The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	0	5091	6350620		Acanthocystis_turfacea_Chlorella_virus(100.0%)	3	NA	NA
WP_004101621.1|3266_3539_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|3535_3976_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_080528001.1|4101_5091_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	2.5e-70
>prophage 2
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	10770	11890	6350620	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|10770_11890_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 3
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	21019	22540	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_080528003.1|21019_22540_-	amino acid ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-08
>prophage 4
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	30216	31363	6350620	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_150343100.1|30216_31363_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
>prophage 5
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	57461	58478	6350620	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|57461_58478_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 6
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	72269	73340	6350620		Synechococcus_phage(100.0%)	1	NA	NA
WP_047723821.1|72269_73340_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 7
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	82879	87490	6350620		Klosneuvirus(50.0%)	2	NA	NA
WP_047723827.1|82879_86782_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	5.9e-54
WP_047723828.1|86830_87490_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	49.6	1.1e-29
>prophage 8
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	99491	105932	6350620	transposase	Bacillus_phage(16.67%)	9	NA	NA
WP_014229205.1|99491_100463_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
WP_004850536.1|100528_100732_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014229206.1|101023_101221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749252.1|101527_101770_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	6.2e-31
WP_047723830.1|101995_102523_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.7	2.4e-19
WP_047722936.1|102639_103833_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
WP_014229208.1|103937_104411_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004101746.1|104515_104791_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_080528017.1|104813_105932_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	6.2e-33
>prophage 9
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	113178	114687	6350620		Mollivirus(100.0%)	1	NA	NA
WP_047723832.1|113178_114687_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	3.0e-30
>prophage 10
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	128748	130713	6350620		Phage_TP(100.0%)	1	NA	NA
WP_080528024.1|128748_130713_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	2.3e-22
>prophage 11
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	137465	138476	6350620		Mycoplasma_phage(100.0%)	1	NA	NA
WP_080528028.1|137465_138476_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	6.2e-24
>prophage 12
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	155492	157589	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_150343382.1|155492_157589_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	63.8	4.3e-128
>prophage 13
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	168211	168991	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014229256.1|168211_168991_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 14
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	182805	183507	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_029946961.1|182805_183507_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 15
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	189099	190644	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_032749182.1|189099_190644_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 16
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	196746	198237	6350620		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004850706.1|196746_198237_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 17
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	211021	212626	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_032749162.1|211021_212626_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.9e-19
>prophage 18
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	216867	221654	6350620		Tupanvirus(33.33%)	4	NA	NA
WP_004120604.1|216867_217878_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
WP_025108262.1|218134_218734_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	9.0e-23
WP_080528035.1|218935_219904_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064380354.1|219941_221654_-	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	26.1	1.6e-32
>prophage 19
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	240243	243827	6350620		Bacillus_virus(50.0%)	2	NA	NA
WP_025108277.1|240243_240939_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
WP_025108278.1|241094_243827_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
>prophage 20
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	252077	253666	6350620		Bacillus_virus(50.0%)	2	NA	NA
WP_009652192.1|252077_252893_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	4.3e-07
WP_009652163.1|252889_253666_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
>prophage 21
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	266789	270907	6350620		Klosneuvirus(50.0%)	4	NA	NA
WP_009652210.1|266789_268175_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	3.3e-28
WP_032719073.1|268482_269418_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047723886.1|269441_270182_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032695014.1|270178_270907_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	5.8e-24
>prophage 22
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	287997	288882	6350620		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_032749114.1|287997_288882_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	57.0	9.7e-82
>prophage 23
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	296117	297515	6350620		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032749104.1|296117_297515_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	1.1e-42
>prophage 24
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	314470	315286	6350620		Autographa_californica_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_000018326.1|314470_315286_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
>prophage 25
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	332908	335411	6350620	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001067855.1|332908_333613_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012637488.1|334583_335411_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	7.4e-07
>prophage 26
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	343450	348217	6350620	transposase	Leptospira_phage(33.33%)	4	NA	NA
WP_087451024.1|343450_344571_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004118669.1|344736_345474_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000843497.1|345507_345705_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_155774222.1|345745_348217_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.9e-83
>prophage 27
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	355361	358686	6350620		Bacillus_phage(66.67%)	4	NA	NA
WP_000697969.1|355361_356042_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|356034_357510_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|357760_358192_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|358335_358686_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
>prophage 29
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	432552	433278	6350620		Indivirus(100.0%)	1	NA	NA
WP_074188070.1|432552_433278_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	30.1	1.2e-13
>prophage 30
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	438215	440897	6350620		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_049593935.1|438215_440897_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.7	1.7e-07
>prophage 31
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	449005	461092	6350620	integrase,transposase	Macacine_betaherpesvirus(37.5%)	11	435873:435887	476911:476925
435873:435887	attL	TGTCATCAGATGATC	NA	NA	NA	NA
WP_049594029.1|449005_449971_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	90.0	5.9e-157
WP_000523815.1|449970_451137_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.8e-224
WP_049594028.1|451877_452888_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.7	2.6e-86
WP_049594027.1|453689_454430_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.7e-24
WP_074188076.1|454550_454736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114073.1|455013_455367_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|455414_455777_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_049594019.1|455794_457546_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_049594018.1|457593_458883_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.1e-171
WP_049594017.1|458895_459321_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	8.0e-50
WP_094909515.1|459923_461092_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	2.8e-177
476911:476925	attR	GATCATCTGATGACA	NA	NA	NA	NA
>prophage 32
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	465032	466152	6350620	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|465032_466152_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 33
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	480937	483015	6350620		Bacillus_phage(100.0%)	2	NA	NA
WP_004098935.1|480937_482338_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_004098938.1|482334_483015_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 34
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	488108	491565	6350620		Listeria_phage(50.0%)	3	NA	NA
WP_004118669.1|488108_488846_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000843497.1|488879_489077_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|489117_491565_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
>prophage 35
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	498738	502063	6350620		Bacillus_phage(66.67%)	4	NA	NA
WP_080528064.1|498738_499419_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_016947610.1|499411_500887_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
WP_045409016.1|501137_501569_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_064190166.1|501712_502063_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	5.5e-20
>prophage 36
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	514000	514999	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_040225637.1|514000_514999_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	7.5e-30
>prophage 37
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	525485	596024	6350620	transposase	uncultured_Caudovirales_phage(42.86%)	71	NA	NA
WP_004118218.1|525485_525863_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_048292253.1|525859_526207_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.9	3.8e-58
WP_048292251.1|526256_527795_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.2	2.3e-272
WP_048292250.1|528248_528653_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_000427620.1|529546_530551_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_080528071.1|530954_531965_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|532425_533508_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_080528072.1|533629_536704_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.4	0.0e+00
WP_003846917.1|536755_538009_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|538065_538236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060591199.1|541756_542641_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060591201.1|542685_543435_-	hydratase	NA	NA	NA	NA	NA
WP_060591203.1|543431_544868_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_060591205.1|544869_545595_-	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
WP_060591228.1|545688_546453_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	4.4e-14
WP_060591207.1|546482_547481_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060591210.1|547477_548254_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	4.7e-32
WP_077265231.1|548257_549118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080528073.1|549119_550145_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060591232.1|550420_551185_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060591214.1|551229_551967_+	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
WP_077265232.1|552185_552464_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_139840825.1|552496_552730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098837.1|552951_555960_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.0	0.0e+00
WP_004098835.1|556123_556690_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
WP_001258875.1|556717_557425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160641.1|557465_558080_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001159650.1|558248_559016_+	DUF1883 domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	41.9	1.6e-27
WP_000646594.1|559240_559939_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|560012_560834_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_012561145.1|560833_561994_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012561144.1|562035_563031_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000792636.1|563030_563564_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_000091613.1|563736_564051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|564305_564662_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_080528075.1|564651_565053_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|565049_565340_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001166628.1|565704_566160_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294660.1|566231_566582_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732276.1|566597_566873_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522993.1|566900_567308_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000281123.1|567346_569029_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_001277466.1|569046_569412_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|569408_569645_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|569628_569748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|569710_569923_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|570053_570614_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_048281060.1|570616_573583_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427623.1|573661_574666_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032655884.1|575025_575547_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032655882.1|575596_576022_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.1e-50
WP_032655881.1|576034_577324_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.9	5.1e-172
WP_032655878.1|577369_579121_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_032655876.1|579138_579501_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_032655874.1|579548_579902_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	1.5e-22
WP_032655872.1|580022_580514_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_032655870.1|580657_581098_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_032655868.1|581143_581623_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.2	6.1e-38
WP_032655866.1|581627_581999_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016156490.1|582088_585097_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.1	0.0e+00
WP_004118540.1|585256_585814_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|585945_586278_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|586631_587780_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|588054_588429_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_080528076.1|588957_590154_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|590225_591053_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
WP_001549885.1|591071_592550_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|593033_593387_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|593482_594766_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|594815_595244_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_004118521.1|595301_596024_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
>prophage 38
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	606724	607507	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014229398.1|606724_607507_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.8e-15
>prophage 39
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	612114	614112	6350620		Acinetobacter_phage(100.0%)	1	NA	NA
WP_086073937.1|612114_614112_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 40
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	617862	618591	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_025106318.1|617862_618591_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	6.4e-23
>prophage 41
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	651796	652633	6350620		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014838530.1|651796_652633_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	2.4e-13
>prophage 42
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	661896	663429	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_046877983.1|661896_663429_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 43
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	671200	674765	6350620		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_080528090.1|671200_672196_+	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
WP_004851075.1|672285_673548_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_025106268.1|673679_674765_-	porin	NA	Q1MVN1	Enterobacteria_phage	67.1	6.0e-142
>prophage 44
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	679192	680002	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_025106265.1|679192_680002_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.7e-14
>prophage 45
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	683988	685446	6350620		Mycoplasma_phage(100.0%)	1	NA	NA
WP_080528092.1|683988_685446_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	36.0	1.5e-39
>prophage 46
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	692525	693266	6350620		Indivirus(100.0%)	1	NA	NA
WP_049080275.1|692525_693266_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.1	5.6e-14
>prophage 47
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	696642	697434	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|696642_697434_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 48
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	708792	710313	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_049080281.1|708792_710313_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.6	2.8e-36
>prophage 49
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	716984	720483	6350620		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_080528099.1|716984_719246_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	3.0e-135
WP_080528100.1|719250_720483_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.0	3.0e-28
>prophage 50
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	735090	736452	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_009654684.1|735090_736452_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.4e-17
>prophage 51
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	742024	742786	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_014838580.1|742024_742786_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.3	1.5e-30
>prophage 52
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	747339	748101	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_080528112.1|747339_748101_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.6	1.3e-42
>prophage 53
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	755676	756057	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|755676_756057_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 54
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	759701	762628	6350620	transposase	Thermus_phage(33.33%)	3	NA	NA
WP_032747738.1|759701_760682_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
WP_014229495.1|761122_761821_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
WP_080528117.1|761830_762628_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.3	6.2e-11
>prophage 55
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	766808	767912	6350620		uncultured_virus(100.0%)	1	NA	NA
WP_032719179.1|766808_767912_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.6	1.8e-101
>prophage 56
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	775795	783014	6350620		Escherichia_phage(50.0%)	5	NA	NA
WP_057173494.1|775795_776866_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
WP_080528120.1|777072_780180_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.9	0.0e+00
WP_025105768.1|780235_781486_+	MFS transporter	NA	NA	NA	NA	NA
WP_080528121.1|781559_782648_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.2	8.3e-176
WP_004851229.1|782750_783014_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
>prophage 57
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	788523	798916	6350620		Klosneuvirus(20.0%)	9	NA	NA
WP_080528123.1|788523_790566_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.1	1.8e-14
WP_004851244.1|790737_791487_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_004851246.1|791577_792264_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025105778.1|792307_792739_-	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	39.3	8.8e-20
WP_004851251.1|793016_794480_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_080528124.1|794715_796092_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_042945264.1|796135_797155_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004851257.1|797169_798384_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
WP_004851258.1|798589_798916_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
>prophage 58
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	803389	805515	6350620		Escherichia_phage(100.0%)	3	NA	NA
WP_032719195.1|803389_804007_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
WP_080528125.1|804008_804866_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_064377289.1|804906_805515_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.6	4.9e-24
>prophage 59
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	815888	818045	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_047723738.1|815888_818045_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.6	3.5e-16
>prophage 60
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	825514	826474	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|825514_826474_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 61
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	837399	840177	6350620		Lactobacillus_phage(100.0%)	1	NA	NA
WP_047723732.1|837399_840177_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 62
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	856689	857205	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_014229564.1|856689_857205_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 63
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	871372	874341	6350620		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_032719220.1|871372_871855_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.5	3.9e-16
WP_032748939.1|872031_872721_-	VIT family protein	NA	NA	NA	NA	NA
WP_014229576.1|873039_874341_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 64
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	885791	885995	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|885791_885995_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 65
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	891351	892722	6350620		Pandoravirus(100.0%)	1	NA	NA
WP_025105825.1|891351_892722_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	3.6e-67
>prophage 66
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	904013	905288	6350620	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_004851444.1|904013_905288_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	9.4e-86
>prophage 67
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	913927	915405	6350620		Salmonella_phage(50.0%)	2	NA	NA
WP_004119475.1|913927_914449_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
WP_032748921.1|914508_915405_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.2	7.2e-08
>prophage 68
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	919562	928261	6350620		Bacillus_phage(20.0%)	9	NA	NA
WP_025105837.1|919562_920417_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_004851476.1|920541_921123_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	9.0e-44
WP_004851479.1|921179_922346_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|922510_922600_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851481.1|922896_923922_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_004851483.1|923940_924852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032749752.1|924964_926149_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014838673.1|926447_927596_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	5.0e-86
WP_032749754.1|927625_928261_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	2.1e-22
>prophage 69
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	939931	940930	6350620		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004851570.1|939931_940930_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.3	3.1e-20
>prophage 70
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	948509	952603	6350620		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_032749766.1|948509_949394_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.1	5.7e-82
WP_025105856.1|949416_950223_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004119381.1|950329_950965_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_014229623.1|951189_951819_+	LysE family transporter	NA	NA	NA	NA	NA
WP_004851588.1|951832_952603_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	3.6e-16
>prophage 71
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	957668	1003345	6350620	plate,integrase,transposase	Planktothrix_phage(22.22%)	35	949935:949951	979006:979022
949935:949951	attL	TGGCGGCATCAAGATTG	NA	NA	NA	NA
WP_047723706.1|957668_958649_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.5e-11
WP_025105867.1|958645_959611_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	9.2e-17
WP_047723705.1|959686_962092_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_032749775.1|962516_963065_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_032749776.1|963521_964040_+	fimbrial protein	NA	NA	NA	NA	NA
WP_025105871.1|964140_964830_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_080528136.1|964890_967461_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032749778.1|967476_968478_+	fimbrial protein	NA	NA	NA	NA	NA
WP_025105874.1|968523_969051_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014838689.1|969088_969640_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_025105875.1|970044_970716_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_049079337.1|970831_971740_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_004851627.1|972055_972196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057173433.1|972317_973736_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_048262255.1|973728_974916_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_047722936.1|975735_976929_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
WP_004136705.1|977042_977255_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_014229640.1|977283_978156_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004851637.1|978262_979042_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
979006:979022	attR	CAATCTTGATGCCGCCA	NA	NA	NA	NA
WP_047723698.1|979052_980732_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_014838693.1|980755_981526_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_032692928.1|981582_982653_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
WP_080528137.1|982645_984415_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032749787.1|984486_985575_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032749789.1|986077_986623_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_057174006.1|986600_987686_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_080528138.1|987649_989404_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_140356901.1|989516_989747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140356903.1|989739_990225_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_050597577.1|990766_991189_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_080528139.1|993866_994301_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_080528140.1|994300_995575_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_080528141.1|996336_999804_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_150343100.1|1000415_1001562_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_087451024.1|1002225_1003345_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 72
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1031334	1035669	6350620		Planktothrix_phage(50.0%)	3	NA	NA
WP_014229681.1|1031334_1032156_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.3e-15
WP_102804048.1|1032662_1034735_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_032749841.1|1034880_1035669_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-28
>prophage 73
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1048459	1050423	6350620		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_047723668.1|1048459_1049476_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.9e-42
WP_025108198.1|1049472_1050423_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
>prophage 74
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1068584	1071797	6350620		environmental_halophage(50.0%)	3	NA	NA
WP_032749875.1|1068584_1069805_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	2.6e-93
WP_032749876.1|1069801_1071076_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004851743.1|1071050_1071797_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.8	2.3e-07
>prophage 75
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1087510	1105497	6350620	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_014229722.1|1087510_1089889_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
WP_004851771.1|1090231_1091065_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_032749898.1|1091218_1092265_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.2	3.0e-82
WP_014229724.1|1092382_1092610_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_032749900.1|1092644_1094087_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	2.6e-55
WP_004134084.1|1094248_1094713_-	NLP/P60 protein	NA	NA	NA	NA	NA
WP_025108224.1|1094794_1095544_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	31.5	7.1e-09
WP_025108225.1|1095543_1096095_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014229729.1|1096319_1097120_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_009653750.1|1097146_1098133_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004851790.1|1098233_1098533_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_032749902.1|1098537_1100925_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851795.1|1100940_1101924_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_001386830.1|1102153_1102198_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_004102963.1|1102321_1102678_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1102728_1102926_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_052746887.1|1103022_1103565_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_004102966.1|1103568_1105497_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 76
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1114860	1117757	6350620		Lactobacillus_phage(33.33%)	3	NA	NA
WP_029946974.1|1114860_1115697_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.0e-08
WP_004851821.1|1115742_1116747_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_004851823.1|1116743_1117757_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-13
>prophage 77
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1126059	1135960	6350620		Erwinia_phage(20.0%)	10	NA	NA
WP_025108233.1|1126059_1126677_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
WP_004121719.1|1127233_1127641_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004851836.1|1127775_1128678_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
WP_025108235.1|1128875_1129889_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
WP_025108236.1|1129969_1130878_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_014229741.1|1130990_1131449_+	YchJ family protein	NA	NA	NA	NA	NA
WP_080528147.1|1131491_1132334_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	45.1	2.0e-12
WP_014229742.1|1133040_1133718_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_014229743.1|1133717_1134428_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_014229744.1|1134424_1135960_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 78
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1152394	1153183	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|1152394_1153183_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 79
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1158543	1164248	6350620		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_009651994.1|1158543_1158774_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
WP_004121802.1|1159039_1160140_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004851877.1|1160227_1161082_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004851879.1|1161121_1161934_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004851880.1|1161937_1162330_-	SirB family protein	NA	NA	NA	NA	NA
WP_047723625.1|1162326_1163166_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851884.1|1163165_1164248_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 80
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1167462	1170339	6350620		Tupanvirus(50.0%)	2	NA	NA
WP_004103157.1|1167462_1168410_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_014229756.1|1168659_1170339_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
>prophage 81
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1174015	1175023	6350620	integrase	uncultured_Caudovirales_phage(100.0%)	1	1164558:1164577	1188806:1188825
1164558:1164577	attL	GCTGGCTTCCTGCTCGACAA	NA	NA	NA	NA
WP_077254494.1|1174015_1175023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.1	6.1e-48
WP_077254494.1|1174015_1175023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.1	6.1e-48
1188806:1188825	attR	TTGTCGAGCAGGAAGCCAGC	NA	NA	NA	NA
>prophage 82
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1193600	1195073	6350620		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032718844.1|1193600_1195073_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 83
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1198094	1198553	6350620		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009651983.1|1198094_1198553_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 84
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1205368	1211565	6350620		Morganella_phage(25.0%)	6	NA	NA
WP_014229778.1|1205368_1205896_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.2	8.4e-49
WP_014229779.1|1205974_1206469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229780.1|1206702_1208343_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.2	1.0e-132
WP_004851947.1|1208658_1209552_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229781.1|1209611_1210298_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
WP_025108425.1|1210476_1211565_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
>prophage 85
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1217060	1218041	6350620	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_032747738.1|1217060_1218041_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
>prophage 86
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1235918	1236530	6350620		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|1235918_1236530_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 87
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1252020	1260105	6350620	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_100248262.1|1252020_1253706_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	2.5e-33
WP_004852007.1|1253914_1254499_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004852009.1|1254542_1255238_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014229807.1|1255305_1257216_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_004113724.1|1257348_1257693_+	RidA family protein	NA	NA	NA	NA	NA
WP_080528772.1|1257863_1259003_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_014229809.1|1259010_1260105_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.5	3.9e-24
>prophage 88
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1267267	1268623	6350620		Pandoravirus(100.0%)	1	NA	NA
WP_080528156.1|1267267_1268623_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	1.2e-43
>prophage 89
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1272467	1274027	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_047723575.1|1272467_1274027_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.6e-40
>prophage 90
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1281463	1281673	6350620		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1281463_1281673_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 91
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1286927	1288976	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_047723566.1|1286927_1288976_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.1	2.6e-85
>prophage 92
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1296438	1297092	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_025106137.1|1296438_1297092_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	2.2e-59
>prophage 93
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1306341	1307310	6350620		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|1306341_1306572_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229839.1|1306650_1307310_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 94
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1314765	1316241	6350620		Cyanophage(100.0%)	1	NA	NA
WP_004122041.1|1314765_1316241_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
>prophage 95
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1320201	1326542	6350620		Listeria_phage(25.0%)	7	NA	NA
WP_047723540.1|1320201_1321524_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_004852123.1|1321539_1322484_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_014229853.1|1322562_1323315_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
WP_014229854.1|1323314_1324100_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004852130.1|1324308_1325319_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_004103390.1|1325327_1325939_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014229855.1|1326020_1326542_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 96
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1330531	1337177	6350620	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_047723532.1|1330531_1331350_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	3.4e-57
WP_025106117.1|1331403_1331799_+	membrane protein	NA	NA	NA	NA	NA
WP_009652021.1|1331838_1332582_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_080528158.1|1332578_1333601_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_047723530.1|1333824_1334568_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014838837.1|1334644_1335214_-	VOC family protein	NA	NA	NA	NA	NA
WP_025106115.1|1335443_1337177_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.1	3.1e-84
>prophage 97
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1344200	1345715	6350620		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_025106113.1|1344200_1345715_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.2e-10
>prophage 98
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1357988	1387292	6350620	head,holin,terminase,tail	uncultured_Caudovirales_phage(40.74%)	39	NA	NA
WP_080528161.1|1357988_1358348_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.0	4.4e-17
WP_076752318.1|1358344_1358881_-	lysozyme	NA	K7PM52	Enterobacteria_phage	70.5	1.9e-72
WP_080528162.1|1358864_1359089_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	70.1	1.6e-20
WP_080528163.1|1359377_1359647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528164.1|1359653_1359995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528165.1|1359991_1362010_-	hypothetical protein	NA	A0A2H4J3Z5	uncultured_Caudovirales_phage	42.6	5.4e-27
WP_080528166.1|1362027_1363638_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.5	5.5e-224
WP_080528167.1|1363634_1363982_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.7	3.5e-19
WP_080528168.1|1364164_1364578_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	46.1	5.7e-08
WP_080528169.1|1364574_1367451_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.3	0.0e+00
WP_080528170.1|1367450_1370162_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	59.5	1.2e-295
WP_080528171.1|1370168_1370657_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	44.8	7.1e-10
WP_077254071.1|1370659_1371112_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.6	5.2e-23
WP_080528172.1|1371111_1373103_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.4	2.8e-185
WP_064167266.1|1373102_1373666_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.7	3.4e-48
WP_080528173.1|1373725_1374631_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.2	1.1e-43
WP_032409899.1|1374850_1375267_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	67.5	4.0e-38
WP_080528174.1|1375300_1376149_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.1	1.6e-44
WP_071458087.1|1376135_1376369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049099626.1|1376365_1377991_-|head,tail	bacteriophage head to tail connecting protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.7	5.2e-174
WP_032409891.1|1377994_1378216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528175.1|1378226_1378667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365933.1|1378694_1378991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155774225.1|1378994_1379159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528176.1|1379146_1379449_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	56.8	6.1e-28
WP_080528177.1|1379460_1380057_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.7	1.4e-79
WP_042945558.1|1380125_1380317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528178.1|1380460_1380799_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.2	5.1e-47
WP_004141582.1|1381425_1381656_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_080528179.1|1381658_1382249_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	1.9e-94
WP_155774226.1|1382245_1382416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064164989.1|1382412_1382646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528180.1|1382649_1383318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071458104.1|1383356_1384751_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
WP_080528773.1|1384759_1385728_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	74.5	1.5e-38
WP_029602737.1|1385745_1385904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|1385987_1386434_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_080528181.1|1386496_1386730_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	45.8	5.8e-10
WP_069135246.1|1386836_1387292_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.3	5.1e-34
>prophage 99
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1390539	1392757	6350620	integrase	Pectobacterium_phage(100.0%)	4	1385067:1385080	1393722:1393735
1385067:1385080	attL	AGATAACCATCAAA	NA	NA	NA	NA
WP_080528182.1|1390539_1391115_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	54.4	9.9e-43
WP_069135238.1|1391116_1391302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528183.1|1391511_1391757_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	35.2	1.2e-05
WP_080528184.1|1391740_1392757_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.8	2.5e-126
1393722:1393735	attR	AGATAACCATCAAA	NA	NA	NA	NA
>prophage 100
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1398198	1398951	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_004852203.1|1398198_1398951_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 101
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1405657	1419151	6350620	transposase	Burkholderia_phage(25.0%)	13	NA	NA
WP_014838854.1|1405657_1407325_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
WP_025106102.1|1407432_1407612_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_004852222.1|1407687_1408599_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_047723443.1|1408782_1409694_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_047723441.1|1409668_1410163_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_047723440.1|1410143_1411577_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	4.6e-97
WP_047723439.1|1411633_1412329_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	5.2e-06
WP_004852229.1|1412371_1412653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025106098.1|1413281_1414352_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	4.0e-90
WP_047722936.1|1414410_1415604_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
WP_049069769.1|1416318_1416708_+	GtrA family protein	NA	NA	NA	NA	NA
WP_047723436.1|1416704_1417697_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_080528186.1|1417693_1419151_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	41.3	1.8e-101
>prophage 102
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1426096	1433947	6350620		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_080528187.1|1426096_1428784_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	1.4e-70
WP_047723422.1|1428834_1429266_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	43.4	3.8e-23
WP_064380266.1|1429799_1430885_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047723418.1|1430884_1433947_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.3	1.5e-25
>prophage 103
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1443077	1444346	6350620		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003030858.1|1443077_1444346_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	41.1	3.6e-77
>prophage 104
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1455837	1456023	6350620		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003036401.1|1455837_1456023_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	4.3e-08
>prophage 105
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1471348	1479633	6350620	transposase	Leptospira_phage(33.33%)	6	NA	NA
WP_087451024.1|1471348_1472469_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_024218866.1|1472624_1473956_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_080528198.1|1474438_1475386_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	41.1	2.9e-55
WP_155774227.1|1475904_1476408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528200.1|1476477_1477425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528201.1|1477437_1479633_-	DEAD/DEAH box helicase	NA	A0A0E3EUQ0	Synechococcus_phage	34.7	8.2e-05
>prophage 106
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1483267	1484182	6350620		Lactobacillus_phage(100.0%)	1	NA	NA
WP_047723410.1|1483267_1484182_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 107
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1490732	1498583	6350620		Erysipelothrix_phage(66.67%)	4	NA	NA
WP_004864302.1|1490732_1492007_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.4	1.8e-68
WP_080528204.1|1492053_1493442_-	SpnT protein	NA	NA	NA	NA	NA
WP_004864307.1|1493636_1495613_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.7	3.3e-106
WP_080528205.1|1495622_1498583_+	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	38.6	9.9e-163
>prophage 108
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1509130	1510251	6350620	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|1509130_1510251_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 109
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1526832	1527048	6350620		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080528226.1|1526832_1527048_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	1.3e-08
>prophage 110
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1560784	1565764	6350620		Stx2-converting_phage(50.0%)	3	NA	NA
WP_088168343.1|1560784_1561957_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.2	8.1e-185
WP_047723373.1|1562131_1563556_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_025107724.1|1563661_1565764_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.3e-63
>prophage 111
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1578820	1580878	6350620		uncultured_virus(50.0%)	2	NA	NA
WP_032719811.1|1578820_1579645_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
WP_014230030.1|1579675_1580878_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.8	3.4e-29
>prophage 112
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1593401	1594301	6350620		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032693852.1|1593401_1594301_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 113
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1599845	1619206	6350620		Streptococcus_phage(20.0%)	15	NA	NA
WP_080528232.1|1599845_1600445_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	3.3e-17
WP_080528233.1|1600528_1601848_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
WP_029946952.1|1601979_1603113_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_080528234.1|1603125_1604019_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004852435.1|1604015_1605170_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
WP_057173229.1|1605188_1607081_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852439.1|1607094_1607835_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
WP_080528776.1|1607834_1608602_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080528235.1|1609907_1610912_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_004138729.1|1611383_1611506_+	small membrane protein	NA	NA	NA	NA	NA
WP_057173231.1|1612072_1613239_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	3.1e-112
WP_057173232.1|1613401_1614772_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.2	7.1e-31
WP_057173233.1|1614794_1616210_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	7.3e-55
WP_057173234.1|1616415_1617822_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.2	4.3e-39
WP_057173235.1|1618108_1619206_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	60.9	1.8e-133
>prophage 114
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1626563	1627550	6350620		Stygiolobus_rod-shaped_virus(100.0%)	1	NA	NA
WP_080528239.1|1626563_1627550_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	33.3	3.7e-05
>prophage 115
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1637647	1644536	6350620		Bacillus_phage(25.0%)	5	NA	NA
WP_085956067.1|1637647_1638538_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_080528242.1|1639521_1641108_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.9e-36
WP_080528243.1|1641347_1643195_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004852489.1|1643222_1643804_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_004122537.1|1643894_1644536_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 116
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1668786	1677191	6350620	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_016946933.1|1668786_1670322_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
WP_014230101.1|1670318_1671041_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_025107782.1|1671369_1672731_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.0	1.6e-200
WP_080528250.1|1672975_1673869_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.4	2.0e-13
WP_014230103.1|1673869_1674340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693715.1|1674326_1675127_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230105.1|1675543_1676317_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_032719918.1|1676327_1677191_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-11
>prophage 117
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1685825	1687193	6350620		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_080528252.1|1685825_1687193_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.0	2.8e-43
>prophage 118
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1694678	1695683	6350620		Serratia_phage(100.0%)	1	NA	NA
WP_004122690.1|1694678_1695683_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	26.3	2.4e-12
>prophage 119
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1710935	1719913	6350620	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
WP_025107804.1|1710935_1712969_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	4.7e-55
WP_014230129.1|1713167_1713635_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_004852612.1|1713738_1714206_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
WP_004852613.1|1714259_1714979_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004852614.1|1714972_1716661_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
WP_032750593.1|1716871_1717630_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
WP_004103838.1|1718156_1718270_+	protein YohO	NA	NA	NA	NA	NA
WP_047723251.1|1718244_1718982_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230133.1|1718965_1719913_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 120
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1726486	1727041	6350620		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004138576.1|1726486_1727041_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 121
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1731235	1731970	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_057173244.1|1731235_1731970_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.2	8.1e-50
>prophage 122
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1748756	1751898	6350620	transposase	Clostridium_phage(50.0%)	3	NA	NA
WP_032751944.1|1748756_1749194_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
WP_004852662.1|1749351_1750362_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_080528257.1|1750377_1751898_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.5	8.2e-12
>prophage 123
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1755656	1760063	6350620		Cellulophaga_phage(50.0%)	4	NA	NA
WP_004103895.1|1755656_1756325_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_064404479.1|1756693_1757530_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_025106750.1|1757824_1757983_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_014230158.1|1758089_1760063_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 124
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1764181	1765039	6350620		Catovirus(100.0%)	1	NA	NA
WP_014230162.1|1764181_1765039_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.5e-23
>prophage 125
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1776265	1780573	6350620		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_057173880.1|1776265_1777732_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.1	3.0e-43
WP_049101616.1|1777850_1778828_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_014230173.1|1778869_1779577_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|1780003_1780573_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 126
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1786331	1795390	6350620		Vibrio_phage(50.0%)	9	NA	NA
WP_064379364.1|1786331_1787921_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	9.5e-19
WP_004122937.1|1787924_1788269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057173883.1|1788599_1789796_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_057173884.1|1789792_1790512_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_080528258.1|1790660_1792418_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	1.1e-100
WP_004114143.1|1792555_1792840_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_032693687.1|1792901_1793495_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014230181.1|1793575_1794334_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|1794382_1795390_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
>prophage 127
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1801736	1810308	6350620		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
WP_014230208.1|1801736_1802984_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
WP_014230209.1|1802946_1804383_-	magnesium transporter	NA	NA	NA	NA	NA
WP_064404459.1|1804551_1806195_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.3	1.8e-09
WP_032750685.1|1806271_1806922_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_049079891.1|1806921_1807986_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_025106709.1|1808058_1809111_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_048260705.1|1809213_1810308_-	OmpK36 porin	NA	Q1MVN1	Enterobacteria_phage	60.3	1.2e-118
>prophage 128
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1814451	1826236	6350620		Pseudomonas_phage(33.33%)	7	NA	NA
WP_080528259.1|1814451_1817298_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.1	4.9e-42
WP_004852752.1|1817428_1820062_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
WP_057173324.1|1820247_1820976_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004852755.1|1821320_1823606_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.3e-284
WP_004852757.1|1823709_1824840_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004104002.1|1824839_1825094_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_057173323.1|1825165_1826236_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
>prophage 129
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1834092	1835298	6350620		Oenococcus_phage(100.0%)	1	NA	NA
WP_014839100.1|1834092_1835298_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
>prophage 130
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1838403	1840881	6350620	transposase	Tupanvirus(50.0%)	2	NA	NA
WP_047723175.1|1838403_1839852_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_014839101.1|1839900_1840881_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.7	1.8e-73
>prophage 131
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1861911	1862463	6350620	integrase	Escherichia_phage(100.0%)	1	1859242:1859257	1862595:1862610
1859242:1859257	attL	CAAAAGCGCCAGGCGC	NA	NA	NA	NA
WP_025106679.1|1861911_1862463_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.1	4.7e-50
WP_025106679.1|1861911_1862463_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.1	4.7e-50
1862595:1862610	attR	GCGCCTGGCGCTTTTG	NA	NA	NA	NA
>prophage 132
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1881451	1882051	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_004852850.1|1881451_1882051_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 133
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1893863	1894883	6350620		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004852866.1|1893863_1894883_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	7.9e-19
>prophage 134
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1899145	1901350	6350620		Salmonella_phage(66.67%)	4	NA	NA
WP_032720494.1|1899145_1899400_+	hypothetical protein	NA	J9Q735	Salmonella_phage	46.1	2.2e-10
WP_032750748.1|1899403_1899970_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	61.3	1.2e-45
WP_071846161.1|1900037_1900535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004852881.1|1900576_1901350_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 135
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1905643	1907161	6350620		Mollivirus(100.0%)	1	NA	NA
WP_070596212.1|1905643_1907161_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	1.6e-87
>prophage 136
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1913589	1914726	6350620		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_080528262.1|1913589_1914726_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.9e-21
>prophage 137
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1923142	1924231	6350620		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|1923142_1924231_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 138
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1933351	1938308	6350620		Enterobacteria_phage(33.33%)	5	NA	NA
WP_032694845.1|1933351_1934248_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
WP_032750827.1|1934475_1934811_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004852922.1|1935481_1935736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025106650.1|1936331_1937195_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.3	6.5e-06
WP_049079448.1|1937375_1938308_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	1.2e-10
>prophage 139
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1943469	1944213	6350620		Clostridioides_phage(100.0%)	1	NA	NA
WP_025106647.1|1943469_1944213_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	1.6e-13
>prophage 140
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1961913	1971782	6350620		Lactobacillus_phage(25.0%)	9	NA	NA
WP_014230310.1|1961913_1962840_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	2.0e-08
WP_004852990.1|1962929_1963928_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004123346.1|1963924_1964143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057173342.1|1964135_1966160_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.4	1.6e-148
WP_143439956.1|1966234_1967245_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_009654873.1|1967478_1968240_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_046878226.1|1968399_1969371_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.5e-75
WP_002913505.1|1969752_1970010_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004852999.1|1970054_1971782_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	4.3e-17
>prophage 141
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	1976030	1984623	6350620		Streptococcus_phage(25.0%)	10	NA	NA
WP_014230319.1|1976030_1976942_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
WP_004853015.1|1977008_1978103_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	3.7e-30
WP_004853017.1|1978092_1978968_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|1978967_1979801_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_014230322.1|1979800_1980817_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009654897.1|1981042_1981942_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014839169.1|1982035_1982611_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004853030.1|1982674_1983124_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|1983110_1983536_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|1983747_1984623_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 142
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2015855	2094787	6350620	holin,tRNA,capsid,integrase,terminase,protease,tail	Salmonella_phage(48.98%)	80	2039392:2039408	2098674:2098690
WP_032750868.1|2015855_2017856_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_014839185.1|2017868_2018735_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
WP_004104417.1|2018855_2019569_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
WP_004853085.1|2019677_2020712_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004853086.1|2020728_2021607_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_086074073.1|2021694_2022330_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_004104423.1|2022333_2022804_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_004123481.1|2022882_2023950_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004853093.1|2024179_2025643_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_004853095.1|2025652_2026012_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_029946903.1|2026038_2026764_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_004853099.1|2026835_2028125_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
WP_004123492.1|2028220_2028847_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014230344.1|2029029_2030460_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_047723136.1|2030469_2031363_-	ROK family protein	NA	NA	NA	NA	NA
WP_047723135.1|2031628_2032666_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004853109.1|2032662_2033304_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
WP_049101680.1|2033347_2034706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723133.1|2035128_2036583_+	MFS transporter	NA	NA	NA	NA	NA
WP_047723132.1|2036557_2037655_+	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_047723131.1|2037658_2039332_-	hypothetical protein	NA	NA	NA	NA	NA
2039392:2039408	attL	TTTTTCTTCGCTATATA	NA	NA	NA	NA
WP_004123499.1|2039509_2041570_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004853121.1|2041573_2043115_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_032750872.1|2043154_2045374_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_014230352.1|2045726_2045936_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.9	2.5e-20
WP_014230353.1|2045950_2046838_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032750873.1|2046936_2048133_+	MFS transporter	NA	NA	NA	NA	NA
WP_150343122.1|2048362_2048947_-	DUF2514 domain-containing protein	NA	T1SAQ9	Salmonella_phage	40.1	7.7e-19
WP_080528267.1|2048943_2049573_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	79.2	8.1e-91
WP_080528268.1|2049562_2049868_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	9.2e-40
WP_080528269.1|2049854_2050259_-	hypothetical protein	NA	T1SA79	Salmonella_phage	81.3	2.7e-55
WP_009485391.1|2053011_2053308_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_080528270.1|2053580_2054831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528271.1|2055048_2055738_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	69.6	2.3e-86
WP_080528272.1|2056166_2056625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528273.1|2056614_2057115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528275.1|2057395_2058247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528276.1|2058248_2061638_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	35.6	1.6e-177
WP_080528277.1|2061637_2064382_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	3.4e-93
WP_080528278.1|2064946_2065417_-	hypothetical protein	NA	Q858G2	Salmonella_phage	53.9	4.7e-43
WP_080528279.1|2065418_2067896_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	57.8	2.4e-271
WP_049090796.1|2067897_2068509_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.0	4.1e-47
WP_049090795.1|2068558_2068837_-	hypothetical protein	NA	Q858G6	Salmonella_phage	59.4	2.5e-20
WP_080528280.1|2068829_2069222_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	2.6e-55
WP_080528281.1|2069231_2070239_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	93.1	5.5e-182
WP_077259892.1|2070251_2070692_-	peptidase	NA	T1SAP9	Salmonella_phage	58.7	1.7e-39
WP_080528283.1|2070931_2071237_-	hypothetical protein	NA	Q2A090	Sodalis_phage	50.0	2.4e-16
WP_080528284.1|2071233_2072913_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.5	3.1e-193
WP_004152472.1|2072916_2073120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528285.1|2073812_2074070_+	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	40.7	2.5e-06
WP_080528286.1|2074113_2075589_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.9	2.0e-281
WP_080528287.1|2075585_2076176_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	85.1	8.2e-85
WP_080528288.1|2076233_2076563_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	58.8	4.3e-27
WP_080528289.1|2076639_2076978_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.7e-50
WP_080528290.1|2076977_2077175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150343367.1|2077167_2077746_-	DUF551 domain-containing protein	NA	H6WRY2	Salmonella_phage	34.0	8.8e-07
WP_080528291.1|2077946_2078234_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	84.6	5.8e-36
WP_080528292.1|2078230_2078458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528782.1|2078458_2078851_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	46.3	2.9e-06
WP_080528783.1|2078970_2079507_-	hypothetical protein	NA	J9Q748	Salmonella_phage	76.0	3.1e-75
WP_080528293.1|2079509_2079929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528294.1|2080115_2080460_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	87.6	1.3e-53
WP_080528295.1|2080580_2081363_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	89.7	1.6e-136
WP_080528296.1|2081359_2082151_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	76.8	2.2e-117
WP_053064344.1|2082150_2082360_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.2	2.7e-27
WP_032715137.1|2082507_2082741_-	hypothetical protein	NA	Q858D6	Salmonella_phage	78.9	9.5e-29
WP_080528297.1|2082896_2083484_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.5	3.2e-65
WP_080528298.1|2083841_2084819_+	cell envelope biogenesis protein TolA	NA	A0A1I9KFA0	Aeromonas_phage	47.6	1.9e-14
WP_080528299.1|2084826_2085126_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	51.5	2.1e-20
WP_080528300.1|2085122_2086022_+	endonuclease	NA	Q858E0	Salmonella_phage	97.0	1.1e-165
WP_080528301.1|2086031_2087054_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	98.8	6.4e-186
WP_032715143.1|2087099_2087348_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	85.4	1.2e-34
WP_032745691.1|2087457_2087751_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	73.2	4.7e-33
WP_080528302.1|2087743_2087902_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	75.0	1.4e-15
WP_080528303.1|2087898_2088492_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.4	4.8e-109
WP_080528304.1|2088488_2088680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528305.1|2088696_2089947_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	1.7e-204
WP_004853173.1|2090139_2091717_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_014230355.1|2091785_2093252_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
WP_032750874.1|2093410_2094787_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.9e-40
2098674:2098690	attR	TTTTTCTTCGCTATATA	NA	NA	NA	NA
>prophage 143
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2108210	2108642	6350620		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|2108210_2108642_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 144
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2120813	2127171	6350620		Mycoplasma_phage(20.0%)	8	NA	NA
WP_014230371.1|2120813_2122100_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_004104502.1|2122206_2122407_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|2122408_2122744_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_032750897.1|2122745_2124596_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.4e-103
WP_004114426.1|2124611_2125127_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004104506.1|2125200_2125524_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|2125543_2125930_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|2125956_2127171_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 145
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2141494	2157128	6350620	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_009654385.1|2141494_2142748_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_032750902.1|2143073_2144264_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|2144322_2144661_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_014230390.1|2144726_2146064_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_032750903.1|2146050_2146755_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_086074088.1|2146768_2148205_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	1.7e-11
WP_080528784.1|2148769_2152657_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	2.2e-130
WP_014839219.1|2152831_2154448_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071846082.1|2154444_2154990_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_004853258.1|2155009_2155645_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_014230398.1|2155854_2156703_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|2156867_2157128_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 146
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2160135	2163832	6350620		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004104573.1|2160135_2160816_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_025106581.1|2161042_2162017_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004853275.1|2162032_2163832_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 147
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2169609	2175567	6350620	transposase,tRNA	Cafeteria_roenbergensis_virus(25.0%)	6	NA	NA
WP_004853282.1|2169609_2170941_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_004104596.1|2170985_2171369_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_048260572.1|2171680_2172370_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.6	2.1e-55
WP_032721139.1|2172414_2173743_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004853286.1|2173864_2174938_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|2175141_2175567_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
>prophage 148
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2180866	2182894	6350620		Burkholderia_virus(50.0%)	2	NA	NA
WP_004853296.1|2180866_2182165_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.1e-44
WP_032751926.1|2182438_2182894_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	48.6	6.2e-32
>prophage 149
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2188833	2191407	6350620		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014226431.1|2188833_2191407_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
>prophage 150
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2198210	2199281	6350620		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_014226435.1|2198210_2199281_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
>prophage 151
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2204218	2293388	6350620	head,holin,tail,transposase,tRNA,portal,capsid,integrase,terminase,protease	Salmonella_phage(16.39%)	96	2234910:2234924	2286943:2286957
WP_004104636.1|2204218_2204986_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014226441.1|2205031_2205580_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004123777.1|2205598_2205847_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004123779.1|2206083_2207451_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004853326.1|2207615_2208407_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_014839241.1|2208425_2209715_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004853330.1|2209779_2210370_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004123797.1|2210495_2211374_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_032750923.1|2211460_2213122_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004123807.1|2213269_2213611_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_025107350.1|2213677_2213968_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029946935.1|2213957_2214434_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004104655.1|2214544_2215027_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_080528785.1|2215707_2216469_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	3.2e-09
WP_080528310.1|2218097_2219003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046895.1|2219020_2219899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528311.1|2219975_2221241_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.2	3.4e-205
WP_080528312.1|2221242_2221662_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	1.9e-35
WP_080528313.1|2221740_2221983_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.2	2.4e-30
WP_080528314.1|2221982_2222225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528315.1|2222354_2222903_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	88.4	2.9e-84
WP_080528316.1|2222978_2224349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528317.1|2224345_2224687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528318.1|2224693_2224960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155774230.1|2224986_2225127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528319.1|2227417_2230501_-	kinase	NA	A0A286S259	Klebsiella_phage	69.1	0.0e+00
WP_080528320.1|2230497_2230878_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.2e-57
WP_014838151.1|2230887_2231373_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	2.3e-53
WP_049069906.1|2231359_2231833_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.5	1.2e-54
WP_080528321.1|2231853_2235432_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	61.9	3.9e-238
2234910:2234924	attL	TGAACTGGGTAATAA	NA	NA	NA	NA
WP_071561202.1|2235492_2235777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049069904.1|2235831_2236170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528322.1|2236203_2236461_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.3	4.4e-19
WP_080528323.1|2236463_2237219_-	DNA-binding protein	NA	K7PH30	Enterobacteria_phage	48.4	1.1e-57
WP_049069901.1|2237405_2237711_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	2.1e-28
WP_049069900.1|2237713_2238118_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	2.5e-32
WP_080528324.1|2238148_2238859_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	69.1	1.3e-84
WP_049069898.1|2238915_2239263_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	57.5	1.7e-29
WP_049069896.1|2239259_2239709_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.2	5.1e-63
WP_048258044.1|2239705_2240044_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_032734570.1|2240056_2240389_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_014838142.1|2240394_2240649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528325.1|2240694_2241915_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	1.5e-141
WP_014838140.1|2241924_2242632_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_080528326.1|2242607_2243927_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.1	4.4e-139
WP_080528327.1|2243933_2245670_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.4e-137
WP_080528328.1|2245623_2246088_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.1e-47
WP_032734579.1|2246205_2246547_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.7e-48
WP_049106544.1|2246601_2246847_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	4.7e-18
WP_080528329.1|2246911_2247112_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	6.5e-18
WP_014228564.1|2247262_2247448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837907.1|2248003_2248288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064404667.1|2248523_2248799_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	3.7e-24
WP_025108061.1|2248806_2249433_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	1.5e-89
WP_014228560.1|2249432_2249711_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	4.0e-34
WP_004139418.1|2249700_2250090_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
WP_014228559.1|2250332_2250743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048258054.1|2251221_2251377_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	4.2e-09
WP_015370231.1|2251373_2251799_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
WP_080528330.1|2251930_2252431_-	hypothetical protein	NA	A0A1B1PE63	Salmonella_phage	38.7	1.3e-22
WP_064411118.1|2252707_2253787_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.3	1.8e-170
WP_064411190.1|2253936_2254128_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	84.1	8.3e-23
WP_047683618.1|2254338_2255169_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.0	1.0e-56
WP_080528331.1|2255187_2256243_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.3	2.9e-109
WP_080528332.1|2256251_2256776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048258059.1|2256785_2257616_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	70.7	1.7e-99
WP_080528333.1|2257704_2258103_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	71.3	2.0e-47
WP_080528334.1|2258099_2258576_-|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	56.3	1.2e-14
WP_080528335.1|2258572_2260423_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	1.1e-199
WP_080528336.1|2260415_2261369_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	74.7	9.7e-128
WP_048258063.1|2261547_2262006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528337.1|2262002_2262914_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	78.2	7.7e-50
WP_080528338.1|2262903_2263083_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	64.8	4.7e-12
WP_049069267.1|2263255_2263807_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.3	3.2e-67
WP_080528339.1|2263835_2264066_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	3.6e-12
WP_064147558.1|2264163_2264796_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	1.0e-32
WP_080528340.1|2265042_2265276_+	hypothetical protein	NA	Q56BD7	Escherichia_virus	37.0	5.1e-06
WP_001515608.1|2266619_2266991_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_080528341.1|2267047_2267875_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	85.1	2.1e-131
WP_080528342.1|2268007_2268535_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.6	2.1e-63
WP_047683655.1|2268534_2268735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528343.1|2268727_2269513_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	3.1e-63
WP_080528786.1|2269640_2270039_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.8	1.7e-09
WP_080528344.1|2270778_2271153_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.0	6.6e-64
WP_064838855.1|2271152_2271341_+	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	4.8e-23
WP_080528345.1|2272417_2273608_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.6e-146
WP_040018983.1|2273905_2275147_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.5	1.6e-101
WP_080528346.1|2275284_2278914_+	DNA helicase	NA	NA	NA	NA	NA
WP_080528787.1|2280345_2281587_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_080528347.1|2282012_2284211_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_077139404.1|2284207_2285524_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_080528788.1|2285527_2287837_-	ATPase	NA	NA	NA	NA	NA
2286943:2286957	attR	TTATTACCCAGTTCA	NA	NA	NA	NA
WP_087451024.1|2288270_2289390_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_150343100.1|2290281_2291428_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_080528348.1|2291495_2292212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142988957.1|2292354_2293388_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 152
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2304749	2306270	6350620		Pithovirus(100.0%)	1	NA	NA
WP_032750929.1|2304749_2306270_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	5.1e-14
>prophage 153
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2313643	2314285	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_032751934.1|2313643_2314285_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	28.2	1.2e-12
>prophage 154
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2317349	2320835	6350620		Mollivirus(50.0%)	4	NA	NA
WP_025107304.1|2317349_2318126_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
WP_032750936.1|2318271_2319192_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004853415.1|2319231_2320005_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014226484.1|2320040_2320835_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	28.6	3.5e-06
>prophage 155
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2336762	2342053	6350620		Gordonia_phage(25.0%)	5	NA	NA
WP_004853449.1|2336762_2337008_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_004104769.1|2337004_2337415_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_080528351.1|2337387_2339532_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	1.8e-190
WP_080528352.1|2339542_2340505_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.2	7.2e-131
WP_014226499.1|2340850_2342053_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 156
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2356997	2365281	6350620	tRNA	Vibrio_phage(20.0%)	9	NA	NA
WP_000906486.1|2356997_2357183_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_032750964.1|2357421_2360049_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_009651620.1|2360179_2360680_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004104808.1|2360751_2361810_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_032750966.1|2361890_2362388_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.7e-27
WP_025107287.1|2362592_2362820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528789.1|2362856_2363735_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226515.1|2363743_2364607_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014226516.1|2364603_2365281_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.7e-07
>prophage 157
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2370890	2371856	6350620		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032750970.1|2370890_2371856_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	5.2e-36
>prophage 158
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2411765	2412587	6350620		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_047723017.1|2411765_2412587_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.0e-12
>prophage 159
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2420826	2424156	6350620		Pithovirus(33.33%)	3	NA	NA
WP_080528357.1|2420826_2421606_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.9	4.6e-11
WP_047723011.1|2421797_2423051_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.7	2.3e-44
WP_032694641.1|2423388_2424156_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.4e-20
>prophage 160
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2435678	2440890	6350620		Planktothrix_phage(66.67%)	3	NA	NA
WP_047723004.1|2435678_2437622_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	1.9e-29
WP_014226569.1|2437621_2438782_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_047723003.1|2438778_2440890_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-16
>prophage 161
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2451058	2453620	6350620		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_047723001.1|2451058_2453620_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	3.0e-30
>prophage 162
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2459728	2463506	6350620		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|2459728_2460721_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_032751033.1|2460880_2462002_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_009651549.1|2462124_2462751_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_049103728.1|2462744_2463506_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.2e-58
>prophage 163
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2466579	2468612	6350620		Tupanvirus(50.0%)	2	NA	NA
WP_004853621.1|2466579_2467185_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
WP_080528359.1|2467184_2468612_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	1.1e-31
>prophage 164
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2479069	2484394	6350620		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|2479069_2479741_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_014839382.1|2480201_2481311_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004124327.1|2481377_2482676_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	2.8e-130
WP_004105009.1|2482756_2484394_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 165
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2487816	2493226	6350620		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_047722991.1|2487816_2489160_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.4	5.2e-34
WP_080528360.1|2489282_2492036_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	1.5e-48
WP_014226599.1|2492086_2493226_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 166
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2500667	2501513	6350620		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|2500667_2501513_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 167
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2513901	2514657	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_025108014.1|2513901_2514657_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 168
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2525663	2528238	6350620	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_032720169.1|2525663_2526869_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	2.0e-69
WP_032751059.1|2526868_2527306_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_009651598.1|2527428_2528238_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 169
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2533271	2534087	6350620		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_025107439.1|2533271_2534087_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 170
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2567112	2578226	6350620		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_014226651.1|2567112_2568366_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004853841.1|2568593_2569925_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_038423517.1|2569966_2571802_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.2	2.2e-19
WP_080528363.1|2571798_2575344_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
WP_025107418.1|2575340_2578226_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	3.4e-59
>prophage 171
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2583698	2602734	6350620		Geobacillus_virus(16.67%)	16	NA	NA
WP_004124584.1|2583698_2584493_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
WP_014226659.1|2584499_2585375_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004853863.1|2585670_2587917_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_004124593.1|2587929_2588460_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014226661.1|2589142_2589838_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004105253.1|2589919_2590633_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
WP_004105255.1|2590757_2590976_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_014226662.1|2591213_2592254_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_047722972.1|2592393_2593587_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_025107411.1|2593579_2595739_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_014226665.1|2596361_2597378_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_047722970.1|2597338_2597818_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|2597814_2598588_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047722969.1|2598656_2600084_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	5.8e-36
WP_047722968.1|2600091_2601429_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014839436.1|2601723_2602734_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.2	1.5e-30
>prophage 172
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2614122	2615250	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|2614122_2615250_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 173
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2623260	2626386	6350620	transposase	Aichi_virus(33.33%)	3	NA	NA
WP_014226687.1|2623260_2624679_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	1.6e-25
WP_032751944.1|2625016_2625454_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
WP_004124661.1|2625624_2626386_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 174
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2646692	2651657	6350620	integrase,transposase	Escherichia_phage(66.67%)	5	2649836:2649851	2654068:2654083
WP_080528366.1|2646692_2647673_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	3.5e-24
WP_014226704.1|2648222_2648684_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032751106.1|2648833_2649445_+	LysE family translocator	NA	NA	NA	NA	NA
2649836:2649851	attL	ATAAAAATAAGAACTG	NA	NA	NA	NA
WP_032751107.1|2649984_2650590_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	56.2	1.9e-57
WP_032751109.1|2651030_2651657_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.9	3.1e-50
2654068:2654083	attR	ATAAAAATAAGAACTG	NA	NA	NA	NA
>prophage 175
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2669524	2673370	6350620		Acinetobacter_phage(50.0%)	3	NA	NA
WP_080528371.1|2669524_2671078_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	58.0	1.0e-158
WP_080528372.1|2671575_2671998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654966.1|2672596_2673370_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 176
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2680666	2682223	6350620		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|2680666_2682223_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 177
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2689585	2690761	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_032751158.1|2689585_2690761_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	1.7e-41
>prophage 178
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2694618	2696754	6350620		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_032751161.1|2694618_2695044_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	3.3e-51
WP_032751162.1|2695057_2696350_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	6.2e-170
WP_032751164.1|2696403_2696754_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	2.8e-24
>prophage 179
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2709337	2718402	6350620	transposase,tRNA	Clostridium_phage(16.67%)	8	NA	NA
WP_032751176.1|2709337_2710063_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
WP_032751178.1|2710409_2710958_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_047722936.1|2711000_2712194_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
WP_014226789.1|2712319_2713837_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.6e-87
WP_100248296.1|2713846_2714945_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_032751182.1|2715030_2716764_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	4.6e-59
WP_004854054.1|2716769_2717483_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004105555.1|2717505_2718402_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 180
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2730761	2736663	6350620		Pandoravirus(50.0%)	4	NA	NA
WP_025105966.1|2730761_2732195_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.5e-31
WP_047722934.1|2732385_2732877_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032751196.1|2732985_2733729_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032751198.1|2733789_2736663_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.3	9.7e-264
>prophage 181
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2744841	2746074	6350620		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|2744841_2746074_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 182
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2763566	2764223	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_032751214.1|2763566_2764223_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.9	1.4e-08
>prophage 183
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2771431	2772226	6350620		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004125082.1|2771431_2772226_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	1.3e-08
>prophage 184
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2785817	2786972	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226830.1|2785817_2786972_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 185
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2804985	2806071	6350620		Geobacillus_virus(100.0%)	1	NA	NA
WP_014839539.1|2804985_2806071_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 186
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2811140	2811347	6350620		Vibrio_phage(100.0%)	1	NA	NA
WP_032692858.1|2811140_2811347_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	8.1e-16
>prophage 187
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2820596	2821967	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_047722911.1|2820596_2821967_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.1	5.6e-44
>prophage 188
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2843867	2853809	6350620		Staphylococcus_phage(20.0%)	8	NA	NA
WP_025105927.1|2843867_2844695_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
WP_025105926.1|2844793_2845249_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
WP_014226867.1|2845342_2847526_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
WP_004854230.1|2847646_2849059_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004125254.1|2849143_2849881_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_014226868.1|2850073_2852332_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
WP_009651841.1|2852454_2853324_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839568.1|2853401_2853809_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 189
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2857100	2858996	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_080528386.1|2857100_2858996_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	3.8e-91
>prophage 190
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2863318	2865153	6350620		Erwinia_phage(50.0%)	2	NA	NA
WP_004125303.1|2863318_2863987_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
WP_032751293.1|2863992_2865153_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.3e-89
>prophage 191
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2872480	2875764	6350620		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004854262.1|2872480_2873134_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
WP_004854265.1|2873512_2873794_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004854266.1|2873847_2874057_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_014226884.1|2874330_2875764_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	5.1e-40
>prophage 192
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2880874	2882116	6350620		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|2880874_2882116_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 193
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2891300	2896864	6350620	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_025105907.1|2891300_2892314_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	3.1e-108
WP_001144069.1|2892551_2892767_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_080528391.1|2893000_2894746_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	9.2e-76
WP_004105908.1|2895019_2896864_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 194
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2909949	2916535	6350620	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_080528394.1|2909949_2911356_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.2e-34
WP_014226909.1|2911393_2911726_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_032720237.1|2911945_2912929_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_047722897.1|2913442_2916535_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.8	6.9e-159
>prophage 195
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2924678	2926145	6350620		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_047722894.1|2924678_2926145_+	PAAR domain-containing protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	26.2	2.0e-23
>prophage 196
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2931159	2932647	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226925.1|2931159_2932647_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.2e-10
>prophage 197
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2945099	2946068	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_014839614.1|2945099_2946068_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.9	5.9e-40
>prophage 198
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2963340	2968876	6350620	transposase	Shigella_phage(66.67%)	4	NA	NA
WP_104457020.1|2963340_2964569_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_150343100.1|2965017_2966165_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_080528401.1|2966187_2966394_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_047722884.1|2967730_2968876_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	1.7e-46
>prophage 199
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2974144	2974954	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_025108325.1|2974144_2974954_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	2.5e-28
>prophage 200
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2984591	2988554	6350620		Streptococcus_phage(50.0%)	4	NA	NA
WP_009651852.1|2984591_2985452_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_047722881.1|2985515_2987597_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_014226966.1|2987554_2987941_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|2987963_2988554_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
>prophage 201
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2992321	2994093	6350620		Yellowstone_lake_phycodnavirus(33.33%)	4	NA	NA
WP_004854517.1|2992321_2992840_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_046878315.1|2992819_2993263_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004854522.1|2993318_2993603_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	51.3	3.4e-12
WP_004125592.1|2993589_2994093_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 202
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	2999287	3001249	6350620		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|2999287_3001249_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 203
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3006648	3013266	6350620		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_025108147.1|3006648_3009339_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	5.5e-27
WP_004854539.1|3009363_3010851_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004125659.1|3010878_3011331_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_032751471.1|3011922_3013266_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
>prophage 204
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3017471	3020353	6350620	protease	Pandoravirus(50.0%)	2	NA	NA
WP_014226978.1|3017471_3018320_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_004854549.1|3018418_3020353_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 205
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3026940	3028382	6350620		Indivirus(50.0%)	2	NA	NA
WP_047722875.1|3026940_3027912_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.0e-07
WP_004854566.1|3028109_3028382_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 206
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3032431	3046414	6350620		Staphylococcus_phage(28.57%)	16	NA	NA
WP_004125691.1|3032431_3033244_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
WP_004854581.1|3033453_3034431_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004854583.1|3034445_3035432_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
WP_004854584.1|3035446_3036013_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_004854587.1|3036009_3036585_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|3036553_3037099_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|3037105_3037831_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004854591.1|3037878_3039312_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004106167.1|3039334_3039622_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004854593.1|3039687_3040176_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|3040221_3041076_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004106170.1|3041072_3041345_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_014226984.1|3041397_3042123_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014226985.1|3042119_3042773_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014226986.1|3043007_3045347_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_014226987.1|3045478_3046414_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 207
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3058236	3058725	6350620	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_014226996.1|3058236_3058725_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 208
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3062629	3063997	6350620	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014226999.1|3062629_3063997_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 209
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3071336	3074701	6350620	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_025108482.1|3071336_3072605_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.3	8.8e-60
WP_014227009.1|3072815_3073481_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025108483.1|3073452_3074097_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032751944.1|3074263_3074701_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
>prophage 210
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3092133	3093177	6350620		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|3092133_3093177_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 211
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3122077	3123549	6350620	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004854751.1|3122077_3122587_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_032751523.1|3122601_3123549_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 212
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3143430	3149002	6350620		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|3143430_3144615_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|3144685_3146800_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|3146896_3147367_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|3147462_3147837_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025107828.1|3147961_3148249_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004854839.1|3148256_3148616_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_032751527.1|3148615_3149002_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	5.4e-21
>prophage 213
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3154631	3167483	6350620		Tupanvirus(14.29%)	12	NA	NA
WP_032751530.1|3154631_3156536_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.0	1.9e-74
WP_057173358.1|3156597_3158088_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	50.5	8.3e-142
WP_032751532.1|3158092_3158962_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	2.4e-48
WP_014227046.1|3159158_3159878_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	3.3e-19
WP_080528407.1|3159959_3160982_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|3160978_3161197_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854874.1|3161232_3162105_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004854875.1|3162148_3162553_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|3162857_3163490_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_014839675.1|3163541_3165620_+	membrane protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_014839676.1|3165609_3166830_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014227049.1|3166919_3167483_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 214
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3179799	3180627	6350620		Vibrio_phage(100.0%)	1	NA	NA
WP_025107840.1|3179799_3180627_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	9.4e-71
>prophage 215
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3195566	3201744	6350620		Staphylococcus_phage(50.0%)	3	NA	NA
WP_004854959.1|3195566_3197189_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.7	4.5e-141
WP_080528408.1|3197249_3199343_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_032751551.1|3199353_3201744_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 216
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3205234	3205993	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_080528409.1|3205234_3205993_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	5.1e-23
>prophage 217
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3209004	3211452	6350620		Dickeya_phage(100.0%)	1	NA	NA
WP_004854983.1|3209004_3211452_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 218
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3229169	3230977	6350620		Enterococcus_phage(50.0%)	2	NA	NA
WP_047722852.1|3229169_3229910_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
WP_025107858.1|3229906_3230977_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 219
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3239316	3240815	6350620		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004126158.1|3239316_3240030_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004855045.1|3240047_3240815_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 220
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3249583	3255344	6350620		Klosneuvirus(25.0%)	5	NA	NA
WP_032751581.1|3249583_3250849_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
WP_032751582.1|3250966_3252481_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
WP_004106554.1|3252513_3253368_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_025106848.1|3253624_3254683_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|3254675_3255344_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 221
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3258437	3262503	6350620		Dickeya_phage(50.0%)	4	NA	NA
WP_004855080.1|3258437_3259064_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_032751584.1|3259142_3261347_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	4.2e-118
WP_004106582.1|3261425_3261671_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_025106844.1|3261837_3262503_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.3	2.8e-57
>prophage 222
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3268805	3272912	6350620		Tupanvirus(66.67%)	3	NA	NA
WP_032751591.1|3268805_3270791_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004126208.1|3270787_3271771_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_004855110.1|3271772_3272912_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 223
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3278583	3280115	6350620		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_032751597.1|3278583_3279345_+	nickel import ATP-binding protein NikD	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.7	8.3e-05
WP_049080825.1|3279344_3280115_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.0	3.3e-17
>prophage 224
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3283283	3284237	6350620		Cedratvirus(100.0%)	1	NA	NA
WP_025106833.1|3283283_3284237_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 225
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3296652	3298695	6350620		Indivirus(100.0%)	1	NA	NA
WP_014839726.1|3296652_3298695_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.9e-44
>prophage 226
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3309674	3311752	6350620		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|3309674_3310394_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_014227153.1|3310390_3311752_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 227
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3342436	3343549	6350620	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_032751636.1|3342436_3343549_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.6	1.9e-191
>prophage 228
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3359648	3365860	6350620		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_053087481.1|3359648_3361760_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	5.6e-35
WP_004855313.1|3361780_3362584_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_064406150.1|3362574_3363153_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227185.1|3363866_3364880_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_004855320.1|3364876_3365860_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	1.5e-14
>prophage 229
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3383528	3384500	6350620		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009652700.1|3383528_3384500_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 230
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3387858	3389790	6350620		Morganella_phage(50.0%)	2	NA	NA
WP_004126446.1|3387858_3388071_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_032751659.1|3388170_3389790_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.7	3.9e-28
>prophage 231
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3394176	3395172	6350620		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_025106787.1|3394176_3395172_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	1.7e-10
>prophage 232
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3400531	3402073	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032751663.1|3400531_3402073_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.0e-17
>prophage 233
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3420008	3421202	6350620	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_047722936.1|3420008_3421202_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
>prophage 234
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3424753	3426595	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_032751684.1|3424753_3426595_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	2.6e-12
>prophage 235
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3442848	3451996	6350620		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|3442848_3443100_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_004126582.1|3443211_3443643_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014227235.1|3443888_3445433_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025107808.1|3445442_3446714_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_009652761.1|3446765_3447653_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032751692.1|3447649_3448447_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032751695.1|3448608_3449634_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_014227238.1|3449643_3450837_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
WP_014227239.1|3451051_3451996_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 236
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3456342	3456780	6350620	transposase	Clostridium_phage(100.0%)	1	NA	NA
WP_032751944.1|3456342_3456780_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
>prophage 237
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3465492	3470231	6350620		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_004106901.1|3465492_3465969_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_014227251.1|3466092_3466902_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_003024094.1|3467101_3467269_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|3467289_3467526_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004126657.1|3467742_3468408_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014227252.1|3468583_3469795_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	5.8e-45
WP_009652760.1|3469775_3470231_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	1.8e-47
>prophage 238
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3475798	3480825	6350620		Pseudomonas_phage(33.33%)	4	NA	NA
WP_080528422.1|3475798_3477475_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	4.3e-22
WP_004126677.1|3477732_3478356_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_004106927.1|3478410_3478686_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004855514.1|3478704_3480825_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 239
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3491958	3492810	6350620		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004106970.1|3491958_3492810_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 240
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3496296	3497688	6350620		environmental_Halophage(100.0%)	1	NA	NA
WP_080528423.1|3496296_3497688_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.1e-66
>prophage 241
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3516024	3520538	6350620		Wolbachia_phage(50.0%)	6	NA	NA
WP_077254519.1|3516024_3516618_+	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	45.7	3.7e-37
WP_032751853.1|3516645_3517251_-	shikimate kinase	NA	NA	NA	NA	NA
WP_032751852.1|3517438_3517906_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_032751849.1|3518018_3519026_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_080528425.1|3519027_3519330_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014227281.1|3519488_3520538_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 242
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3536146	3537313	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_014227296.1|3536146_3537313_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 243
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3541543	3542497	6350620	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032751828.1|3541543_3542497_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	3.3e-67
>prophage 244
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3549887	3551000	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014227307.1|3549887_3551000_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 245
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3563402	3568745	6350620		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_080528426.1|3563402_3565091_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.6e-59
WP_004107123.1|3565193_3565289_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|3565871_3565961_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_032751821.1|3566032_3566479_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014227319.1|3566549_3567383_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004855651.1|3567560_3568745_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
>prophage 246
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3580142	3581103	6350620		Synechococcus_phage(50.0%)	2	NA	NA
WP_004107167.1|3580142_3580571_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	2.5e-14
WP_004126917.1|3580689_3581103_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 247
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3584600	3585749	6350620		Oenococcus_phage(100.0%)	1	NA	NA
WP_032751806.1|3584600_3585749_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.5	2.3e-51
>prophage 248
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3591181	3598710	6350620		Bacillus_virus(33.33%)	7	NA	NA
WP_004126944.1|3591181_3593596_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
WP_032751800.1|3593624_3594698_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|3594846_3595947_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|3595951_3597352_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|3597973_3598114_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|3598129_3598489_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|3598452_3598710_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 249
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3611363	3612854	6350620		Burkholderia_virus(100.0%)	1	NA	NA
WP_032751792.1|3611363_3612854_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.9	3.2e-08
>prophage 250
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3618746	3620084	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_150343172.1|3618746_3620084_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 251
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3625941	3633543	6350620		Bacillus_phage(25.0%)	6	NA	NA
WP_004855746.1|3625941_3626715_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_032751778.1|3626762_3627653_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004107261.1|3627652_3628612_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|3628804_3629845_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_014227346.1|3630161_3631991_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_032751777.1|3632172_3633543_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	7.3e-36
>prophage 252
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3648124	3649117	6350620		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_047722784.1|3648124_3649117_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	7.1e-49
>prophage 253
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3652286	3656275	6350620		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_004107313.1|3652286_3654155_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.9e-66
WP_004855789.1|3654339_3654759_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_047722783.1|3654769_3656275_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	5.2e-19
>prophage 254
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3672224	3675014	6350620		uncultured_virus(100.0%)	1	NA	NA
WP_025106523.1|3672224_3675014_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	2.5e-75
>prophage 255
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3678906	3681374	6350620		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_004107350.1|3678906_3680316_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|3680324_3681374_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 256
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3688198	3689116	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_032751765.1|3688198_3689116_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	46.5	2.5e-08
>prophage 257
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3740751	3742263	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_080528437.1|3740751_3742263_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	6.7e-14
>prophage 258
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3752004	3755531	6350620		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_004127220.1|3752004_3752625_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_080528439.1|3752696_3753371_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|3753462_3754836_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|3754832_3755531_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 259
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3760149	3761484	6350620		Erwinia_phage(100.0%)	1	NA	NA
WP_004127247.1|3760149_3761484_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 260
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3773869	3776569	6350620		Escherichia_phage(50.0%)	3	NA	NA
WP_014227432.1|3773869_3774619_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
WP_014227433.1|3774747_3775851_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_057173445.1|3775906_3776569_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	1.0e-27
>prophage 261
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3791298	3793167	6350620		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004856052.1|3791298_3793167_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 262
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3803237	3804884	6350620		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_080528442.1|3803237_3804884_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.2	2.2e-66
>prophage 263
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3814574	3825411	6350620		Vibrio_phage(20.0%)	9	NA	NA
WP_004097491.1|3814574_3815303_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
WP_014227450.1|3815405_3817424_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	3.2e-112
WP_064381127.1|3817429_3818392_-	ribokinase	NA	NA	NA	NA	NA
WP_049102522.1|3818375_3819791_-	allantoin permease	NA	NA	NA	NA	NA
WP_014227452.1|3819809_3820826_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
WP_025108414.1|3821047_3821788_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032747337.1|3821852_3823340_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004127388.1|3823474_3824740_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_004097507.1|3825081_3825411_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 264
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3829460	3835600	6350620		Escherichia_phage(40.0%)	6	NA	NA
WP_004097518.1|3829460_3830591_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
WP_032747340.1|3830587_3831850_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.3	1.1e-25
WP_032747342.1|3831846_3832914_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.0	3.0e-101
WP_032747344.1|3832931_3833813_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.7	7.9e-108
WP_032747345.1|3833790_3834465_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004097526.1|3834469_3835600_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 265
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3858957	3862816	6350620		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009651718.1|3858957_3859860_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
WP_032747362.1|3859859_3860576_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_032747365.1|3860653_3862816_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	4.6e-117
>prophage 266
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3866665	3870139	6350620	transposase	Catovirus(50.0%)	3	NA	NA
WP_080528444.1|3866665_3868492_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.1e-82
WP_004097571.1|3868553_3869177_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_047722755.1|3869218_3870139_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.2	2.4e-67
>prophage 267
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3880070	3886252	6350620		Alteromonas_phage(33.33%)	7	NA	NA
WP_032747382.1|3880070_3881519_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
WP_004097585.1|3881589_3882345_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032747384.1|3882358_3882964_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_025108392.1|3882960_3884601_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.6	2.6e-40
WP_025108391.1|3884678_3884933_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014227481.1|3884936_3885476_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_032747388.1|3885478_3886252_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.4	6.6e-26
>prophage 268
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3895456	3896071	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|3895456_3896071_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 269
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3905822	3925523	6350620		uncultured_Mediterranean_phage(16.67%)	14	NA	NA
WP_014227490.1|3905822_3906773_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
WP_004097636.1|3907774_3908959_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|3909191_3909575_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|3909576_3910122_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_080528446.1|3910275_3910704_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|3910707_3911412_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|3911827_3912325_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|3912391_3912757_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004097647.1|3913082_3917111_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_004097649.1|3917187_3921411_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	2.9e-67
WP_004097650.1|3921807_3923148_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_004097651.1|3923191_3923509_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|3923512_3923818_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_064381413.1|3923990_3925523_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	1.1e-08
>prophage 270
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3934068	3935832	6350620		Klosneuvirus(50.0%)	3	NA	NA
WP_025107530.1|3934068_3934740_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	9.5e-21
WP_032747412.1|3934782_3935373_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|3935559_3935832_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
>prophage 271
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3939523	3944788	6350620		Organic_Lake_phycodnavirus(33.33%)	3	NA	NA
WP_032747420.1|3939523_3941662_+	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.9	6.1e-13
WP_047722746.1|3941658_3942849_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	42.9	6.4e-12
WP_064381418.1|3942841_3944788_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.2	8.8e-35
>prophage 272
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3959503	3961093	6350620		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_004097693.1|3959503_3961093_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 273
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3974881	3978565	6350620		Dickeya_phage(100.0%)	1	NA	NA
WP_080528447.1|3974881_3978565_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 274
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	3995017	3995806	6350620		Pseudomonas_phage(100.0%)	1	NA	NA
WP_025107707.1|3995017_3995806_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	46.3	4.8e-48
>prophage 275
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4008716	4009826	6350620		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|4008716_4009826_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 276
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4016952	4017561	6350620		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|4016952_4017561_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 277
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4023552	4026193	6350620		Escherichia_phage(50.0%)	2	NA	NA
WP_004097788.1|4023552_4024968_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
WP_032747492.1|4025113_4026193_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.8	5.8e-28
>prophage 278
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4030314	4035623	6350620		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004097797.1|4030314_4033140_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|4033386_4033914_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_032747499.1|4034000_4035623_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.5e-06
>prophage 279
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4047436	4048786	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_004097818.1|4047436_4048786_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	8.8e-159
>prophage 280
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4061050	4072162	6350620		Staphylococcus_phage(33.33%)	8	NA	NA
WP_080528450.1|4061050_4063009_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	2.1e-92
WP_004109428.1|4063420_4064734_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014837150.1|4064770_4065454_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_080528452.1|4065660_4067808_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.2	5.3e-33
WP_049102528.1|4068069_4068981_-	allose kinase	NA	NA	NA	NA	NA
WP_014227571.1|4068964_4069660_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014837152.1|4069670_4070651_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_025107678.1|4070629_4072162_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
>prophage 281
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4077830	4079473	6350620		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_047724819.1|4077830_4078517_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	1.5e-08
WP_004097860.1|4078714_4079473_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.1	7.4e-14
>prophage 282
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4084795	4091731	6350620		Burkholderia_virus(25.0%)	9	NA	NA
WP_004097871.1|4084795_4086298_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	1.8e-56
WP_004097873.1|4086444_4086750_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_014227587.1|4086749_4087670_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_101827076.1|4087627_4087813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528453.1|4087820_4088501_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	44.3	2.7e-31
WP_014837164.1|4088724_4089507_+	DsbA family protein	NA	NA	NA	NA	NA
WP_032747545.1|4089540_4090137_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032747547.1|4090252_4090840_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032750026.1|4091296_4091731_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	39.1	1.2e-19
>prophage 283
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4105422	4110953	6350620		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|4105422_4105716_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_032747587.1|4105759_4107406_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	4.5e-189
WP_004097909.1|4107539_4107893_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_032747589.1|4107940_4108807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004097913.1|4108829_4110953_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.8	1.6e-29
>prophage 284
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4121850	4127068	6350620		Morganella_phage(33.33%)	6	NA	NA
WP_032747606.1|4121850_4122381_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	8.8e-46
WP_004097938.1|4122521_4122881_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004097939.1|4122891_4123287_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004097940.1|4123297_4124032_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_025107641.1|4124024_4125815_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
WP_004097943.1|4126090_4127068_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	9.9e-27
>prophage 285
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4134320	4134866	6350620		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|4134320_4134866_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 286
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4139605	4142837	6350620		Vibrio_phage(50.0%)	2	NA	NA
WP_014837183.1|4139605_4140937_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
WP_080528455.1|4140947_4142837_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	1.7e-59
>prophage 287
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4148363	4152725	6350620		Pithovirus(50.0%)	3	NA	NA
WP_032747626.1|4148363_4149662_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_004097980.1|4149811_4150237_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004097981.1|4150274_4152725_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 288
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4194259	4200812	6350620		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|4194259_4194787_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_032747650.1|4195190_4196147_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032747652.1|4196257_4197760_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_014227645.1|4197770_4198796_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004098052.1|4198782_4199769_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004098053.1|4199813_4200812_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 289
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4219685	4223001	6350620		Cronobacter_phage(50.0%)	3	NA	NA
WP_014227659.1|4219685_4220150_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
WP_075209512.1|4220467_4220779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032695170.1|4220862_4223001_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	3.4e-266
>prophage 290
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4230829	4238604	6350620		Enterobacteria_phage(25.0%)	6	NA	NA
WP_014227667.1|4230829_4231777_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
WP_080528460.1|4232155_4234864_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	1.8e-46
WP_009652347.1|4234931_4235318_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_080528461.1|4235472_4236936_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	37.9	7.1e-21
WP_004098115.1|4237195_4237657_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_014227670.1|4237668_4238604_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	7.7e-53
>prophage 291
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4243748	4252798	6350620	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_047724759.1|4243748_4246604_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_004098129.1|4246603_4247047_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004098131.1|4247169_4248681_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_004098132.1|4249074_4250172_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|4250171_4251254_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|4251295_4252798_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
>prophage 292
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4268281	4275019	6350620	transposase	Bacillus_virus(33.33%)	6	NA	NA
WP_080528463.1|4268281_4269355_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.4e-28
WP_080528464.1|4269360_4270185_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_014227686.1|4270195_4271083_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032747688.1|4271072_4271945_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004108819.1|4272136_4273156_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	5.8e-46
WP_101869236.1|4273778_4275019_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	77.4	1.0e-129
>prophage 293
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4287715	4288846	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004136079.1|4287715_4288846_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	3.2e-21
>prophage 294
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4292160	4359994	6350620	integrase,holin,transposase,tRNA	Shigella_phage(20.0%)	51	4296981:4296997	4347082:4347098
WP_096810283.1|4292160_4293328_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	95.8	1.1e-178
WP_064175079.1|4293719_4294466_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_064175078.1|4294682_4295240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064175077.1|4295416_4297615_-	S8 family peptidase	NA	NA	NA	NA	NA
4296981:4296997	attL	TTTATGATTTTATTTTC	NA	NA	NA	NA
WP_064175076.1|4297607_4298690_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	31.1	7.9e-17
WP_000537152.1|4299773_4300058_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072125076.1|4300884_4301133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064175039.1|4301101_4302007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004133505.1|4302221_4303493_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8W6M6	Sinorhizobium_phage	30.0	1.0e-44
WP_004133503.1|4303513_4303699_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064175040.1|4303784_4304846_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	61.1	8.9e-114
WP_064175041.1|4305205_4308727_+	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
WP_064175042.1|4308793_4310413_+	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_064175043.1|4310409_4311891_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_064175044.1|4311977_4312256_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064175045.1|4312436_4313354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528467.1|4313540_4314092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528468.1|4314718_4315285_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	69.4	8.0e-05
WP_150343100.1|4315352_4316499_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_004117617.1|4316782_4317217_-	VOC family protein	NA	NA	NA	NA	NA
WP_080528469.1|4317363_4317687_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_080528470.1|4317976_4318681_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_080528471.1|4319155_4320187_+	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_032691904.1|4320382_4321411_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080528472.1|4321547_4321979_-	heme-binding protein	NA	NA	NA	NA	NA
WP_049078888.1|4321965_4322877_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_004133472.1|4322870_4323698_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032694266.1|4323721_4324825_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_080528473.1|4324877_4326329_-	MFS transporter	NA	NA	NA	NA	NA
WP_057173399.1|4326473_4328123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049078891.1|4328688_4330053_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
WP_080528474.1|4330094_4331438_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_080528475.1|4331522_4332302_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_080528476.1|4332797_4333673_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_014227737.1|4333741_4334866_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014227738.1|4341137_4341455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528477.1|4341494_4342619_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080528478.1|4342618_4345348_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	2.3e-20
WP_004098195.1|4345344_4346412_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009652888.1|4346945_4348343_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
4347082:4347098	attR	TTTATGATTTTATTTTC	NA	NA	NA	NA
WP_014227742.1|4348621_4349629_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025108468.1|4349827_4351084_-	tryptophan permease	NA	NA	NA	NA	NA
WP_004128455.1|4351222_4352611_-	tryptophanase	NA	NA	NA	NA	NA
WP_004098218.1|4352735_4352831_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_004108688.1|4353072_4353402_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014227744.1|4353419_4353833_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_009652892.1|4353852_4354539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837302.1|4354551_4355172_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_004098223.1|4355168_4355591_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014227748.1|4355603_4356551_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_080528479.1|4356607_4359994_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 295
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4365743	4366328	6350620		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|4365743_4366328_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 296
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4372911	4382737	6350620		Liberibacter_phage(33.33%)	5	NA	NA
WP_080528484.1|4372911_4376178_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	2.5e-50
WP_080528794.1|4376273_4377548_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080528485.1|4377669_4379289_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.6	3.2e-06
WP_080528486.1|4379318_4380665_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_080528487.1|4380664_4382737_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	38.1	6.3e-31
>prophage 297
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4394935	4396773	6350620		Streptococcus_phage(50.0%)	2	NA	NA
WP_047724604.1|4394935_4396147_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.7	3.5e-58
WP_014227775.1|4396146_4396773_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
>prophage 298
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4402013	4402952	6350620	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_080528490.1|4402013_4402952_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.5	2.0e-69
>prophage 299
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4432160	4433183	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_032747812.1|4432160_4433183_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	5.5e-12
>prophage 300
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4440186	4443378	6350620	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_047724579.1|4440186_4441248_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.0	9.4e-07
WP_086073965.1|4441244_4442276_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_047724573.1|4442415_4443378_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.7e-68
>prophage 301
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4446539	4447819	6350620		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|4446539_4447277_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_047724569.1|4447279_4447819_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 302
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4461126	4463831	6350620		Streptococcus_phage(50.0%)	3	NA	NA
WP_004098388.1|4461126_4462716_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
WP_014227828.1|4462933_4463545_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|4463669_4463831_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 303
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4468499	4469822	6350620		Geobacillus_virus(100.0%)	1	NA	NA
WP_014227832.1|4468499_4469822_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 304
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4476121	4482779	6350620	transposase	Enterococcus_phage(33.33%)	4	NA	NA
WP_004098414.1|4476121_4477354_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
WP_032721139.1|4477464_4478793_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014227837.1|4478900_4480568_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_014227838.1|4480841_4482779_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 305
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4486743	4488168	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_047724559.1|4486743_4488168_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.0	1.4e-18
>prophage 306
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4499253	4500207	6350620		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|4499253_4500207_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 307
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4504594	4512877	6350620		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004128758.1|4504594_4506511_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_014837364.1|4506598_4507735_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_032750048.1|4507902_4508850_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227856.1|4508974_4509322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032747870.1|4509399_4509933_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	3.3e-53
WP_014227858.1|4509949_4510393_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032747871.1|4510777_4512877_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	4.0e-33
>prophage 308
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4518840	4525529	6350620	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_032747878.1|4518840_4520016_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.3	1.7e-89
WP_014227863.1|4520068_4520968_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|4521135_4521399_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004098483.1|4521729_4522668_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_014227864.1|4522712_4525529_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
>prophage 309
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4552236	4553385	6350620		Halovirus(100.0%)	1	NA	NA
WP_014837384.1|4552236_4553385_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.8e-48
>prophage 310
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4559988	4561357	6350620		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|4559988_4560468_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_014227890.1|4560508_4561357_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 311
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4573898	4579350	6350620		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_025106476.1|4573898_4576805_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
WP_047724509.1|4576992_4579350_-	DNA polymerase II	NA	E5ESJ9	Bathycoccus_sp._RCC1105_virus	24.1	1.5e-28
>prophage 312
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4585557	4586259	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014227903.1|4585557_4586259_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 313
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4607029	4608754	6350620		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_025106489.1|4607029_4608754_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 314
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4634871	4635915	6350620		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_047724480.1|4634871_4635915_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.9e-101
>prophage 315
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4640244	4640796	6350620		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_032747986.1|4640244_4640796_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.3	9.2e-14
>prophage 316
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4651921	4653346	6350620		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004098637.1|4651921_4653346_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 317
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4663131	4663902	6350620		Escherichia_phage(100.0%)	1	NA	NA
WP_032748007.1|4663131_4663902_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	3.4e-30
>prophage 318
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4668780	4675361	6350620		Mamastrovirus(33.33%)	5	NA	NA
WP_080528503.1|4668780_4670382_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.3	1.1e-19
WP_025106510.1|4670482_4672873_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|4673076_4673613_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_004098666.1|4673664_4674327_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004098667.1|4674434_4675361_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.8e-22
>prophage 319
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4687964	4694730	6350620	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071846143.1|4687964_4689362_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.3	6.3e-27
WP_047724430.1|4689413_4690295_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|4690355_4690811_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004098690.1|4690975_4691692_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_014837425.1|4691691_4692228_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_047724428.1|4692300_4694730_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.2	5.1e-40
>prophage 320
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4716725	4717523	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098728.1|4716725_4717523_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
>prophage 321
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4723897	4724242	6350620		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|4723897_4724242_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 322
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4728373	4734177	6350620	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004098740.1|4728373_4729813_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
WP_004098741.1|4730004_4731162_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080528507.1|4731198_4734177_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.5	7.4e-41
>prophage 323
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4744629	4745388	6350620		Flavobacterium_phage(100.0%)	1	NA	NA
WP_032750056.1|4744629_4745388_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	1.6e-24
>prophage 324
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4754222	4758340	6350620		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_014228005.1|4754222_4754819_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
WP_047724399.1|4754857_4758340_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	5.5e-205
>prophage 325
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4773742	4774774	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098793.1|4773742_4774774_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	1.9e-36
>prophage 326
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4781332	4782136	6350620		Indivirus(100.0%)	1	NA	NA
WP_014837458.1|4781332_4782136_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
>prophage 327
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4786179	4790390	6350620		Lactobacillus_phage(33.33%)	5	NA	NA
WP_004129156.1|4786179_4787547_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
WP_046878642.1|4787618_4788374_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004847912.1|4788406_4789129_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_049101434.1|4789125_4789593_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
WP_025108466.1|4789658_4790390_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 328
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4794490	4795072	6350620		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|4794490_4795072_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 329
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4830124	4831600	6350620		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_080528514.1|4830124_4831600_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	2.9e-46
>prophage 330
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4846924	4851795	6350620		Catovirus(50.0%)	5	NA	NA
WP_080528795.1|4846924_4848457_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.1e-67
WP_004848020.1|4848467_4849343_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080528520.1|4849373_4850054_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004848024.1|4850056_4850701_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032748116.1|4850697_4851795_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
>prophage 331
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4859978	4868298	6350620	transposase	Streptococcus_phage(40.0%)	5	NA	NA
WP_150343100.1|4859978_4861125_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_087451024.1|4862634_4863755_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_014228088.1|4864587_4865841_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
WP_004848066.1|4865851_4866955_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_004129421.1|4867245_4868298_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
>prophage 332
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4873049	4873793	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_064379752.1|4873049_4873793_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.8e-32
>prophage 333
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4880977	4881820	6350620		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228100.1|4880977_4881820_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.2e-12
>prophage 334
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4891065	4895324	6350620		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_014837542.1|4891065_4891884_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
WP_004099328.1|4891897_4892707_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|4893563_4893746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848112.1|4893853_4894549_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_014228113.1|4894541_4895324_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 335
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4905040	4906087	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_047724330.1|4905040_4906087_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 336
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4914143	4914911	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|4914143_4914911_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 337
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4939273	4948493	6350620		Bacillus_phage(60.0%)	7	NA	NA
WP_004099396.1|4939273_4940185_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_080528530.1|4940275_4941181_+	fructokinase	NA	NA	NA	NA	NA
WP_014228145.1|4941229_4941592_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_080528531.1|4941880_4945015_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
WP_080528532.1|4945011_4946214_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_004099401.1|4946492_4947182_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_004848171.1|4947203_4948493_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 338
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4965126	4969466	6350620	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004129667.1|4965126_4966254_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004099423.1|4966276_4966609_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071957337.1|4966636_4968484_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004848195.1|4968494_4969466_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 339
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4974476	4976144	6350620		Indivirus(50.0%)	2	NA	NA
WP_025107180.1|4974476_4975580_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	3.2e-50
WP_004129690.1|4975673_4976144_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 340
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	4993140	4994844	6350620		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032748245.1|4993140_4994844_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	4.9e-21
>prophage 341
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5010065	5015732	6350620	transposase,protease	Agrobacterium_phage(20.0%)	5	NA	NA
WP_003021624.1|5010065_5010689_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|5010821_5012096_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_004099539.1|5012279_5014634_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|5014842_5015115_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_032751944.1|5015294_5015732_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
>prophage 342
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5019088	5019784	6350620		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|5019088_5019784_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 343
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5024211	5027755	6350620		Bacillus_phage(100.0%)	2	NA	NA
WP_032748266.1|5024211_5025984_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	1.7e-48
WP_025107159.1|5025976_5027755_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	2.2e-40
>prophage 344
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5039178	5040288	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848307.1|5039178_5040288_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 345
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5049441	5058830	6350620		Enterobacteria_phage(33.33%)	10	NA	NA
WP_009653595.1|5049441_5050515_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	41.4	8.2e-67
WP_004848323.1|5050627_5050891_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|5050890_5051031_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_032748285.1|5051027_5051726_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032748288.1|5051827_5053282_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.1	1.2e-15
WP_014228205.1|5053256_5053727_-	membrane protein	NA	NA	NA	NA	NA
WP_032748289.1|5053853_5054420_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|5054582_5054801_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_025107145.1|5054827_5055202_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_032748290.1|5055683_5058830_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	2.1e-49
>prophage 346
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5064346	5072193	6350620	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_032748296.1|5064346_5065282_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	8.7e-65
WP_014228211.1|5065348_5065522_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_025107143.1|5065536_5066064_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_032748298.1|5066133_5066511_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004099669.1|5066661_5067213_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_032748300.1|5067304_5069212_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_004099673.1|5069269_5069602_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|5069601_5070207_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_009653565.1|5070318_5072193_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 347
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5082253	5087464	6350620		uncultured_virus(50.0%)	5	NA	NA
WP_032748314.1|5082253_5084755_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.9e-114
WP_014228223.1|5084861_5085272_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_032748316.1|5085268_5085733_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004129981.1|5085729_5086647_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004848402.1|5086783_5087464_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.2e-24
>prophage 348
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5090650	5091337	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228231.1|5090650_5091337_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 349
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5099438	5101220	6350620		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032748342.1|5099438_5101220_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.5	7.8e-38
>prophage 350
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5108834	5109980	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_032748359.1|5108834_5109980_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.3	4.8e-49
>prophage 351
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5121946	5124707	6350620	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_004848430.1|5121946_5123332_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_049084559.1|5123626_5123839_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|5123840_5124707_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 352
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5131266	5131980	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_025107119.1|5131266_5131980_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.6	7.0e-14
>prophage 353
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5135818	5136694	6350620		Burkholderia_virus(100.0%)	1	NA	NA
WP_025107115.1|5135818_5136694_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.7e-20
>prophage 354
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5143473	5148513	6350620	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_049079709.1|5143473_5144949_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.5	3.8e-46
WP_004848495.1|5145290_5146808_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
WP_014228246.1|5146960_5147374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528555.1|5147640_5148513_-	OXY family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	74.1	1.5e-111
>prophage 355
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5153279	5154764	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004848509.1|5153279_5154764_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	5.0e-14
>prophage 356
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5162101	5163502	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_048261531.1|5162101_5163502_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	1.3e-16
>prophage 357
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5167889	5168681	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_025107094.1|5167889_5168681_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 358
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5184069	5184819	6350620		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_057173769.1|5184069_5184819_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	1.2e-19
>prophage 359
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5218233	5220945	6350620		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_086544286.1|5218233_5220945_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	1.2e-66
>prophage 360
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5231687	5233731	6350620		Bacillus_virus(50.0%)	2	NA	NA
WP_032748601.1|5231687_5232731_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_025107064.1|5232720_5233731_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.3e-16
>prophage 361
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5239737	5244414	6350620		Streptococcus_phage(50.0%)	5	NA	NA
WP_014228326.1|5239737_5241204_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
WP_004848610.1|5241438_5242290_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004100025.1|5242338_5242980_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009653202.1|5242994_5243660_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014228328.1|5243652_5244414_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.1e-30
>prophage 362
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5247877	5253795	6350620	holin	Catovirus(50.0%)	4	NA	NA
WP_080528565.1|5247877_5249542_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.0e-60
WP_032748625.1|5249556_5251029_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_047724266.1|5251039_5251633_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_080528566.1|5251761_5253795_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.4	2.0e-21
>prophage 363
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5257268	5258813	6350620		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032748628.1|5257268_5258813_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 364
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5270359	5275259	6350620		Tupanvirus(50.0%)	2	NA	NA
WP_080528568.1|5270359_5274241_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.8	5.3e-55
WP_014837773.1|5274464_5275259_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 365
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5279223	5281341	6350620		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_080528571.1|5279223_5281341_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.3	9.0e-33
>prophage 366
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5290711	5294327	6350620		Burkholderia_phage(50.0%)	3	NA	NA
WP_004100084.1|5290711_5291116_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
WP_014228365.1|5291575_5292664_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032748653.1|5292824_5294327_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.3e-14
>prophage 367
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5311462	5331467	6350620	transposase	Cedratvirus(12.5%)	17	NA	NA
WP_080528575.1|5311462_5312491_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	33.4	5.0e-29
WP_080528576.1|5312529_5313474_-	sugar kinase	NA	NA	NA	NA	NA
WP_004848729.1|5313485_5314487_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032748677.1|5314486_5315473_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080528796.1|5315469_5316975_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_004848735.1|5317019_5318000_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080528577.1|5318538_5320848_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.1	5.1e-82
WP_032747738.1|5321037_5322018_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
WP_004848741.1|5322296_5322839_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_014837800.1|5322835_5323525_-	acireductone synthase	NA	NA	NA	NA	NA
WP_032748680.1|5323704_5324865_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_032748682.1|5324865_5325495_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	1.0e-53
WP_032750104.1|5325479_5326703_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.4	1.0e-60
WP_080528578.1|5326807_5327719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002894394.1|5328588_5329152_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_004848755.1|5329396_5330962_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_004100140.1|5331038_5331467_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 368
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5335554	5337092	6350620		Morganella_phage(33.33%)	3	NA	NA
WP_004100146.1|5335554_5335764_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_024358815.1|5335828_5336212_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	1.2e-23
WP_049079604.1|5336303_5337092_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.2e-08
>prophage 369
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5341008	5343440	6350620		Stx2-converting_phage(50.0%)	2	NA	NA
WP_014228398.1|5341008_5342208_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_080528580.1|5342351_5343440_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 370
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5350456	5358554	6350620	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_025106396.1|5350456_5353039_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
WP_080528582.1|5353265_5353748_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_080528583.1|5353946_5355734_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.1	1.1e-26
WP_049101536.1|5355789_5357457_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004848813.1|5357828_5358554_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.3e-28
>prophage 371
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5364402	5365467	6350620		Pseudomonas_phage(100.0%)	1	NA	NA
WP_085954924.1|5364402_5365467_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 372
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5370122	5371784	6350620		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_025106390.1|5370122_5371784_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 373
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5376410	5386361	6350620	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_004848836.1|5376410_5378363_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_004848839.1|5378541_5380209_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_004130464.1|5380646_5382050_+	chitoporin	NA	NA	NA	NA	NA
WP_004848843.1|5382096_5382429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049104006.1|5382481_5383777_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	2.4e-60
WP_014837817.1|5383831_5384971_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_014228418.1|5384957_5386361_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	1.7e-08
>prophage 374
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5389365	5390139	6350620		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014837821.1|5389365_5390139_-	esterase	NA	W0LK50	Mycobacterium_phage	38.0	5.3e-07
>prophage 375
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5396583	5398068	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_080528797.1|5396583_5398068_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 376
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5406335	5413827	6350620		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004848888.1|5406335_5408384_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.0	1.4e-27
WP_032748739.1|5408405_5410085_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_077254487.1|5410084_5410174_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004848892.1|5410483_5410690_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_080528591.1|5410934_5412383_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	32.6	3.6e-57
WP_080528592.1|5412345_5413827_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
>prophage 377
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5419624	5420416	6350620		Kaumoebavirus(100.0%)	1	NA	NA
WP_048261198.1|5419624_5420416_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.7	2.2e-08
>prophage 378
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5459195	5462712	6350620		Vibriophage(33.33%)	4	NA	NA
WP_025108132.1|5459195_5459915_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.2e-23
WP_014228460.1|5459911_5460856_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
WP_080528598.1|5460973_5461345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653359.1|5461659_5462712_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.4e-82
>prophage 379
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5467032	5473555	6350620		Tupanvirus(33.33%)	7	NA	NA
WP_004130603.1|5467032_5468049_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	7.5e-78
WP_049102790.1|5468260_5469730_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.1	2.2e-09
WP_004848991.1|5469797_5470586_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004848993.1|5470739_5470889_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_080528600.1|5471031_5471805_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848997.1|5471804_5472494_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_080528601.1|5472496_5473555_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	5.3e-18
>prophage 380
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5480728	5481460	6350620		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004849019.1|5480728_5481460_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 381
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5488350	5493304	6350620		Catovirus(50.0%)	4	NA	NA
WP_025108118.1|5488350_5489874_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
WP_080528604.1|5489986_5491369_+	amino acid permease	NA	NA	NA	NA	NA
WP_009653774.1|5491468_5491945_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_032750110.1|5492014_5493304_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
>prophage 382
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5496979	5497702	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228488.1|5496979_5497702_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 383
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5504253	5505159	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849048.1|5504253_5505159_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.2	3.1e-27
>prophage 384
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5514982	5516722	6350620		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_057173980.1|5514982_5516722_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 385
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5521863	5530400	6350620		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_014228507.1|5521863_5522709_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
WP_014837873.1|5522708_5523701_+	transketolase family protein	NA	NA	NA	NA	NA
WP_049079915.1|5524001_5525351_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_080528609.1|5525551_5527696_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	5.7e-43
WP_025108100.1|5527738_5528707_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|5528842_5529103_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|5529387_5529654_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_032748839.1|5529722_5530400_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	2.0e-18
>prophage 386
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5536971	5542075	6350620		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|5536971_5537694_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|5537690_5538350_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849110.1|5538483_5539230_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004130751.1|5539601_5540105_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004100495.1|5540323_5541211_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|5541562_5542075_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 387
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5545981	5553037	6350620		Klosneuvirus(33.33%)	6	NA	NA
WP_025108092.1|5545981_5547022_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
WP_032748856.1|5547173_5548550_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.8	6.5e-24
WP_004849131.1|5548620_5549337_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130773.1|5549379_5550294_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032748858.1|5550484_5551267_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_032748859.1|5551444_5553037_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	2.5e-59
>prophage 388
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5560907	5563340	6350620		Citrobacter_phage(100.0%)	1	NA	NA
WP_032748865.1|5560907_5563340_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 389
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5567518	5569372	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228532.1|5567518_5569372_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	4.1e-13
>prophage 390
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5579046	5588377	6350620		Escherichia_phage(25.0%)	16	NA	NA
WP_064342388.1|5579046_5580333_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.2	6.3e-122
WP_004111685.1|5580332_5580548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528611.1|5580609_5581116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049250967.1|5581112_5581337_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	4.0e-16
WP_155774240.1|5581379_5581613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653813.1|5581678_5581972_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_077267846.1|5582561_5583068_-	hypothetical protein	NA	A0A0R6PJG5	Moraxella_phage	50.6	2.5e-13
WP_049111952.1|5583117_5583387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082865.1|5583386_5583800_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	71.4	2.6e-45
WP_080528613.1|5584065_5585142_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	43.7	2.5e-31
WP_080528614.1|5585154_5585448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528615.1|5585444_5585657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082868.1|5585649_5586435_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	2.2e-61
WP_080528616.1|5586431_5586848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083026.1|5586850_5587387_+	hypothetical protein	NA	J9Q748	Salmonella_phage	77.2	5.2e-78
WP_080528617.1|5587981_5588377_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	77.1	6.1e-52
>prophage 391
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5592322	5687984	6350620	head,plate,transposase,tRNA,portal,capsid,terminase,protease,tail	Salmonella_phage(11.9%)	92	NA	NA
WP_080528621.1|5592322_5592916_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	64.8	5.0e-42
WP_080528622.1|5592912_5593557_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	77.6	2.0e-100
WP_009653799.1|5593553_5593694_+	YlcG family protein	NA	NA	NA	NA	NA
WP_080528623.1|5593690_5594290_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.4	5.4e-68
WP_047722936.1|5594528_5595722_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	4.3e-141
WP_080528624.1|5596309_5596624_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	88.1	7.5e-45
WP_080528625.1|5596626_5597169_+	lysozyme	NA	H6WRZ4	Salmonella_phage	80.1	3.2e-83
WP_080528626.1|5597165_5597555_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	48.1	1.8e-19
WP_070082874.1|5597790_5598111_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_070082875.1|5598249_5598513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528627.1|5598587_5599226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528628.1|5599294_5600008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048982866.1|5600263_5600827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528629.1|5600768_5602895_+|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.0	4.7e-98
WP_048982863.1|5602904_5603156_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_080528798.1|5603212_5604808_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.9	5.1e-89
WP_048982862.1|5604804_5605674_+	S49 family peptidase	NA	K4I1N3	Providencia_phage	37.7	1.6e-49
WP_080528630.1|5605675_5606266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528631.1|5606265_5606670_+|head	head decoration protein	head	NA	NA	NA	NA
WP_080528632.1|5606769_5607819_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.6	1.9e-52
WP_048982855.1|5607820_5608189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048982854.1|5608194_5608554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528633.1|5608550_5609096_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_048263923.1|5609099_5609279_+	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	57.1	3.5e-07
WP_080528634.1|5609279_5610791_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	5.1e-107
WP_080528635.1|5610794_5611163_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070082889.1|5611164_5611443_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_070082890.1|5611584_5613459_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	41.9	2.7e-17
WP_080528636.1|5613503_5614904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082892.1|5614900_5615980_+|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.5	6.8e-37
WP_080528799.1|5616015_5616564_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	33.1	5.4e-06
WP_048294792.1|5616556_5617006_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	40.7	3.8e-18
WP_080528637.1|5616995_5618144_+|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	27.5	1.9e-16
WP_080528638.1|5618140_5618824_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.7	8.4e-33
WP_080528640.1|5619899_5620865_+	hypothetical protein	NA	K4MPY5	Escherichia_phage	31.5	1.1e-06
WP_150343100.1|5620925_5622072_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.4	2.3e-144
WP_032721350.1|5622595_5623798_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	3.6e-95
WP_046877864.1|5623826_5624585_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	1.6e-11
WP_047724208.1|5624710_5625304_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032748874.1|5625622_5626858_+	MFS transporter	NA	NA	NA	NA	NA
WP_047724207.1|5626905_5627721_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014228591.1|5627720_5628923_-	MFS transporter	NA	NA	NA	NA	NA
WP_014228592.1|5629105_5629648_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004849356.1|5629806_5631492_-	transporter	NA	NA	NA	NA	NA
WP_004849358.1|5631759_5632143_+	membrane protein	NA	NA	NA	NA	NA
WP_004100567.1|5632149_5632413_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_009653259.1|5632617_5632908_+	YbjC family protein	NA	NA	NA	NA	NA
WP_025108025.1|5632891_5633614_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653278.1|5633717_5634620_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_032748880.1|5634709_5635189_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_004849369.1|5636313_5637426_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_150343243.1|5637528_5638662_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_080528642.1|5638672_5639629_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_080528643.1|5639621_5640467_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004100588.1|5640524_5641013_+	YbjO family protein	NA	NA	NA	NA	NA
WP_014228603.1|5641055_5642186_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	2.2e-25
WP_080528800.1|5642264_5642981_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	1.5e-35
WP_080528644.1|5642977_5644450_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	2.5e-26
WP_014228605.1|5645154_5645886_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228606.1|5646059_5646728_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_080528645.1|5646727_5647444_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004130868.1|5647450_5648182_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004111834.1|5648201_5648930_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_004849391.1|5649157_5649673_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|5649790_5650114_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014837943.1|5650110_5650941_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
WP_009653274.1|5650937_5651951_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032748886.1|5652047_5653481_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_032694256.1|5653491_5654493_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_025108290.1|5654647_5656366_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_014228613.1|5656518_5656953_+	DoxX family protein	NA	NA	NA	NA	NA
WP_032748889.1|5656992_5657961_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_025108293.1|5657971_5659624_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_014837946.1|5659769_5660669_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004849414.1|5660794_5661490_-	aquaporin Z	NA	NA	NA	NA	NA
WP_032748892.1|5661872_5663531_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_014228619.1|5663706_5664822_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_025108294.1|5664818_5666765_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_004100627.1|5666833_5667064_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|5667388_5667706_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_080528646.1|5667736_5670019_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_002211347.1|5670156_5670375_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_025108296.1|5670654_5671359_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_032720837.1|5671397_5673119_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	2.4e-15
WP_032748895.1|5673119_5674886_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	1.2e-22
WP_004849433.1|5675000_5675969_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
WP_002439523.1|5676500_5676995_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_080528647.1|5677130_5681249_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.0e-88
WP_004130911.1|5681370_5681982_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_032748904.1|5681990_5683334_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	2.7e-83
WP_009653254.1|5683425_5684718_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_009653301.1|5687366_5687984_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	3.4e-73
>prophage 392
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5695116	5698343	6350620		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|5695116_5695857_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_014228637.1|5696060_5698343_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 393
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5702392	5703481	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849472.1|5702392_5703481_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 394
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5707775	5712328	6350620		Bacillus_phage(66.67%)	3	NA	NA
WP_004100704.1|5707775_5708063_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_080528648.1|5708278_5710534_+	ComEC family protein	NA	Q0H255	Geobacillus_phage	28.3	4.5e-14
WP_032748909.1|5710579_5712328_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 395
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5729636	5737996	6350620	tRNA	Enterobacteria_phage(20.0%)	5	NA	NA
WP_032748919.1|5729636_5730716_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	54.0	1.9e-100
WP_004849497.1|5731307_5732708_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_025107499.1|5733011_5734214_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_080528652.1|5734541_5737157_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_014837971.1|5737222_5737996_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 396
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5744708	5746616	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_080528654.1|5744708_5746616_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 397
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5759391	5769503	6350620	transposase	Shigella_phage(75.0%)	7	NA	NA
WP_014228667.1|5759391_5761446_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
WP_014228668.1|5761474_5761933_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_014228669.1|5762087_5762501_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_080528657.1|5762545_5763739_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.5	5.6e-141
WP_104457020.1|5764957_5766185_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_155774242.1|5766170_5768441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457020.1|5768274_5769503_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
>prophage 398
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5779206	5781354	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_004849540.1|5779206_5781354_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
>prophage 399
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5791928	5792588	6350620	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|5791928_5792588_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 400
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5811026	5811767	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_004849580.1|5811026_5811767_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-29
>prophage 401
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5845248	5851871	6350620		Morganella_phage(50.0%)	5	NA	NA
WP_080528678.1|5845248_5845461_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.6	1.9e-23
WP_004849645.1|5846125_5846347_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
WP_080528680.1|5846983_5850103_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.9	1.6e-46
WP_080528801.1|5850421_5850808_-	transporter	NA	NA	NA	NA	NA
WP_004131145.1|5851166_5851871_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
>prophage 402
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5865890	5866919	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_047724125.1|5865890_5866919_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 403
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5872314	5875710	6350620	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_014228757.1|5872314_5873697_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	5.7e-20
WP_025106220.1|5873674_5874175_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_025106221.1|5874171_5874498_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_032747738.1|5874729_5875710_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
>prophage 404
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5888362	5889103	6350620		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228772.1|5888362_5889103_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 405
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5896548	5897451	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_025106240.1|5896548_5897451_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 406
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5901682	5908260	6350620		Serratia_phage(50.0%)	4	NA	NA
WP_080528690.1|5901682_5903980_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_004100938.1|5904031_5904352_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|5904372_5905449_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_064380748.1|5905758_5908260_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.6e-12
>prophage 407
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5922163	5924411	6350620		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|5922163_5922337_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_080528694.1|5922572_5923895_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.4	2.7e-200
WP_004849801.1|5923916_5924411_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	77.1	5.7e-39
>prophage 408
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5941035	5944193	6350620		Cronobacter_phage(50.0%)	4	NA	NA
WP_080528702.1|5941035_5942100_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	2.5e-92
WP_014838068.1|5942150_5942444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528703.1|5942586_5943375_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_049079877.1|5943497_5944193_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	2.0e-26
>prophage 409
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5956906	5957461	6350620		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_014228822.1|5956906_5957461_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 410
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5965830	5966751	6350620		Morganella_phage(100.0%)	1	NA	NA
WP_004849864.1|5965830_5966751_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 411
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5969981	5970227	6350620		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|5969981_5970227_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 412
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5991464	5992646	6350620		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004131399.1|5991464_5992199_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
WP_000103754.1|5992409_5992646_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 413
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	5995946	5996588	6350620		Pseudomonas_phage(100.0%)	1	NA	NA
WP_025106911.1|5995946_5996588_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	5.9e-28
>prophage 414
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6012359	6012617	6350620		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|6012359_6012617_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 415
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6018909	6022660	6350620		Planktothrix_phage(50.0%)	4	NA	NA
WP_014228855.1|6018909_6019611_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
WP_032721372.1|6019610_6020855_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_025106920.1|6020903_6021815_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_032749587.1|6021829_6022660_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 416
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6029913	6030864	6350620		Cyanophage(100.0%)	1	NA	NA
WP_080528713.1|6029913_6030864_+	transaldolase	NA	A0A127KMN5	Cyanophage	34.5	6.0e-13
>prophage 417
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6036144	6037281	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|6036144_6037281_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 418
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6044064	6114821	6350620	head,plate,transposase,tRNA,portal,capsid,integrase,terminase,tail	Enterobacteria_phage(45.0%)	76	6043201:6043218	6108001:6108018
6043201:6043218	attL	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_004131470.1|6044064_6045435_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
WP_004131471.1|6045438_6046080_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004849976.1|6046139_6047246_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_025106932.1|6047284_6047761_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004138338.1|6047781_6048432_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004131480.1|6048668_6049919_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_080528716.1|6050064_6051849_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	7.3e-20
WP_080528717.1|6051926_6053117_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_009653379.1|6053396_6054440_+	type II asparaginase	NA	NA	NA	NA	NA
WP_080528718.1|6054476_6055244_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	6.8e-15
WP_049082199.1|6055244_6056198_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_080528719.1|6056194_6057193_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.7	2.7e-11
WP_080528720.1|6057189_6058092_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080528721.1|6058150_6060487_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_064380621.1|6060584_6061532_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_032749540.1|6061528_6062050_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_049101335.1|6062309_6063098_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004138325.1|6063641_6064556_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
WP_025106941.1|6064646_6065285_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004131510.1|6065414_6065678_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_086074258.1|6065726_6065852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100248259.1|6065992_6066067_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004101234.1|6066066_6066168_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_047724073.1|6066225_6067239_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_080528722.1|6067470_6068484_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.2	2.2e-154
WP_038423230.1|6068599_6068899_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
WP_020806130.1|6069021_6069300_+	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004131515.1|6069320_6069539_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_023287455.1|6069554_6069932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337018.1|6069947_6070220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|6070288_6070513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528723.1|6070509_6071076_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	6.8e-12
WP_080528724.1|6071308_6072241_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.4	2.0e-85
WP_080528725.1|6072281_6074831_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	58.7	1.1e-247
WP_061155006.1|6074833_6075352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150343259.1|6075474_6076122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528727.1|6076165_6077740_-	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	29.0	4.9e-52
WP_080528728.1|6078177_6079239_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.6	5.3e-143
WP_023287464.1|6079232_6080960_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	1.8e-233
WP_080528729.1|6081116_6081956_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	3.6e-94
WP_004213107.1|6081965_6083000_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_080528730.1|6083049_6083916_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	5.8e-71
WP_080528731.1|6084020_6084536_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	8.3e-41
WP_004131559.1|6084535_6084736_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_080528732.1|6084726_6085011_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_080528733.1|6085007_6085553_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	2.4e-30
WP_080528802.1|6085564_6085894_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032720044.1|6086075_6086543_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_080528734.1|6086539_6087175_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_031593575.1|6087171_6087756_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	58.3	3.9e-55
WP_017898624.1|6087752_6088103_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_048261656.1|6088104_6089028_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_080528735.1|6089017_6092047_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_031593568.1|6092043_6092259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528736.1|6092243_6093281_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	28.6	1.2e-11
WP_087451024.1|6093273_6094394_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_150343262.1|6094988_6097454_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_080528738.1|6097775_6098267_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	1.5e-52
WP_080528739.1|6098282_6101258_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	2.8e-221
WP_032440702.1|6101244_6101403_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_004131585.1|6101402_6101720_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_023287479.1|6101765_6102281_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_080528740.1|6102280_6103453_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	69.5	4.6e-156
WP_080528741.1|6103607_6104747_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	5.2e-144
WP_004213128.1|6104790_6105042_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_025106943.1|6105303_6105543_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014228940.1|6105537_6105882_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032749537.1|6105868_6106378_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_080528742.1|6106551_6107232_+	CTP synthase	NA	NA	NA	NA	NA
WP_080528743.1|6107269_6108454_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
6108001:6108018	attR	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_032749534.1|6108554_6109346_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004138309.1|6109329_6109776_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032749533.1|6109939_6110440_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032749532.1|6110473_6111970_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
WP_032749531.1|6112331_6113489_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004138302.1|6113537_6114821_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 419
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6118153	6119008	6350620		Indivirus(100.0%)	1	NA	NA
WP_032749530.1|6118153_6119008_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	1.9e-13
>prophage 420
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6122633	6123887	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_032749523.1|6122633_6123887_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	5.3e-25
>prophage 421
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6129580	6133635	6350620		Staphylococcus_phage(50.0%)	4	NA	NA
WP_032749514.1|6129580_6130564_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	5.7e-06
WP_047724041.1|6130697_6131456_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032749512.1|6131597_6132956_+	MFS transporter	NA	NA	NA	NA	NA
WP_047724039.1|6132993_6133635_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.1	7.7e-20
>prophage 422
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6139581	6141537	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228966.1|6139581_6141537_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 423
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6145776	6146409	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_032749497.1|6145776_6146409_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	2.6e-12
>prophage 424
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6152419	6153640	6350620		Klosneuvirus(100.0%)	1	NA	NA
WP_032749488.1|6152419_6153640_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-27
>prophage 425
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6163057	6163885	6350620		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|6163057_6163885_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 426
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6170101	6175842	6350620		Tupanvirus(50.0%)	5	NA	NA
WP_080528748.1|6170101_6172360_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.7	3.5e-144
WP_072351776.1|6172448_6172796_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228987.1|6172872_6174264_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_032749476.1|6174398_6174989_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_032749474.1|6175080_6175842_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.4e-15
>prophage 427
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6180218	6181535	6350620		Streptococcus_phage(100.0%)	1	NA	NA
WP_080528749.1|6180218_6181535_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.1	6.6e-42
>prophage 428
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6191255	6194213	6350620		Acinetobacter_phage(100.0%)	2	NA	NA
WP_025106981.1|6191255_6192614_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
WP_004850135.1|6192617_6194213_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 429
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6207166	6209764	6350620		Tupanvirus(100.0%)	1	NA	NA
WP_032749439.1|6207166_6209764_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.9e-89
>prophage 430
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6216046	6216637	6350620		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|6216046_6216637_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 431
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6222214	6228400	6350620		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_032749434.1|6222214_6224149_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
WP_014229020.1|6224230_6225388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004121225.1|6225570_6226359_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004850180.1|6226596_6227406_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
WP_004850183.1|6227407_6228400_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	1.2e-08
>prophage 432
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6258095	6259115	6350620		Bacillus_phage(100.0%)	1	NA	NA
WP_080528754.1|6258095_6259115_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.0	2.0e-14
>prophage 433
NZ_CP020358	Klebsiella oxytoca strain AR_0147, complete genome	6350620	6267945	6343530	6350620	holin,plate,tRNA,protease,tail	Cronobacter_phage(20.0%)	70	NA	NA
WP_032749393.1|6267945_6269289_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014229072.1|6269285_6269951_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032749392.1|6269947_6271636_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014229074.1|6271780_6272272_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_047723945.1|6272518_6275161_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.6	2.2e-97
WP_071846113.1|6275157_6277530_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.6	4.0e-21
WP_080528756.1|6277541_6278414_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_139134506.1|6278406_6281028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050597573.1|6281031_6282090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057174084.1|6282130_6283165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071957396.1|6283161_6283428_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_150343311.1|6283427_6284630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528758.1|6288383_6290144_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_080528759.1|6290107_6291193_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032749377.1|6291170_6291710_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838282.1|6291711_6292167_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_080528760.1|6292190_6293525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057174086.1|6293687_6295367_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_025107999.1|6295421_6296876_-	MFS transporter	NA	NA	NA	NA	NA
WP_032749371.1|6297767_6299150_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_014229093.1|6299213_6300173_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032749369.1|6300187_6300721_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_047723944.1|6300717_6301941_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047723943.1|6301937_6302660_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_080528761.1|6302661_6303915_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038424404.1|6303911_6304631_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047723942.1|6304627_6305062_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_032693666.1|6305303_6306029_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
WP_071846167.1|6306129_6306474_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_032749358.1|6306571_6307693_-	MFS transporter	NA	NA	NA	NA	NA
WP_014229103.1|6307902_6309039_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014838299.1|6309210_6310095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004850284.1|6310208_6311093_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032749356.1|6311251_6312232_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_071532263.1|6312947_6313136_+	cold-shock protein	NA	NA	NA	NA	NA
WP_014838304.1|6313497_6314127_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032720811.1|6314252_6314834_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014229112.1|6315030_6315594_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_080528762.1|6315648_6315963_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004850297.1|6316140_6316332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528763.1|6316488_6316683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004850301.1|6316970_6317393_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_080528764.1|6317392_6318658_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.6	9.1e-158
WP_080528805.1|6318730_6319798_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014229116.1|6319814_6320558_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
WP_049082088.1|6321174_6321795_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004850311.1|6322137_6323121_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080528765.1|6323603_6324977_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_080528766.1|6325021_6325957_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	1.6e-138
WP_032749348.1|6326160_6326433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025107976.1|6326770_6327709_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|6328107_6328398_-	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004101601.1|6328586_6329021_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|6329103_6329316_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_009652979.1|6329469_6330576_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_032750138.1|6330933_6334461_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_009653037.1|6335106_6335643_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_014229124.1|6336106_6336469_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_009653048.1|6336545_6336938_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032749344.1|6336927_6337200_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_004850338.1|6337207_6337750_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	5.2e-70
WP_004850340.1|6337805_6338225_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_014229127.1|6338344_6339007_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
WP_004850345.1|6339079_6339391_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
WP_048263674.1|6339453_6339699_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	40.0	2.3e-09
WP_032749342.1|6339783_6340893_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
WP_032749341.1|6340915_6341263_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.0	2.4e-36
WP_025107965.1|6341259_6342012_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.3	5.7e-115
WP_032749340.1|6342013_6342748_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.2	1.6e-125
WP_004850357.1|6342915_6343530_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	69.6	1.2e-67
>prophage 1
NZ_CP020359	Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence	110705	25919	53677	110705	integrase,transposase	Salmonella_phage(20.0%)	22	28485:28500	54498:54513
WP_020804955.1|25919_26909_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.1	1.5e-70
WP_009654831.1|27053_27836_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.5	2.7e-51
WP_009654830.1|27832_28600_-	hypothetical protein	NA	NA	NA	NA	NA
28485:28500	attL	AAAGCCACGCCGCCAG	NA	NA	NA	NA
WP_009654828.1|28639_28990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073558205.1|29521_29791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073558204.1|29778_30354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528808.1|30384_30879_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_080528809.1|31068_31683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049110611.1|32401_32920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046664160.1|33152_33476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528810.1|33662_34337_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	2.2e-81
WP_080528811.1|34465_35368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|35840_37160_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|37409_38291_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|38677_39457_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39453_40479_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40585_43615_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|43724_45440_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049110607.1|47232_47919_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	5.3e-27
WP_023320118.1|47915_49103_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.7	2.1e-18
WP_000427623.1|49627_50632_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|50710_53677_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
54498:54513	attR	AAAGCCACGCCGCCAG	NA	NA	NA	NA
