The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	1406148	1465489	5112484	terminase,holin,transposase,tRNA,integrase,head,tail	Salmonella_phage(47.83%)	72	1410295:1410313	1475744:1475762
WP_000997403.1|1406148_1407186_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1407233_1407923_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1408227_1408611_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1408666_1409254_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001443508.1|1409356_1410238_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1410295:1410313	attL	ATGCCGGATGCGGCGTGAA	NA	NA	NA	NA
WP_064482910.1|1410474_1411455_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000219193.1|1411725_1413060_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|1413191_1413929_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001094499.1|1413913_1415536_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1415791_1415947_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1415943_1416519_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1416551_1417202_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1417201_1418158_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589068.1|1418154_1418634_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1418831_1420631_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1420646_1421621_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1421893_1422574_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020739.1|1422570_1423476_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|1423487_1424216_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1424227_1424959_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|1424958_1425339_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1425759_1425840_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000054752.1|1426033_1426294_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001138334.1|1426508_1427906_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291430.1|1427902_1428103_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314214.1|1428099_1429494_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	4.9e-213
WP_032314215.1|1429537_1430344_-	DNA-binding protein	NA	B1GS65	Salmonella_phage	54.8	7.4e-20
WP_000043908.1|1430696_1431026_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001382380.1|1430994_1431171_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080025922.1|1431167_1431437_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	1.5e-25
WP_000637724.1|1431426_1431726_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_032314216.1|1431722_1431938_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080025923.1|1431943_1434007_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.5	2.5e-274
WP_032314218.1|1434033_1434633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314219.1|1434659_1435208_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.0e-65
WP_032314220.1|1435223_1436525_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	2.3e-132
WP_021580224.1|1436527_1437430_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_033816084.1|1438209_1438902_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_000708850.1|1439015_1439198_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314221.1|1439190_1441377_+	replication protein	NA	B6SCY1	Bacteriophage	72.9	4.9e-175
WP_032314222.1|1441663_1442098_+	antitermination protein Q	NA	B6SD39	Bacteriophage	62.9	1.1e-41
WP_000781776.1|1442501_1442843_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194117.1|1442846_1443323_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	1.0e-85
WP_000779566.1|1443306_1443831_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|1443892_1444465_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|1444467_1446090_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_032314223.1|1446089_1447556_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	2.5e-260
WP_136759112.1|1447446_1448181_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_032314224.1|1448195_1449416_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.3	4.0e-203
WP_021580222.1|1449419_1449926_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	6.4e-70
WP_032314225.1|1449937_1450879_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_001107515.1|1450920_1451142_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001125663.1|1451107_1451515_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	2.5e-69
WP_000008729.1|1451511_1452066_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.0e-80
WP_032314226.1|1452052_1452442_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000503647.1|1452416_1452980_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_023565717.1|1452983_1454129_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.8e-160
WP_000109249.1|1454139_1454580_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032314228.1|1454583_1455036_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_032314230.1|1455213_1457202_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.3	3.7e-270
WP_001420197.1|1457201_1457789_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155113.1|1457788_1458091_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	4.1e-48
WP_032314231.1|1458093_1459155_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	4.5e-158
WP_032314234.1|1459158_1459500_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.3	1.8e-31
WP_032314235.1|1459636_1460368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314236.1|1460367_1460790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314237.1|1460853_1461606_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	1.6e-88
WP_001270636.1|1461605_1461959_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_032314238.1|1461958_1463158_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	83.4	4.9e-185
WP_032314239.1|1463154_1463835_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	1.0e-102
WP_033816086.1|1463834_1464911_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	66.3	3.8e-64
WP_033816087.1|1464910_1465489_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.3e-95
1475744:1475762	attR	TTCACGCCGCATCCGGCAT	NA	NA	NA	NA
>prophage 2
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	1920646	2029549	5112484	terminase,holin,capsid,transposase,protease,tRNA,integrase,head,tail	Stx2-converting_phage(39.77%)	119	1923121:1923141	1982151:1982171
WP_000569361.1|1920646_1921573_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1921577_1922309_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1922289_1922397_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1922456_1923158_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
1923121:1923141	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1923178_1924465_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1924498_1924753_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556584.1|1924771_1924906_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	9.3e-21
WP_000457728.1|1924909_1925152_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000207998.1|1925239_1926070_-	DUF550 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	91.4	6.6e-48
WP_000582233.1|1926080_1926836_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	3.2e-142
WP_001289866.1|1926837_1927476_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	97.2	5.2e-93
WP_000763376.1|1927472_1927694_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	2.9e-35
WP_001386642.1|1927792_1928074_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1928084_1928276_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|1928248_1928431_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000186851.1|1928427_1929108_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_015971133.1|1929104_1929890_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	100.0	4.8e-149
WP_000995439.1|1929895_1930192_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1930267_1930411_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1930379_1930544_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1930616_1930985_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|1931135_1931606_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001479835.1|1931664_1932048_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000687675.1|1932519_1932924_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1932920_1933577_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1933573_1933861_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1933997_1934702_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1934815_1935049_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|1935187_1935484_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032314820.1|1935516_1936455_+	replication protein	NA	A0A0P0ZCK0	Stx2-converting_phage	100.0	1.4e-171
WP_032208536.1|1936451_1937153_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	6.4e-129
WP_000145907.1|1937149_1937440_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1937510_1937789_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1937921_1938137_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1938147_1938384_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1938340_1938787_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1938783_1939311_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1939307_1939490_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1939764_1940499_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1940573_1941296_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1941295_1941901_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1941897_1942092_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1942084_1942519_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1943025_1943973_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1943982_1944252_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|1944751_1946689_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|1946824_1947004_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|1947044_1947317_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|1947393_1947609_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|1947613_1947958_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|1948008_1948542_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|1948812_1949382_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1949381_1949528_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1949755_1949941_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1950365_1950593_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1950634_1951000_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|1951290_1951854_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015971136.1|1951850_1953512_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	100.0	0.0e+00
WP_000172990.1|1953575_1955513_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1955557_1955779_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1958467_1958794_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1958803_1959154_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1959150_1959597_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1959593_1959938_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1959996_1960713_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1960718_1961093_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1961188_1961398_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_033816001.1|1961449_1964692_+|tail	phage tail tape measure protein	tail	Q6H9T7	Enterobacteria_phage	97.5	0.0e+00
WP_000807954.1|1964684_1965026_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032254123.1|1965025_1965724_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	2.4e-131
WP_001302649.1|1965740_1966061_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1966168_1966342_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_032317450.1|1966412_1967336_+	antirepressor	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	2.3e-174
WP_080025930.1|1967390_1968128_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	97.6	2.5e-147
WP_072141513.1|1968073_1968706_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_080025931.1|1972494_1973094_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	7.0e-108
WP_000741894.1|1973153_1974470_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.9	3.1e-76
WP_001101703.1|1974471_1974741_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_072165077.1|1975664_1976270_+	secretion protein EspS	NA	Q4A521	Enterobacteria_phage	99.5	4.7e-112
WP_106904300.1|1976358_1977571_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_080025933.1|1978555_1979932_-	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	91.5	5.0e-218
WP_001295431.1|1982439_1984125_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
1982151:1982171	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1984121_1984841_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1984887_1985358_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1985398_1985860_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001443371.1|1985984_1987985_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001294362.1|1989109_1991389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314683.1|1991399_1992488_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636944.1|1992794_1993112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314684.1|1993173_1996806_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_032314685.1|1996815_2000610_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|2000750_2002784_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2002915_2004025_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|2004287_2004569_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|2004861_2005404_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|2005484_2006159_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032314686.1|2006174_2008655_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033815855.1|2008670_2009705_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2009786_2010125_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_032314688.1|2010343_2011192_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019942.1|2011312_2011585_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195623.1|2011807_2012596_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822266.1|2012592_2013393_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001352238.1|2013457_2014276_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|2014327_2015074_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011956.1|2015047_2016013_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846233.1|2016009_2017014_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858505.1|2017010_2018288_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|2018544_2019597_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|2019904_2020759_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853861.1|2020787_2022050_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|2022059_2022512_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|2022542_2022827_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|2022830_2024186_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844220.1|2024233_2025274_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|2025373_2026153_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|2026234_2027134_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001397258.1|2027539_2027857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476036.1|2028187_2029549_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.4e-217
>prophage 3
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	2144077	2232942	5112484	terminase,holin,capsid,transposase,portal,integrase,head,tail	Escherichia_phage(42.19%)	102	2128581:2128598	2179725:2179742
2128581:2128598	attL	TTGCAGGCGCTTTCGCAC	NA	NA	NA	NA
WP_106904303.1|2144077_2145290_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001300307.1|2148569_2149367_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_032314802.1|2149602_2150628_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	7.5e-102
WP_000096346.1|2150627_2150831_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001090200.1|2153454_2153646_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2153642_2153831_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|2154401_2154611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|2154611_2155250_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|2155261_2155414_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|2155680_2156100_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|2156199_2156481_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|2156464_2156890_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|2156961_2158044_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|2158050_2158797_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_033815917.1|2158818_2159535_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	3.1e-70
WP_042353845.1|2159567_2159849_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|2159845_2160073_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|2160065_2160377_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|2160504_2160723_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2160724_2161282_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2161515_2161728_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2161847_2162192_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2162313_2162586_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2162587_2163637_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|2163649_2164009_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_080025935.1|2164017_2164572_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	2.3e-65
WP_000917763.1|2164796_2164994_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2165129_2165843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2166293_2166725_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|2167074_2167218_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_080025936.1|2167203_2169141_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143464.1|2169277_2169457_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|2169497_2169770_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|2169846_2170062_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001092860.1|2170624_2171158_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_045904330.1|2171428_2171998_+	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000539795.1|2171997_2172144_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2172366_2172552_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2173077_2173392_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2173473_2173698_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_033816199.1|2174083_2174629_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027269.1|2174603_2176529_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2176525_2176732_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033816198.1|2176728_2178330_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123236.1|2178310_2179630_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|2179639_2179972_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
2179725:2179742	attR	GTGCGAAAGCGCCTGCAA	NA	NA	NA	NA
WP_032314870.1|2180027_2181053_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_000158899.1|2181094_2181490_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|2181501_2181855_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_033816197.1|2181866_2182445_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683137.1|2182441_2182837_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_033816257.1|2182844_2183597_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.4e-134
WP_000479105.1|2183610_2184042_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_062864850.1|2184068_2184473_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	3.4e-42
WP_080025937.1|2184453_2187033_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000847304.1|2187029_2187359_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_080025938.1|2187358_2188057_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_064482874.1|2188067_2188811_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_072141513.1|2188756_2189389_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_080025939.1|2189635_2193112_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_001230383.1|2193178_2193778_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.4e-108
WP_064482855.1|2193837_2195109_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	88.4	1.2e-69
WP_001401301.1|2195130_2195379_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_001079090.1|2198068_2198599_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001317164.1|2198941_2199613_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|2199848_2200484_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740094.1|2200484_2201489_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2201597_2202011_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2202143_2202815_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826749.1|2202814_2204173_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218204.1|2204280_2205132_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824367.1|2205723_2206797_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	3.1e-98
WP_001313057.1|2207362_2207728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365559.1|2207767_2208463_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|2208529_2209948_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786005.1|2209928_2210399_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212248.1|2210387_2211308_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|2211480_2212398_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2212476_2212659_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001349973.1|2212829_2214524_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491497.1|2214520_2215336_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2215633_2215861_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|2215969_2216212_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|2216255_2216879_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_032314571.1|2217168_2217954_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2217962_2218232_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2218241_2218979_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001299290.1|2218978_2219344_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2219346_2219760_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2219756_2220761_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|2220765_2221230_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620091.1|2221334_2222462_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807661.1|2222458_2222902_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_032314572.1|2222920_2224294_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282685.1|2224293_2224980_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2224972_2225968_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994405.1|2225960_2227619_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|2227833_2228148_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2228481_2228814_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|2228982_2229534_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|2229543_2230341_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064734585.1|2231733_2232942_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.3e-209
>prophage 4
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	2747253	2868938	5112484	terminase,holin,transposase,protease,lysis,portal,tRNA,integrase,tail	Escherichia_phage(43.94%)	120	2807278:2807303	2863577:2863602
WP_071606909.1|2747253_2748462_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	2.4e-208
WP_001261020.1|2748993_2749662_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2749963_2750557_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001190278.1|2750553_2751546_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234034.1|2751669_2752650_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140891.1|2752644_2753181_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2753243_2753468_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2753607_2755263_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013789.1|2755487_2756831_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414560.1|2757047_2757971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032314948.1|2758008_2759649_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2760047_2760197_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2760268_2760442_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001397126.1|2760686_2761217_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000048667.1|2761405_2762407_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115939.1|2762448_2763888_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027938.1|2764085_2764886_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139563.1|2765157_2769060_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2769260_2769866_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000890932.1|2772998_2773895_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177543.1|2773894_2774500_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097840.1|2774798_2775659_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|2775888_2776479_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039888.1|2776460_2777411_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_105466968.1|2777660_2778873_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_052085551.1|2778876_2780139_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206186.1|2780165_2781371_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2781370_2781793_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973358.1|2781782_2783210_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969774.1|2783211_2784000_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|2783999_2784767_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_032314513.1|2784763_2785834_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189194.1|2785841_2786339_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2786353_2787100_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2787108_2787396_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191068.1|2787407_2788337_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186478.1|2788621_2790667_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2790914_2793188_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2793244_2794744_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067512.1|2794979_2795885_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001409348.1|2796056_2796383_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2796390_2796576_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_032314510.1|2796572_2799212_-	YdbH family protein	NA	NA	NA	NA	NA
WP_032314508.1|2799419_2800409_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	43.7	1.6e-69
WP_001298828.1|2800519_2800942_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2800938_2801205_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032314507.1|2801478_2805003_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837962.1|2805369_2806503_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
WP_001295593.1|2806643_2807078_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
2807278:2807303	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_122988840.1|2809110_2809188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101703.1|2809298_2809568_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_045904098.1|2809569_2810883_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001216293.1|2810947_2811571_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_080025944.1|2811637_2815117_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.5	0.0e+00
WP_040062327.1|2815363_2815996_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	99.0	1.8e-106
WP_080025945.1|2815941_2816685_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.0e-145
WP_080025938.1|2816695_2817394_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|2817393_2817723_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_080025946.1|2817719_2820365_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	89.9	0.0e+00
WP_000533450.1|2820408_2820717_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_044707580.1|2820743_2821166_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000235090.1|2821179_2821932_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2821939_2822338_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_001450644.1|2822350_2822974_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_001281347.1|2822976_2823258_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|2823250_2823577_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_122996189.1|2823664_2825689_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.5	0.0e+00
WP_000974576.1|2825633_2827136_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.8	5.4e-290
WP_000102415.1|2827135_2827348_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000133409.1|2828840_2829122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126303322.1|2829240_2829447_-	hypothetical protein	NA	S5M7R1	Escherichia_phage	84.6	3.8e-05
WP_000860403.1|2829379_2831269_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|2831926_2832349_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|2832345_2832591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761774.1|2832878_2834693_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_000728901.1|2834689_2834932_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000335965.1|2835714_2835939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088136225.1|2835931_2836651_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001038670.1|2836631_2837213_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_000229066.1|2837272_2837497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|2837489_2838728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001077621.1|2838889_2839897_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000348565.1|2839893_2840370_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_080025947.1|2840825_2841293_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	96.7	7.9e-75
WP_000455406.1|2841300_2841450_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2841449_2842019_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_080025948.1|2842293_2842827_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	6.7e-102
WP_000284506.1|2842831_2843047_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290233.1|2843123_2843369_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000142777.1|2843409_2843589_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_052933920.1|2843725_2845672_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000640170.1|2847213_2847768_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_000228018.1|2847764_2848055_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000940327.1|2848054_2848654_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	4.5e-107
WP_000818166.1|2849115_2849601_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|2849619_2849799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|2850007_2850220_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_001278450.1|2850408_2850513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206794.1|2850628_2851213_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001141093.1|2851269_2851662_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_000788990.1|2852469_2853216_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000899743.1|2853222_2854080_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000702023.1|2854092_2854515_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000171139.1|2854498_2854774_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|2854878_2855343_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000233812.1|2855578_2855713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169149.1|2855723_2855876_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000935601.1|2856304_2857153_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.8	1.7e-54
WP_000560228.1|2857199_2857421_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000258918.1|2857414_2857591_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	70.7	6.3e-17
WP_001358843.1|2857665_2857941_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.2e-44
WP_000105091.1|2858042_2860715_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	80.6	0.0e+00
WP_000166318.1|2860707_2861517_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
WP_001302840.1|2861760_2861949_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2862048_2862264_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_024185869.1|2862265_2863501_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	6.7e-238
WP_001157382.1|2863552_2864488_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2863577:2863602	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123751.1|2864616_2865990_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	8.6e-53
WP_033816077.1|2866467_2867451_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2867705_2868938_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 5
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	2945481	2996638	5112484	terminase,holin,transposase,protease,head,tail	Escherichia_phage(23.53%)	58	NA	NA
WP_000422045.1|2945481_2946531_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|2946750_2947509_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|2947505_2948096_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2948135_2949008_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2949108_2949729_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2949725_2950607_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2950744_2950789_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|2950880_2952443_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2952442_2954038_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2954041_2955400_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2955411_2956605_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2956604_2957411_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2957791_2957971_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2958056_2958557_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2958602_2959109_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071529157.1|2959610_2959829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|2961405_2962568_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_106425100.1|2963186_2963381_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	8.2e-10
WP_000767050.1|2963325_2963868_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023388.1|2964088_2964358_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	6.4e-45
WP_032314473.1|2964359_2965664_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	87.3	3.0e-71
WP_001216293.1|2965728_2966352_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_074390344.1|2966418_2967645_-	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	99.8	2.0e-218
WP_000998048.1|2967794_2969333_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2969382_2969730_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2969726_2970107_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_155120686.1|2970182_2971363_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.2	8.4e-97
WP_072023064.1|2971383_2971503_-|head	head protein	head	A0A0P0ZAJ3	Stx2-converting_phage	100.0	1.6e-11
WP_085947772.1|2972816_2974029_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_047661669.1|2974485_2975049_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.6	7.1e-86
WP_105466968.1|2975665_2976878_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_000074669.1|2977048_2977273_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2977354_2977669_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_137524955.1|2978193_2978379_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	8.3e-20
WP_047661548.1|2978595_2979093_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|2979092_2979299_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023143.1|2979746_2981597_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001059384.1|2983116_2983806_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_032314810.1|2983828_2984167_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.4e-33
WP_010917803.1|2985225_2985504_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2985573_2985831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2986051_2986264_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2986542_2987301_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|2987999_2988164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2988160_2988895_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001443510.1|2988928_2989351_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	6.5e-76
WP_032314809.1|2989382_2990423_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	5.1e-90
WP_000705622.1|2990394_2990946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2990929_2991157_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2991233_2991641_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2991905_2992205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2992277_2992496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2992518_2992926_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2992903_2993137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2993130_2993298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2993697_2993886_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2993882_2994074_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064482945.1|2994166_2996638_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.8	8.0e-57
>prophage 6
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	3258900	3315691	5112484	holin,transposase,protease,integrase,tail	Enterobacteria_phage(30.56%)	67	3263574:3263633	3300546:3300610
WP_032314674.1|3258900_3259488_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3259484_3260192_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3260210_3262004_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3262000_3263119_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3263574:3263633	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_001443410.1|3263736_3264120_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_080025951.1|3264565_3265600_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001401301.1|3265726_3265975_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_080025952.1|3265996_3267265_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.0	1.8e-73
WP_080025982.1|3268327_3268651_-	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	9.4e-35
WP_155120688.1|3268548_3268686_-	hypothetical protein	NA	Q687E8	Enterobacteria_phage	95.5	2.4e-16
WP_155120691.1|3271558_3272188_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.9	1.7e-101
WP_080025956.1|3272921_3273575_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	86.1	5.7e-95
WP_080025957.1|3273574_3273901_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.7e-53
WP_106904299.1|3275865_3277078_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	7.9e-167
WP_074390350.1|3277062_3277293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303940.1|3277513_3277738_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001303878.1|3277819_3278134_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3278659_3278845_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3279066_3279180_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3279400_3279934_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3280093_3280366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3280621_3280828_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|3281276_3283127_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|3283894_3284608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3284745_3284943_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_033815881.1|3285229_3286048_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3286199_3286571_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3286560_3286932_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3286944_3287994_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|3287995_3288274_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|3288441_3288654_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|3288842_3288947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|3289062_3289932_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|3289942_3290206_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|3290207_3290372_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|3290457_3290670_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|3290720_3291077_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|3291054_3291516_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|3291512_3291809_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151153.1|3291805_3292228_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|3292268_3293339_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|3293410_3293836_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3293832_3294048_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|3294097_3294814_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|3295086_3295239_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|3295250_3295625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3296156_3296345_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3296341_3296533_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064482952.1|3296625_3299097_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	1.0e-59
WP_000273151.1|3299164_3299407_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299701.1|3299384_3300404_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000375136.1|3300811_3301471_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3300546:3300610	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
WP_001397075.1|3301561_3301891_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048233.1|3301887_3302166_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116288.1|3302260_3303451_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|3303508_3303826_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_032314554.1|3303870_3304284_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|3304456_3305119_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|3305214_3305673_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_001397074.1|3305704_3307759_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	5.0e-20
WP_001261235.1|3307881_3308328_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875026.1|3308337_3310500_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000839145.1|3310462_3311092_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|3311310_3311820_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|3312176_3313217_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|3313292_3313745_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_032314553.1|3313930_3315691_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	3391673	3478552	5112484	terminase,capsid,portal,protease,plate,lysis,tRNA,integrase,head,tail	Salmonella_phage(58.18%)	86	3384636:3384651	3481123:3481138
3384636:3384651	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3391673_3392966_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3393056_3394400_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3394410_3395022_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_032314547.1|3395176_3399166_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3399300_3399795_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3400339_3401305_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|3401427_3403194_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3403194_3404916_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3404957_3405662_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3405946_3406165_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3406849_3409126_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3409156_3409477_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3409799_3410024_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_033815909.1|3410096_3412043_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3412039_3413155_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001397058.1|3413305_3414262_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599823.1|3414258_3415917_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001328199.1|3416343_3417039_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3417534_3418434_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458832.1|3418577_3420230_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032314543.1|3420241_3421210_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3421342_3423061_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_016246997.1|3423097_3424099_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3424109_3425540_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3425638_3426652_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3426648_3427479_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3427475_3427799_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3427924_3428440_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3428657_3429386_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3429403_3430135_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033815908.1|3430141_3430858_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3430857_3431526_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3431817_3432549_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149738.1|3432723_3433851_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_000389260.1|3433891_3434380_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3434439_3435285_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3435281_3436235_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_032314541.1|3436244_3437378_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_032314540.1|3437472_3438585_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3438935_3439412_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3439499_3440402_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_032314539.1|3440462_3441185_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3441168_3441456_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3441615_3441873_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681112.1|3441902_3442280_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3442549_3444235_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|3444470_3444689_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032314538.1|3444779_3445880_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
WP_032314536.1|3445876_3446362_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.1e-66
WP_000763311.1|3449428_3449548_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3449562_3449865_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3449919_3450435_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_007866350.1|3450444_3451617_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_032314535.1|3452008_3453130_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	28.2	3.1e-32
WP_032314534.1|3453310_3453730_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	60.0	8.0e-26
WP_033815906.1|3453731_3455153_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	83.2	6.9e-162
WP_032314532.1|3455149_3455755_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268301.1|3455747_3456656_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_032314531.1|3456642_3457002_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.2	8.8e-50
WP_024220192.1|3456998_3457577_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_032314530.1|3457645_3458092_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_021546575.1|3458084_3458516_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_032314528.1|3458611_3459040_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.4e-46
WP_016245845.1|3459036_3459414_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_001442491.1|3459415_3459889_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|3459908_3460124_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3460127_3460331_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3460330_3460795_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|3460890_3461541_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032314526.1|3461544_3462603_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_033815904.1|3462619_3463453_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	1.0e-117
WP_032314523.1|3463595_3465362_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_032314522.1|3465361_3466393_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.9e-170
WP_001059831.1|3468844_3469180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314521.1|3469372_3469606_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	6.1e-36
WP_001154431.1|3469616_3469805_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_032314520.1|3469957_3472372_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
WP_000104175.1|3472368_3473226_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000752619.1|3473222_3473450_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|3473449_3473683_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963473.1|3473750_3474092_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|3474055_3474256_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460897.1|3474263_3474773_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3474805_3475027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033815902.1|3475739_3477416_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	7.5e-83
WP_000290933.1|3477499_3478552_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3481123:3481138	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	3777556	3820207	5112484	integrase,transposase,protease,holin	Enterobacteria_phage(52.5%)	51	3793362:3793408	3820221:3820267
WP_105466968.1|3777556_3778770_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_074390353.1|3778832_3783053_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.3	8.6e-19
WP_001443483.1|3783086_3783350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314806.1|3783362_3784253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080025963.1|3784881_3786018_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383934.1|3786286_3788524_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001396984.1|3788510_3791483_+	phage receptor	NA	NA	NA	NA	NA
WP_001224569.1|3791483_3792374_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|3792556_3793318_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3793362:3793408	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3793830_3794784_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|3794970_3796455_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000075135.1|3796860_3797358_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000411802.1|3797357_3797564_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085947772.1|3798373_3799587_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_080025964.1|3799607_3801122_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.4	4.7e-286
WP_000499454.1|3801419_3801578_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3801663_3802407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314960.1|3802659_3803283_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.4e-111
WP_001028854.1|3803279_3803945_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3803941_3804562_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3804554_3804725_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3804721_3804904_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000153280.1|3804900_3805428_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|3805424_3805865_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145940.1|3805938_3806229_-	protein ren	NA	K7P7K7	Enterobacteria_phage	99.0	8.2e-46
WP_001372464.1|3806225_3806927_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000185506.1|3806923_3807823_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000251067.1|3807855_3808149_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|3808267_3808468_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274762.1|3808568_3809282_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
WP_001207141.1|3809332_3809767_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_001278659.1|3809763_3810366_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	96.6	7.6e-46
WP_001171554.1|3810608_3810989_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3810985_3811333_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998077.1|3811382_3812921_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	1.7e-299
WP_001443534.1|3813242_3813566_+	antitermination protein	NA	K7P718	Enterobacteria_phage	98.1	4.2e-51
WP_001278766.1|3813558_3814053_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000213977.1|3814262_3814463_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_000065358.1|3814645_3815014_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_001198861.1|3815086_3815251_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|3815219_3815363_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995433.1|3815437_3815734_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3815739_3816525_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3816521_3817202_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|3817198_3817360_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|3817352_3817910_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3817920_3818202_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763390.1|3818300_3818519_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|3818566_3818845_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3818816_3819188_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_033816035.1|3819043_3820207_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.4e-197
3820221:3820267	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	4065750	4128768	5112484	transposase,capsid,holin	Enterobacteria_phage(23.08%)	54	NA	NA
WP_000131043.1|4065750_4067784_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|4067912_4068500_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|4068513_4069986_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159099.1|4069999_4071670_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.6e-61
WP_001209103.1|4071882_4072551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370300.1|4072793_4073489_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001102114.1|4074918_4075638_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4076164_4077019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|4077244_4078570_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|4078678_4078915_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032314451.1|4078926_4079520_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001396940.1|4079679_4080549_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_032314452.1|4080797_4081655_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314453.1|4081775_4086029_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4087144_4087246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803990.1|4087611_4087875_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4087874_4088015_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|4088049_4088277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|4089099_4089642_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4089716_4090304_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4090361_4091030_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131094.1|4091055_4093581_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001323478.1|4093570_4095214_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_033815808.1|4095182_4095893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|4096205_4096535_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4096782_4097397_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|4097814_4098504_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643323.1|4098500_4099457_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667027.1|4099453_4101652_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
WP_000121330.1|4101661_4102618_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_080025970.1|4102596_4103007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904303.1|4103834_4105048_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_000179449.1|4105964_4106678_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.3	1.9e-48
WP_032314455.1|4106712_4108542_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.4	1.6e-30
WP_001308407.1|4108560_4108761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314456.1|4108847_4109876_-|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_074014476.1|4109891_4110089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155120689.1|4110138_4111300_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.2e-50
WP_032314825.1|4111511_4111724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314826.1|4112068_4112404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129165.1|4112405_4112816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314827.1|4112945_4113224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314828.1|4113240_4113930_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314829.1|4114173_4114362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314830.1|4116391_4116931_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.1	1.6e-26
WP_000893255.1|4118335_4119589_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|4119600_4120704_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|4120991_4122047_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|4122085_4122487_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_032314831.1|4122544_4123789_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4123880_4124339_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|4124599_4126057_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4126113_4126728_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001358663.1|4127571_4128768_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	4155851	4201228	5112484	transposase,tRNA,plate	Cronobacter_phage(14.29%)	36	NA	NA
WP_000611742.1|4155851_4156265_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4156268_4158119_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4158082_4159165_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4159189_4160470_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4160466_4160991_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246415.1|4160993_4162325_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|4162329_4163091_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_033815975.1|4163099_4165883_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	2.0e-80
WP_000088862.1|4165879_4166623_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|4166627_4168040_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122996187.1|4168148_4171583_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_106904303.1|4172168_4173381_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_096844020.1|4173365_4174259_+	VasL domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|4174282_4174765_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032314855.1|4174808_4175723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4175732_4176212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4177669_4178401_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4178465_4178933_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|4178929_4179652_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|4179685_4180441_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4180512_4181871_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211688.1|4181919_4182690_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4182767_4183568_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|4183808_4184723_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|4184719_4185523_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140175.1|4191421_4191997_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4192184_4193216_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4193208_4193862_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4193901_4194717_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4194834_4195239_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094018.1|4195235_4195943_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260721.1|4196053_4197772_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032314432.1|4197824_4198649_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4198851_4199832_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239173.1|4200081_4200792_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4200805_4201228_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	4416786	4495506	5112484	terminase,holin,capsid,transposase,portal,tRNA,integrase,head,tail	Enterobacteria_phage(35.59%)	88	4459657:4459671	4496692:4496706
WP_001223164.1|4416786_4417473_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4417872_4418013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4418108_4418825_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920323.1|4418884_4420237_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|4420294_4421719_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188666.1|4421718_4422408_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4422420_4422894_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4423104_4423974_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4423970_4424618_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001338221.1|4424669_4425182_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4425223_4425550_-	trp operon repressor	NA	NA	NA	NA	NA
WP_032314751.1|4425639_4427577_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4427787_4429455_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4429761_4430994_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|4431014_4432397_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4432445_4433414_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_033815939.1|4433519_4434164_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|4434191_4435208_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4435663_4436383_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4436462_4437686_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|4437737_4439060_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_001295412.1|4439186_4439966_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143248.1|4440223_4441774_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088395.1|4441745_4442609_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563066.1|4442721_4443504_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4443500_4444574_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4444695_4444857_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4444983_4445589_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4445981_4447568_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4447787_4448036_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_085947598.1|4448124_4449287_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001372053.1|4449723_4449837_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|4449905_4450139_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|4450518_4451109_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_032314750.1|4451206_4451782_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	9.4e-102
WP_033815940.1|4451781_4455135_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_064217532.1|4455199_4455799_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	6.3e-109
WP_062874753.1|4455865_4459264_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000090873.1|4459323_4459956_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
4459657:4459671	attL	GGCAATGGCGGCAGC	NA	NA	NA	NA
WP_064482969.1|4459892_4460636_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	1.5e-144
WP_080025938.1|4460646_4461345_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847304.1|4461344_4461674_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_062874814.1|4461670_4464232_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	87.8	0.0e+00
WP_000459457.1|4464224_4464659_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|4464640_4465063_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001345558.1|4465078_4465819_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000683138.1|4465826_4466222_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_033816197.1|4466218_4466797_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000753019.1|4466808_4467162_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|4467173_4467569_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_032314870.1|4467610_4468636_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_001299443.1|4468691_4469024_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_080025973.1|4469033_4470353_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	5.8e-232
WP_033816198.1|4470333_4471935_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|4471931_4472138_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|4472134_4474060_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_033816199.1|4474034_4474580_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001300120.1|4474968_4475163_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000548592.1|4475413_4475620_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|4475915_4476089_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|4476261_4476417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4476564_4476753_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4476763_4476976_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4477339_4477837_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4477833_4478367_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_106904303.1|4478715_4479929_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_074390338.1|4480001_4480553_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	2.9e-36
WP_000839581.1|4480557_4480773_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066486.1|4481525_4481741_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000087755.1|4482041_4482254_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122632654.1|4482308_4482398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047103.1|4482676_4483429_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_001519432.1|4483442_4484432_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_032314364.1|4484439_4485237_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.2e-150
WP_000767115.1|4485256_4485646_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210173.1|4485642_4485969_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000066918.1|4485965_4486619_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_001331408.1|4486618_4487113_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
WP_000104943.1|4487109_4488051_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|4488040_4488220_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001440240.1|4488395_4488947_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_032314368.1|4488939_4489200_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	97.7	1.0e-39
WP_032314369.1|4489297_4489990_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	9.5e-125
WP_000549626.1|4490336_4490543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|4490514_4490949_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_021537118.1|4491493_4492030_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_021537117.1|4492991_4494011_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_032314370.1|4494282_4495506_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.8	1.2e-236
4496692:4496706	attR	GGCAATGGCGGCAGC	NA	NA	NA	NA
>prophage 12
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	4733788	4742896	5112484	transposase,protease	Stx2-converting_phage(66.67%)	6	NA	NA
WP_000422741.1|4733788_4734214_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4734210_4734561_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032314460.1|4735873_4737445_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624626.1|4737464_4737812_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	7.5e-46
WP_000993931.1|4737811_4738462_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	1.8e-16
WP_033816012.1|4738996_4742896_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	1.6e-237
>prophage 13
NZ_CP020092	Escherichia coli strain 13E0725 chromosome, complete genome	5112484	4823368	4871743	5112484	terminase,holin,capsid,portal,tRNA,integrase,head,tail	Enterobacteria_phage(39.22%)	59	4818747:4818761	4832488:4832502
4818747:4818761	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_000918363.1|4823368_4824784_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|4824866_4825850_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891402.1|4826015_4826258_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|4826391_4827429_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|4827517_4828615_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_001217547.1|4828676_4828925_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.8	1.2e-37
WP_099561169.1|4829061_4829184_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001132160.1|4829170_4829761_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144078.1|4829942_4830593_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.1e-25
WP_000442133.1|4830744_4831167_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.8	2.5e-72
WP_001023455.1|4831327_4831597_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_074390343.1|4831598_4832903_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	97.3	1.8e-71
4832488:4832502	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_047661541.1|4832967_4833567_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q6H9T1	Enterobacteria_phage	99.5	3.3e-110
WP_080025977.1|4833633_4837032_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	86.9	0.0e+00
WP_123123568.1|4837267_4837900_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.2e-103
WP_053895436.1|4837845_4838589_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_001357740.1|4838599_4839298_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|4839297_4839627_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_047661462.1|4839623_4842203_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.8	0.0e+00
WP_000533402.1|4842183_4842597_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|4842623_4843055_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235110.1|4843068_4843821_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|4843828_4844224_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974985.1|4844220_4844754_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204560.1|4844769_4845123_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201512.1|4845115_4845499_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|4845550_4846579_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256821.1|4846636_4846984_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253987.1|4847020_4848526_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001397759.1|4848515_4850108_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_000259002.1|4850104_4850311_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032314862.1|4850294_4852223_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.0e-261
WP_000235436.1|4852194_4852704_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001303940.1|4853095_4853320_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|4853401_4853716_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|4854242_4854428_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|4854650_4854797_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|4854796_4855366_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|4855636_4856170_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000411802.1|4856568_4856775_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_080025978.1|4857222_4859073_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000917759.1|4860251_4860404_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	1.1e-17
WP_001204806.1|4860619_4861000_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_001443262.1|4861017_4862007_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.0e-192
WP_001223333.1|4862016_4862532_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_032314711.1|4862547_4863363_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	1.1e-148
WP_000767110.1|4863514_4863910_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210151.1|4863906_4864233_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_001355692.1|4864229_4864883_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_024145951.1|4864977_4865346_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	5.1e-69
WP_001250270.1|4865926_4866139_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000515867.1|4866314_4866866_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	9.9e-101
WP_000649477.1|4866909_4867110_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859461.1|4867200_4867875_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.6	1.3e-131
WP_000135680.1|4868541_4868904_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081299.1|4868969_4869794_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	5.0e-149
WP_000008182.1|4869921_4870446_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-96
WP_001075213.1|4870554_4871421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093922.1|4871461_4871743_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	94.6	2.0e-41
