The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	178688	185505	4162732		Acinetobacter_phage(42.86%)	9	NA	NA
WP_003636724.1|178688_179468_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.0	5.1e-58
WP_003636725.1|179460_180495_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.9	4.6e-75
WP_003636726.1|180484_181051_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.5e-56
WP_003636730.1|181270_181996_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	7.3e-19
WP_003636733.1|181992_182535_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003636734.1|182515_183088_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003636736.1|183084_183612_-	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	47.1	1.4e-24
WP_003636738.1|183611_184574_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	4.2e-38
WP_003636739.1|184707_185505_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.1e-23
>prophage 2
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	306050	368061	4162732	transposase	Escherichia_phage(33.33%)	44	NA	NA
WP_172622929.1|306050_306491_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_003635442.1|306549_306876_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003636888.1|306948_307518_-	MepB family protein	NA	NA	NA	NA	NA
WP_012979202.1|307581_308034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636891.1|308507_308957_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012979201.1|309536_309821_-	nitrile hydratase subunit beta	NA	NA	NA	NA	NA
WP_003636895.1|310252_313387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636897.1|314191_314884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012979200.1|314954_316931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636900.1|317479_317680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636902.1|317713_319483_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_003636903.1|319816_320989_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003636907.1|321851_325166_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_172622908.1|325728_327861_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	33.6	5.1e-76
WP_003636911.1|328667_331886_-	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	A0A0N9RV52	Escherichia_phage	40.2	6.2e-09
WP_125461269.1|332950_333313_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_035905115.1|333340_333748_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003636913.1|333791_333986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003636915.1|334099_334312_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003636916.1|334324_334489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003636918.1|335187_335607_-	TIGR03792 family protein	NA	NA	NA	NA	NA
WP_003636919.1|335997_336936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619715.1|337275_338562_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_080619716.1|338643_339690_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_080619717.1|340378_341551_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_080619718.1|341569_342682_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_080619719.1|343122_343983_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080619720.1|344370_344877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125461270.1|345182_345404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619721.1|346055_347027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165391559.1|346917_348258_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.3	8.0e-19
WP_080619723.1|348260_349325_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_165391560.1|349333_349504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125461271.1|349735_353047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619725.1|353900_354620_+	endonuclease	NA	NA	NA	NA	NA
WP_165391561.1|355084_356002_-	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	35.0	3.7e-44
WP_080619728.1|356667_357000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619729.1|357570_358698_-	DUF4424 domain-containing protein	NA	NA	NA	NA	NA
WP_080619730.1|361034_361952_+	bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080619968.1|362069_362327_-	YheU family protein	NA	NA	NA	NA	NA
WP_080619731.1|362390_363296_-	DNA polymerase III subunit epsilon	NA	A0A223W0B0	Agrobacterium_phage	37.1	1.4e-30
WP_080619732.1|364423_366823_-	SidC	NA	NA	NA	NA	NA
WP_105166017.1|367235_367673_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080619734.1|367743_368061_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	39.6	6.0e-10
>prophage 3
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	2702977	2760734	4162732	transposase,integrase,protease	Moraxella_phage(16.67%)	49	2725879:2725938	2735965:2736031
WP_012979552.1|2702977_2704219_+|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	34.3	9.9e-56
WP_012979549.1|2705428_2706613_-	MFS transporter	NA	NA	NA	NA	NA
WP_012979548.1|2706622_2707837_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012979547.1|2707818_2709180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979546.1|2709166_2709892_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_012979545.1|2709897_2710533_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012979544.1|2710501_2711563_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_012979543.1|2711913_2713323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012979542.1|2713233_2714454_-	MFS transporter	NA	NA	NA	NA	NA
WP_012979541.1|2714456_2715242_-	uroporphyrinogen III methylase	NA	NA	NA	NA	NA
WP_012979540.1|2715268_2715457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125461282.1|2715520_2715742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012979539.1|2716230_2717082_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012979538.1|2717310_2723376_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_049775004.1|2723514_2723697_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_049775003.1|2723696_2724389_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	41.1	8.9e-14
WP_041819204.1|2724375_2724558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619847.1|2724491_2724650_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041819201.1|2724720_2725743_+	hypothetical protein	NA	NA	NA	NA	NA
2725879:2725938	attL	GCCAAAACCCAGACTGGGATTGGCTCCCCGGACAAGACTCGAACTTGTGACCTAATGATT	NA	NA	NA	NA
WP_080619848.1|2726174_2726384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105166058.1|2726700_2726961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619850.1|2727218_2728469_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	30.5	5.5e-46
WP_080619851.1|2728517_2729144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619852.1|2729318_2729531_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_165391546.1|2730705_2732154_+	DNA primase	NA	Q9T217	Streptomyces_phage	27.1	9.2e-21
WP_105166101.1|2733117_2733600_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	36.7	1.3e-16
WP_080619856.1|2733841_2734066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619857.1|2734085_2734793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619858.1|2735022_2735316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619859.1|2735541_2735820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003634054.1|2736208_2737387_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
2735965:2736031	attR	GCCAAAACCCAGACTGGGATTGGCTCCCCGGACAAGACTCGAACTTGTGACCTAATGATTAACAGTC	NA	NA	NA	NA
WP_003634056.1|2737418_2739410_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_003634060.1|2739714_2740269_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003634063.1|2740404_2741373_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003634067.1|2741749_2743870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634068.1|2744220_2745297_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003634071.1|2745548_2746949_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	B2ZXX8	Ralstonia_phage	40.0	6.0e-94
WP_003634073.1|2746997_2748569_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_003634075.1|2748650_2748974_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003634077.1|2749105_2749681_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_003634079.1|2749697_2751005_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_003634083.1|2750997_2752227_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_003634086.1|2752223_2753396_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003634088.1|2753458_2753623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003634092.1|2754211_2755822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979536.1|2756011_2757577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003634100.1|2757735_2758689_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_003634103.1|2758685_2760212_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_003634105.1|2760227_2760734_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	2878579	2914990	4162732	transposase,integrase	Bacillus_phage(25.0%)	34	2867698:2867714	2920167:2920183
2867698:2867714	attL	GGATCAAATTAATAAAA	NA	NA	NA	NA
WP_080619883.1|2878579_2880214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080619884.1|2880210_2880561_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_105166061.1|2880563_2880944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619885.1|2881052_2882177_+	HD domain-containing protein	NA	A0A1V0SLI6	Klosneuvirus	26.5	8.2e-17
WP_080619886.1|2882329_2883406_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	31.0	3.1e-37
WP_165391539.1|2884101_2884926_+	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_080619888.1|2885376_2885826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080619889.1|2886535_2887237_-|integrase	phage integrase family protein	integrase	A0A1B1P7C7	Bacillus_phage	24.8	1.8e-09
WP_080619890.1|2887236_2890137_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	22.2	1.8e-44
WP_080619891.1|2890286_2890670_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_080619892.1|2890676_2891189_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_080619893.1|2891215_2891941_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080619894.1|2891957_2892929_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_080619896.1|2893975_2894437_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_080619897.1|2894459_2894888_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_080619898.1|2894890_2895259_-	VOC family protein	NA	NA	NA	NA	NA
WP_080619899.1|2895549_2896242_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	6.1e-15
WP_080619900.1|2896350_2897328_-	phosphotransferase	NA	NA	NA	NA	NA
WP_080619901.1|2897494_2897809_+	YggU family protein	NA	NA	NA	NA	NA
WP_080619902.1|2897887_2898466_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080619903.1|2898452_2898890_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_080619981.1|2898873_2899695_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_080619904.1|2899750_2901865_-	serine hydrolase	NA	NA	NA	NA	NA
WP_080619905.1|2902105_2902798_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	1.1e-24
WP_165391540.1|2903043_2904417_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_080619908.1|2904846_2906145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080619909.1|2906684_2908133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165391541.1|2908375_2908648_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.0	1.0e-13
WP_080619911.1|2908640_2909117_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080619912.1|2909102_2909444_-	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_080619913.1|2909591_2912012_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_165391542.1|2912019_2913468_-	recombinase RecA	NA	NA	NA	NA	NA
WP_080619915.1|2913709_2914129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105166063.1|2914177_2914990_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.5	3.1e-50
2920167:2920183	attR	TTTTATTAATTTGATCC	NA	NA	NA	NA
>prophage 5
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	3502188	3557959	4162732	transposase,tRNA,protease	Alteromonas_phage(11.11%)	50	NA	NA
WP_003635331.1|3502188_3502863_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003635333.1|3502947_3504345_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003635335.1|3504442_3505066_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003635337.1|3505142_3506267_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003635342.1|3506336_3507473_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_003635344.1|3507475_3508390_+|protease	protease modulator HflC	protease	R4VJU7	Alteromonas_phage	26.3	1.5e-05
WP_003635346.1|3508476_3509775_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.1	5.3e-68
WP_012979357.1|3510271_3511756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979356.1|3511950_3512679_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003635352.1|3512838_3513504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979355.1|3513635_3514211_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635356.1|3514324_3515167_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003635359.1|3515356_3516709_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.3	3.6e-19
WP_012979354.1|3516799_3518023_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_003635363.1|3518015_3519557_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003635368.1|3519929_3520688_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.3	2.0e-22
WP_003635370.1|3520716_3521499_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003635371.1|3521662_3523015_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003635373.1|3523149_3525462_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003635375.1|3525629_3526130_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_003635377.1|3526144_3527188_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003635379.1|3527343_3527796_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003635381.1|3527792_3528563_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003635384.1|3528755_3530042_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.6e-96
WP_012979353.1|3530084_3530855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012979352.1|3531184_3532789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635390.1|3532923_3533421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003635391.1|3533719_3534004_+	DUF3175 domain-containing protein	NA	A0A0F6TH17	Sinorhizobium_phage	66.3	4.7e-22
WP_003635393.1|3534181_3534409_+	ChaB family protein	NA	A5IZT6	Spodoptera_litura_granulovirus	42.7	1.3e-09
WP_003635395.1|3534578_3535427_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012979350.1|3535850_3536525_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_003635401.1|3536995_3537619_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003635403.1|3537848_3539018_-	tetracycline destructase Tet(56)	NA	NA	NA	NA	NA
WP_003635408.1|3539263_3539476_-	ORF6N domain-containing protein	NA	NA	NA	NA	NA
WP_012979349.1|3539818_3540565_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003635412.1|3540818_3542672_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_003635416.1|3543728_3546491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012979348.1|3546980_3548612_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_080619950.1|3548907_3549177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003635421.1|3549285_3550254_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003635422.1|3550332_3551424_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012979347.1|3551480_3552050_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003635425.1|3552208_3552865_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003635427.1|3553056_3553368_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003635429.1|3553381_3553660_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003635431.1|3553829_3554855_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003635433.1|3555140_3555647_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.9	3.9e-27
WP_085956292.1|3555839_3556907_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	32.2	1.6e-14
WP_172622929.1|3557133_3557574_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_003635442.1|3557632_3557959_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP020412	Legionella longbeachae strain FDAARGOS_201 chromosome, complete genome	4162732	3741652	3750902	4162732		Micromonas_pusilla_virus(16.67%)	6	NA	NA
WP_003635760.1|3741652_3743602_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	1.5e-146
WP_003635761.1|3743905_3745045_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.7	5.7e-26
WP_003635762.1|3745180_3746293_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	1.7e-51
WP_003635763.1|3746401_3747550_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.2	2.6e-127
WP_003635764.1|3747560_3748886_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.9	2.8e-48
WP_003635765.1|3749219_3750902_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	29.1	1.3e-18
