The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020104	Spirosoma aerolatum strain KACC 17939 chromosome, complete genome	7959595	2645273	2696471	7959595	integrase,protease,terminase,plate,transposase	Staphylococcus_virus(11.11%)	41	2645974:2645996	2668493:2668515
WP_080055644.1|2645273_2645636_-|transposase	transposase	transposase	NA	NA	NA	NA
2645974:2645996	attL	TGTATTGCAAGTTGTATTGCAAC	NA	NA	NA	NA
WP_080055645.1|2646018_2647416_+|integrase	site-specific integrase	integrase	Q4ZCC1	Staphylococcus_virus	25.6	8.9e-05
WP_080055646.1|2647431_2648295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055647.1|2648383_2648659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080055648.1|2648768_2649998_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155297228.1|2650135_2651350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055651.1|2651828_2652557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055652.1|2652584_2653088_+|terminase	terminase	terminase	A0A2R4ALD0	Vibrio_phage	51.1	1.0e-27
WP_080055653.1|2653068_2654544_+	hypothetical protein	NA	A0A088C4S7	Flavobacterium_sp._phage	41.6	9.6e-58
WP_080055654.1|2654570_2656607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055655.1|2656932_2658825_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	41.0	4.4e-39
WP_080055656.1|2658821_2659730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080055657.1|2659731_2660454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080055658.1|2660942_2661812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080054324.1|2662428_2663271_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080055659.1|2663655_2664030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055660.1|2664220_2664532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055661.1|2664545_2664839_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080055662.1|2665194_2665728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055663.1|2665729_2666188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179950485.1|2666285_2666573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080055664.1|2666622_2667402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080055665.1|2668755_2671041_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
2668493:2668515	attR	TGTATTGCAAGTTGTATTGCAAC	NA	NA	NA	NA
WP_080055666.1|2671135_2671777_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_080055667.1|2671916_2673479_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_080055668.1|2673678_2675574_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	34.2	5.7e-71
WP_080055669.1|2675714_2676695_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	34.5	4.7e-37
WP_170061118.1|2676708_2677236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080055671.1|2677399_2679172_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.9e-44
WP_080055672.1|2679485_2679941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055673.1|2680051_2680633_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_080055674.1|2680812_2683374_+	dehydrogenase	NA	NA	NA	NA	NA
WP_080055675.1|2683469_2684528_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_080055676.1|2684568_2685354_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	5.7e-17
WP_080055677.1|2685398_2686718_+	MFS transporter	NA	NA	NA	NA	NA
WP_080055678.1|2688106_2688538_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_080055679.1|2688634_2690497_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_080055680.1|2690565_2691501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055681.1|2691600_2692758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055682.1|2692869_2693793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080055683.1|2693912_2696471_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.1	1.9e-106
>prophage 2
NZ_CP020104	Spirosoma aerolatum strain KACC 17939 chromosome, complete genome	7959595	4909628	4922991	7959595	transposase	Bacillus_phage(100.0%)	15	NA	NA
WP_080057412.1|4909628_4910492_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_170061163.1|4910618_4910756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080057413.1|4910882_4911539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155297304.1|4911944_4912166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170061164.1|4912617_4913418_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.1	1.2e-30
WP_080057416.1|4913455_4913707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080057417.1|4913754_4914561_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_080057418.1|4914797_4915661_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_080057419.1|4916341_4917214_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_080057420.1|4917593_4918136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080057421.1|4918474_4919026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080057422.1|4919316_4919913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080057423.1|4920210_4920696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170061165.1|4921604_4922288_-	DUF4595 domain-containing protein	NA	NA	NA	NA	NA
WP_080059833.1|4922235_4922991_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
