The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	360	36212	5351479	tail,portal,integrase,coat,terminase,lysis,capsid,head,plate	Salmonella_phage(83.33%)	47	1306:1352	37873:37919
WP_002914164.1|360_843_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1306:1352	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|1446_1824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|1851_2070_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|2136_3231_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|3227_3713_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|3709_6340_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|6332_6452_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|6466_6766_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|6818_7334_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|7343_8516_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|8664_9738_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|9789_10908_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|10917_12867_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|12868_13540_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|13532_14441_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|14427_14790_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|14786_15359_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|15453_16320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|16342_16789_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|16781_17204_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|17299_17728_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|17724_18108_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|18112_18622_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|18602_18818_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|18821_19025_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|19024_19489_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|19584_20238_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|20241_21294_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|21310_22144_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|22284_24048_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|24047_25091_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|25147_25417_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|25938_26940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|26939_28019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|28005_28689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|28784_29018_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|29029_29218_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|29380_31765_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|31761_32613_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|32609_32837_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|32836_33070_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|33137_33476_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|33439_33640_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|33647_34157_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|34189_34432_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|34554_35184_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|35186_36212_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
37873:37919	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	756569	805412	5351479	tail,protease,portal,terminase,tRNA,capsid,head	uncultured_Caudovirales_phage(66.67%)	54	NA	NA
WP_002918465.1|756569_757064_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|757067_757706_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|758017_758410_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|758425_758854_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|759119_760247_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|760437_760836_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|761009_762377_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|762464_763523_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|763659_764598_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|765012_765483_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|765858_766122_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|766220_766487_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|766537_766813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|766892_768860_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|768865_769798_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|769805_770009_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|770140_771070_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|771105_772551_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|772639_776437_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|776474_777944_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|777946_778528_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|778535_779024_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|779023_780016_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|780086_781130_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|781435_783376_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|783455_783647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|783875_784877_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|784876_785485_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|785708_786161_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|786183_786651_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|786661_788011_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|788121_788364_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|788353_789805_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|789816_790698_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|791055_792021_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|792045_792342_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|792495_792687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|792689_794351_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|794334_794691_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|794966_795410_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|795409_795709_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|795705_796041_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|796037_797279_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|797280_797841_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|797892_799059_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|799322_799835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|799883_800219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|800561_802697_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|802696_803062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|803058_803427_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|803423_803738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|803730_803919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|803911_804181_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|804632_805412_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 3
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	2371444	2383098	5351479	integrase	Enterobacteria_phage(70.0%)	13	2359578:2359592	2382635:2382649
2359578:2359592	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|2371444_2373778_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|2373789_2374110_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|2374106_2374334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|2374330_2374888_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|2374884_2375151_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|2375692_2376430_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|2376426_2376672_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|2376689_2377256_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|2377824_2378250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|2378249_2379200_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|2379187_2380378_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|2380730_2381984_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|2381994_2383098_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2382635:2382649	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 4
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	2592653	2637928	5351479	lysis,head,tRNA,integrase	Escherichia_phage(26.42%)	63	2595536:2595582	2644670:2644716
WP_004143010.1|2592653_2594039_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2594084_2594297_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2594298_2595165_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2595536:2595582	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|2595595_2596759_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|2596635_2596971_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|2596972_2597188_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|2597189_2597408_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|2597404_2598172_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|2598168_2598825_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|2598821_2598980_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|2598976_2599657_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|2599653_2600499_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|2600514_2600799_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|2600887_2601082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|2601181_2601397_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|2601747_2602437_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|2602564_2602798_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|2602838_2603060_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|2603284_2604184_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|2604173_2605604_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|2605603_2605897_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|2605893_2606400_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|2606506_2607349_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|2607521_2608169_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|2608669_2609125_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|2609124_2609295_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|2609287_2609923_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|2609919_2610057_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|2610049_2610580_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|2610576_2611266_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|2612175_2612424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|2612426_2612957_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|2612953_2613418_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|2613523_2613853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|2614223_2614826_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|2614825_2616298_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|2616310_2617732_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|2617706_2618711_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|2618752_2619229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|2619301_2620687_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|2620690_2621119_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|2621130_2622225_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|2622235_2622475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|2622477_2622858_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|2622857_2623031_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|2623030_2623393_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|2623395_2623821_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|2623817_2624210_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|2624278_2625031_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|2625083_2625761_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|2625936_2626692_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|2626694_2626949_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|2627242_2627713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|2627729_2628089_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|2628188_2628359_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|2628348_2629062_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|2629127_2629913_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|2630040_2630544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|2630636_2634083_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|2634182_2634602_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|2634601_2635072_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|2635068_2635464_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|2635450_2637928_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
2644670:2644716	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 5
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	3037988	3075324	5351479	tail,portal,integrase,terminase,capsid,lysis,head,plate	Salmonella_phage(84.62%)	46	3037896:3037914	3075396:3075414
3037896:3037914	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|3037988_3039041_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|3039459_3040944_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|3041042_3041987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3041998_3042877_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|3043022_3043244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3043276_3043786_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|3043793_3043994_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|3043957_3044299_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|3044366_3044600_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|3044599_3044827_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|3044823_3045681_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|3045677_3048092_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|3048245_3048434_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|3048444_3048678_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|3048792_3049470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|3049745_3051488_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|3051549_3052575_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|3052574_3054341_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|3054483_3055317_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|3055333_3056392_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|3056395_3057046_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|3057141_3057606_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|3057605_3057809_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|3057812_3058028_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|3058008_3058518_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|3058522_3058906_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|3058902_3059331_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|3059426_3059858_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|3059850_3060297_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|3060293_3060986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|3061080_3061653_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|3061649_3062012_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|3061998_3062907_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|3062899_3063499_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|3063500_3066452_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|3066455_3067187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|3067183_3067387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|3067416_3068493_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|3068631_3069804_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|3069813_3070329_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|3070381_3070681_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|3070695_3070815_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|3070807_3073435_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|3073431_3073917_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|3073913_3075014_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|3075105_3075324_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
3075396:3075414	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	3109740	3119204	5351479	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3109740_3110856_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3110852_3112793_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3112869_3113091_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3113416_3113734_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3113764_3116044_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3116164_3116383_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3116736_3117438_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|3117482_3119204_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	3507232	3558124	5351479	tail,holin,integrase,terminase,transposase	Klebsiella_phage(23.4%)	61	3499210:3499225	3522049:3522064
3499210:3499225	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004140269.1|3507232_3508042_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|3508043_3509036_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|3509035_3509926_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|3510102_3511290_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|3511497_3512160_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|3512156_3512585_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|3512581_3513262_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|3513263_3513551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|3513547_3514393_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|3514408_3514693_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|3514781_3514976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|3515404_3515608_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|3515689_3516766_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|3516911_3517031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|3517053_3517752_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|3517863_3518091_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|3518131_3518353_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|3518438_3519299_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|3519295_3520144_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|3520140_3520443_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|3520498_3520744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3520951_3521980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|3522500_3522968_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
3522049:3522064	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004243010.1|3522948_3523116_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|3523112_3523781_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|3523773_3524412_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|3524408_3524549_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|3524548_3525238_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|3525887_3526187_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|3526183_3526723_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|3526719_3527064_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|3527060_3527336_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|3528294_3528540_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|3529402_3530407_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|3530384_3531692_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|3531691_3533092_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|3533075_3534188_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004217351.1|3534718_3535504_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|3535514_3536468_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217348.1|3536789_3537185_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|3537186_3537441_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|3537450_3537684_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|3537670_3538054_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|3538055_3538607_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|3538603_3538996_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|3539019_3540192_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|3540245_3540728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|3540865_3541072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|3541148_3541505_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|3541729_3541921_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|3542182_3545080_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|3545163_3545499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|3545813_3546278_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|3546458_3546941_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|3546950_3547331_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|3547327_3550396_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|3550472_3553427_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|3553430_3554162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|3554386_3554986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|3555227_3557171_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|3557419_3558124_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	3562389	3572869	5351479	transposase	Escherichia_phage(22.22%)	9	NA	NA
WP_001389365.1|3562389_3563154_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|3563330_3564035_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|3564627_3565050_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|3565947_3567432_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|3567857_3569342_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|3569421_3569841_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|3569842_3571108_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|3571183_3572011_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|3572197_3572869_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 9
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	3605802	3645574	5351479	transposase,terminase,integrase	uncultured_Caudovirales_phage(35.42%)	57	3603883:3603897	3612823:3612837
3603883:3603897	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|3605802_3606564_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|3606780_3608313_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|3608511_3609060_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|3609256_3610438_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|3610418_3610661_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|3610839_3611319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|3611315_3611528_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|3611524_3611749_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|3611738_3612449_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|3612454_3612973_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
3612823:3612837	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|3613077_3613905_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|3613901_3614096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|3614092_3614518_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|3614514_3614733_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|3614704_3614959_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|3614951_3615317_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|3615486_3615675_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|3615667_3615982_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|3616152_3616821_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|3616918_3617140_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|3617716_3619375_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|3619376_3620339_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|3620335_3620812_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|3620808_3621591_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|3621996_3622245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|3622247_3622778_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|3622774_3623164_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|3623398_3623719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|3623820_3624573_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|3624523_3625924_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|3626161_3627613_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|3627668_3628217_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|3628268_3629471_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|3629474_3629969_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|3629980_3630922_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|3630961_3631243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3631211_3631631_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|3631627_3632134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|3632133_3632520_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|3632614_3633055_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|3633058_3634204_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|3634214_3634505_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|3634445_3635638_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|3635964_3636390_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|3636425_3636578_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|3636567_3638571_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|3638570_3639170_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|3639170_3639473_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|3639475_3640498_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|3640497_3640839_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|3640888_3641071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|3641113_3641680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|3641733_3642387_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|3642388_3642742_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|3642741_3643938_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|3643934_3644708_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|3644707_3645574_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 10
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	4112218	4123105	5351479		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|4112218_4115326_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|4115380_4116646_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|4116676_4117765_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|4117851_4118112_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|4118409_4119270_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|4119290_4120052_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|4120312_4121215_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|4121226_4122492_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|4122484_4123105_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 11
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	4541045	4584145	5351479	plate,tRNA,transposase	Microcystis_virus(25.0%)	39	NA	NA
WP_002910404.1|4541045_4542302_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4542572_4543184_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|4543180_4544032_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4544215_4545163_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|4545287_4546967_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|4546967_4548014_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4548236_4548512_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|4548784_4549369_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4549486_4550578_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|4550660_4550870_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|4551071_4551986_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|4552117_4553533_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|4553552_4553996_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|4553998_4554535_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|4554515_4555562_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|4555561_4557325_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|4557458_4560869_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|4560852_4562010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|4562013_4562280_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|4562577_4562835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|4563023_4563260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|4563383_4564364_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|4564700_4565591_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|4565766_4566660_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|4566835_4567729_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|4567912_4568806_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152634.1|4568827_4570267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|4570372_4570603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|4570648_4571155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|4571151_4571481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|4571477_4571660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|4571801_4572725_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|4574375_4574885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|4575121_4575628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|4575624_4576134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|4576134_4577490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|4580453_4582151_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|4582154_4582808_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|4582804_4584145_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	4851833	4859458	5351479		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|4851833_4852835_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|4853028_4854195_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|4854375_4854930_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|4854944_4855835_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|4855866_4856736_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|4856762_4857827_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|4858051_4859458_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 13
NZ_CP020071	Klebsiella pneumoniae strain AR_0115, complete genome	5351479	4896025	4902932	5351479	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|4896025_4897504_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|4897500_4898223_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|4898541_4899903_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|4900148_4901042_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|4901284_4902058_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|4902068_4902932_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP020072	Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence	209424	14525	52360	209424	integrase,transposase,protease	Escherichia_phage(33.33%)	35	11038:11053	64626:64641
11038:11053	attL	CGCAGGCCGTCGCCGC	NA	NA	NA	NA
WP_020314316.1|14525_15872_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|17714_18677_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|18663_19413_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|19650_19848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|19847_22643_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|22757_23327_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|23361_23643_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|23886_24150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|24164_24428_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|25629_26610_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|27818_28688_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|28681_29692_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|29700_30528_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|30536_31400_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|31396_32224_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|33079_33784_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044503635.1|35087_35756_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_000018329.1|35945_36761_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|36911_37616_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|37737_38643_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|38639_39878_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|39877_40462_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|40954_41719_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|41945_42251_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|42261_43467_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|43622_43826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|43953_44793_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|44786_45134_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|45297_46089_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|46094_46385_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|46496_46994_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|47138_48152_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|48354_48705_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|48830_49391_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|49393_52360_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
64626:64641	attR	CGCAGGCCGTCGCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP020073	Klebsiella pneumoniae strain AR_0115 plasmid tig00000003, complete sequence	39762	133	7678	39762	integrase	Escherichia_phage(50.0%)	8	6191:6205	11817:11831
WP_000776034.1|133_565_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|564_1836_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_006797589.1|1917_2895_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|2891_4097_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|4511_4781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|4957_5824_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
6191:6205	attL	GAGTCGCTCTCCAGA	NA	NA	NA	NA
WP_000764642.1|6586_6844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|6901_7678_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
11817:11831	attR	GAGTCGCTCTCCAGA	NA	NA	NA	NA
>prophage 1
NZ_CP020074	Klebsiella pneumoniae strain AR_0115 plasmid tig00000004, complete sequence	43380	14081	24379	43380	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000516402.1|14081_14744_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|15124_15787_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|15873_16113_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|16505_17210_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|17346_18207_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|18227_18989_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|19250_20153_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|21361_24379_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
