_+	antitermination protein	NA	A0A0M3LPW4	Mannheimia_phage	38.4	1.8e-18
WP_035523043.1|2160725_2161013_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	55.0	1.2e-12
WP_021114001.1|2160987_2161533_+	lysozyme	NA	Q19UR6	Mannheimia_phage	48.1	3.0e-41
WP_021114002.1|2161505_2161850_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	56.2	3.7e-05
WP_021118468.1|2162414_2162930_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	69.7	3.5e-55
WP_082259388.1|2162913_2164149_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	79.5	7.7e-194
WP_082259389.1|2164158_2165556_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	64.6	1.5e-164
WP_021114006.1|2165512_2165920_+	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	65.9	2.7e-39
WP_010786638.1|2166135_2167059_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.7	6.0e-74
WP_021114007.1|2167060_2167945_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	54.3	1.2e-36
WP_010786640.1|2167935_2168124_-	Mu protein C/ Mor gp17 transcription regulator	NA	Q6QIE8	Burkholderia_phage	53.4	1.5e-08
WP_021114008.1|2168095_2168263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082259390.1|2168917_2169559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021114010.1|2169569_2169791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082259391.1|2169854_2170817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043896572.1|2170916_2171255_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_082259392.1|2173223_2176877_+	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	35.4	7.7e-133
WP_082259393.1|2176909_2177623_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	55.5	8.4e-68
WP_005714478.1|2177619_2177901_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.6	2.3e-08
WP_016527932.1|2177912_2178191_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_157888994.1|2178870_2179569_+	hypothetical protein	NA	A0A0M3LQ61	Mannheimia_phage	51.3	3.1e-51
WP_082259394.1|2179867_2180248_+	YacL family protein	NA	NA	NA	NA	NA
WP_082259395.1|2180324_2183318_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_021111730.1|2184341_2184767_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_035496779.1|2185065_2186502_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_021119057.1|2186671_2187013_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082259396.1|2187169_2187772_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_082259397.1|2187838_2188933_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_021119054.1|2189006_2189420_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_082259398.1|2190179_2190614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005713131.1|2190801_2191281_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_157888996.1|2193551_2194272_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082259399.1|2195310_2197038_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.6	3.0e-87
WP_078208432.1|2197074_2197692_+	VOC family protein	NA	NA	NA	NA	NA
WP_021112925.1|2197712_2198177_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_035497322.1|2198206_2198467_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_021112950.1|2198991_2199798_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_021112908.1|2199917_2200592_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	57.7	3.0e-59
WP_082259400.1|2201177_2202035_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.6	1.3e-54
WP_021113768.1|2202375_2203272_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021113767.1|2203547_2204834_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_021112921.1|2204928_2205981_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
2204887:2204915	attR	TAACGGACACACGCAGTGTGTCCCTACAA	NA	NA	NA	NA
WP_021112912.1|2206062_2206518_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
