The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	837	15376	4405338	plate,tail,holin,head	Bacillus_phage(81.25%)	17	NA	NA
WP_009329208.1|837_1287_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_009329207.1|1302_1653_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	60.0	1.3e-32
WP_069500677.1|1582_1957_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	65.6	2.4e-37
WP_069500676.1|1949_2333_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	69.3	5.9e-44
WP_069500675.1|2329_2710_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	54.8	1.8e-32
WP_009329203.1|2709_3318_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	8.2e-56
WP_009329202.1|3377_3713_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_025807965.1|3910_7801_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	62.7	0.0e+00
WP_009330398.1|7800_8637_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	71.8	2.0e-113
WP_080626726.1|8649_10359_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.2	1.9e-219
WP_069500673.1|10395_11970_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.6	1.1e-261
WP_069500672.1|12006_13353_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	86.3	9.9e-86
WP_080626727.1|13365_13689_+	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	46.4	7.8e-13
WP_080626728.1|13685_13871_+	XkdX family protein	NA	NA	NA	NA	NA
WP_069500916.1|13933_14203_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_080626729.1|14218_14482_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	2.7e-32
WP_080626730.1|14533_15376_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	54.3	3.7e-46
>prophage 2
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	88810	98734	4405338		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|88810_90106_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|90180_90897_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|90898_91153_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|91149_91833_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|91816_94045_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|94020_95451_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|95574_96615_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_080626734.1|96611_97199_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.1e-28
WP_003179539.1|97195_98734_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 3
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	328491	335429	4405338		uncultured_Caudovirales_phage(50.0%)	11	NA	NA
WP_080626760.1|328491_328815_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	35.7	1.4e-06
WP_080626761.1|328989_329325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626762.1|329321_329567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761925.1|329566_329740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626763.1|329740_330067_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	36.1	9.9e-08
WP_080626765.1|330418_330802_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.7	6.0e-20
WP_080626766.1|331574_332369_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	52.3	4.8e-64
WP_080626767.1|332338_332839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026588499.1|332838_333042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626768.1|333038_334388_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.6	1.7e-125
WP_080626769.1|334409_335429_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	9.5e-73
>prophage 4
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	339158	430020	4405338	transposase,protease,terminase,tRNA,holin,portal,head,capsid,integrase,tail	Bacillus_phage(43.75%)	98	391269:391284	430440:430455
WP_017474282.1|339158_339914_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.8	1.1e-52
WP_080626771.1|339937_340369_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	8.8e-12
WP_080626772.1|340409_341489_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	36.5	2.8e-14
WP_080626773.1|341694_343992_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	6.0e-123
WP_080626774.1|343992_345042_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	2.2e-80
WP_048356262.1|345041_345362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626775.1|345343_345877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626776.1|345882_346248_+	hypothetical protein	NA	M4HNF9	Bacillus_phage	38.1	1.7e-11
WP_080626777.1|346252_346510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626778.1|346506_346701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626779.1|346697_346898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761926.1|346894_347044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114555277.1|347037_347400_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	55.0	9.6e-28
WP_080626780.1|347406_349506_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.4	0.0e+00
WP_006640508.1|349537_349870_+	DUF1140 family protein	NA	NA	NA	NA	NA
WP_075876064.1|349908_350877_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	4.5e-149
WP_080626781.1|350927_351509_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	2.0e-43
WP_048354323.1|351508_351736_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	78.2	6.0e-20
WP_155761927.1|351736_351907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626782.1|351911_352469_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.4	8.7e-28
WP_080626783.1|352484_353549_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	51.9	2.4e-34
WP_016885220.1|353545_354106_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	46.4	6.7e-36
WP_080626784.1|354094_354481_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	37.0	2.0e-07
WP_080626785.1|354591_355866_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.9e-150
WP_080626786.1|355865_356255_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.3	2.5e-18
WP_080626787.1|356247_356736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626788.1|356824_357625_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	7.0e-71
WP_080626789.1|357657_357969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626790.1|357980_359408_-	lipase	NA	NA	NA	NA	NA
WP_017474209.1|359458_359803_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_080626791.1|359939_360158_+	helix-turn-helix transcriptional regulator	NA	A0A1Z1DA26	Bacillus_phage	43.1	1.3e-08
WP_080626792.1|361143_361422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885205.1|361411_361786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407310.1|361778_362327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053075443.1|362327_362717_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
WP_080626793.1|363033_363333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626794.1|363743_364082_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_011197905.1|364201_364525_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	69.8	6.8e-33
WP_080626795.1|364499_366281_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.1	1.9e-246
WP_073411216.1|366292_367591_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.2	4.3e-86
WP_069500356.1|367544_368291_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	2.4e-57
WP_017474201.1|368290_369445_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_026080791.1|369485_369983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|369985_370225_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_080626796.1|370229_370565_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	50.5	1.1e-22
WP_080626797.1|370561_370984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197913.1|370980_371325_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	1.0e-15
WP_011197914.1|371333_371915_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073411210.1|371865_372180_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.6	2.1e-23
WP_011197916.1|372230_372566_+	hypothetical protein	NA	H0USX2	Bacillus_phage	40.7	1.2e-11
WP_080626798.1|372808_378109_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	42.6	8.1e-99
WP_069500360.1|378109_378931_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.5	1.5e-65
WP_069500361.1|378940_380467_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.3	8.4e-49
WP_080627101.1|381985_382558_+	hypothetical protein	NA	A0A2I7S7J8	Vibrio_phage	40.4	1.3e-07
WP_080626799.1|384030_384327_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	50.0	1.3e-17
WP_003181188.1|384327_384522_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003181190.1|384525_384789_+|holin	holin	holin	NA	NA	NA	NA
WP_080626800.1|384855_385791_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	65.9	9.6e-96
WP_011197925.1|385812_386070_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	52.9	2.3e-20
WP_016885193.1|386513_386780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885192.1|386800_388315_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016885191.1|388378_388594_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069500365.1|388753_389572_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069500366.1|389644_389974_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.6	2.2e-07
391269:391284	attL	TTAAAAATTCAAGAGG	NA	NA	NA	NA
WP_003179971.1|392778_392988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179974.1|394190_394406_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|394399_394750_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|394808_395147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|395172_396897_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_100224395.1|397171_397459_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.8	6.4e-19
WP_009329006.1|397689_398130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583540.1|403489_404815_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|405061_405280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|405667_406432_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017474999.1|406837_408613_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|408815_409583_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_087634947.1|409579_410593_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|410589_411426_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|411439_412570_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071583541.1|412600_413059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|413055_413262_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|413811_414024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|414131_414878_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_080626803.1|414843_416313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699457.1|416302_417211_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|417207_417492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|417599_417869_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|418193_418823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583959.1|418903_420052_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|420115_421021_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085959525.1|421055_421538_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003180021.1|421629_422244_+	YhbD family protein	NA	NA	NA	NA	NA
WP_003180023.1|422258_422969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180026.1|422983_423685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328994.1|424085_425981_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.6	3.3e-103
WP_080626804.1|427062_428655_-	hypothetical protein	NA	I3VYZ3	Thermoanaerobacterium_phage	24.5	2.6e-32
WP_150194401.1|428825_429014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626805.1|429135_430020_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	40.1	2.7e-55
430440:430455	attR	TTAAAAATTCAAGAGG	NA	NA	NA	NA
>prophage 5
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	446353	504397	4405338	holin,tail	Bacillus_phage(86.0%)	75	NA	NA
WP_080626823.1|446353_446593_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	58.9	1.7e-17
WP_080626824.1|446614_446803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626825.1|446906_447119_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_080626826.1|447115_447436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634952.1|447425_447785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087634953.1|447880_448555_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	49.3	2.8e-41
WP_087634954.1|448523_448730_+	hypothetical protein	NA	O64134	Bacillus_phage	57.4	4.3e-09
WP_080626827.1|448729_450484_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	43.4	4.5e-123
WP_155761929.1|450702_450855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626829.1|450906_451134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626830.1|451359_452106_+	DUF3603 family protein	NA	A0A109ZRE1	Bacillus_phage	34.9	3.5e-32
WP_087634999.1|452128_452521_+	dCMP deaminase family protein	NA	F8WPT6	Bacillus_phage	72.8	2.8e-49
WP_080626832.1|452414_452774_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	39.1	9.3e-07
WP_071583448.1|452897_453131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626833.1|453133_453331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583450.1|453516_453918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626834.1|453914_454226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626835.1|454325_455108_+	hypothetical protein	NA	A0A0E3T6A0	Bacillus_phage	35.3	2.8e-32
WP_080626836.1|455117_455606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626837.1|455580_456282_+	hypothetical protein	NA	A0A0E3X9H9	Bacillus_phage	38.6	1.5e-37
WP_080626838.1|456295_456793_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	51.2	1.3e-30
WP_080626839.1|456891_457536_+	hypothetical protein	NA	A0A1D6X8E5	Bacillus_phage	39.3	5.2e-08
WP_080626840.1|457664_457943_+	hypothetical protein	NA	U5PY47	Bacillus_phage	50.0	8.7e-13
WP_080626841.1|457942_458500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626842.1|458522_459296_+	hypothetical protein	NA	U5Q178	Bacillus_phage	50.2	3.4e-70
WP_080626843.1|459357_459660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583460.1|460138_460816_+	hypothetical protein	NA	A0A1D6X837	Bacillus_phage	33.3	1.5e-21
WP_080626844.1|460815_462402_+	hypothetical protein	NA	S5MLT2	Bacillus_phage	36.7	1.2e-93
WP_080626845.1|462494_463853_+	hypothetical protein	NA	A0A0E3JT25	Bacillus_phage	58.9	1.4e-148
WP_080626846.1|463869_464919_+	hypothetical protein	NA	A0A1D6X836	Bacillus_phage	41.6	1.2e-59
WP_071583464.1|464939_465359_+	hypothetical protein	NA	U5PXS9	Bacillus_phage	56.9	1.6e-29
WP_080626847.1|465388_466318_+	hypothetical protein	NA	A0A0E3X9I2	Bacillus_phage	58.7	3.6e-95
WP_071583466.1|466390_466789_+	hypothetical protein	NA	A0A0E3T6A9	Bacillus_phage	40.5	1.3e-14
WP_142396724.1|466851_467154_+	hypothetical protein	NA	A0A0E3T7L9	Bacillus_phage	58.2	2.2e-25
WP_155761930.1|467153_467315_+	hypothetical protein	NA	U5Q1C8	Bacillus_phage	58.7	1.0e-05
WP_080626849.1|467718_468111_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_080626850.1|468178_468898_+	hypothetical protein	NA	A0A1D6X862	Bacillus_phage	36.0	2.3e-28
WP_080626851.1|468916_469387_+	hypothetical protein	NA	U5Q195	Bacillus_phage	59.5	4.0e-42
WP_080626852.1|469649_470102_+	hypothetical protein	NA	U5PWN1	Bacillus_phage	42.6	1.2e-27
WP_080626853.1|470094_470592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626854.1|470597_471062_+	hypothetical protein	NA	S5MLT8	Bacillus_phage	41.1	2.9e-29
WP_080626855.1|471074_477035_+|tail	phage tail tape measure protein	tail	A0A0E3M0Y3	Bacillus_phage	56.4	5.7e-08
WP_080626856.1|477034_477397_+	hypothetical protein	NA	A0A0E3T7M6	Bacillus_phage	55.4	2.6e-33
WP_080626857.1|477413_481523_+	hypothetical protein	NA	A0A1D6X857	Bacillus_phage	45.4	9.3e-143
WP_080626858.1|481542_483945_+	hypothetical protein	NA	R4JGT1	Bacillus_phage	47.1	1.1e-159
WP_080626859.1|483965_484505_+	hypothetical protein	NA	A0A1L2JY73	Aeribacillus_phage	42.0	2.8e-07
WP_080626860.1|484526_484991_+	hypothetical protein	NA	A0A0H3UZD0	Geobacillus_virus	47.0	1.0e-29
WP_080626861.1|485090_485393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626862.1|485420_486500_+	LysM peptidoglycan-binding domain-containing protein	NA	O64040	Bacillus_phage	68.7	2.9e-19
WP_080626863.1|486512_486797_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	42.2	6.6e-08
WP_080626864.1|486871_487237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626865.1|487295_487814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626866.1|487824_488376_-	hypothetical protein	NA	U5Q1A7	Bacillus_phage	41.1	6.2e-26
WP_080626867.1|488372_489221_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	52.1	3.3e-79
WP_080626868.1|489207_489723_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.3	7.0e-24
WP_080626869.1|489733_490465_-	PD-(D/E)XK nuclease family protein	NA	S5M851	Bacillus_phage	40.4	7.1e-54
WP_080626870.1|490464_491091_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	37.8	9.1e-26
WP_071583484.1|491118_491301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626871.1|491316_492327_-	toprim domain-containing protein	NA	S5M855	Bacillus_phage	48.7	2.8e-85
WP_071583486.1|492329_492509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626872.1|492564_493905_-	hypothetical protein	NA	A0A1D6X893	Bacillus_phage	53.1	5.9e-123
WP_080626873.1|493897_494437_-	hypothetical protein	NA	A0A0E3X9J6	Bacillus_phage	45.6	2.5e-32
WP_080626874.1|494466_495189_-	sigma-70 family RNA polymerase sigma factor	NA	U5Q0I1	Bacillus_phage	38.9	7.5e-32
WP_080626875.1|495227_495440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626876.1|495432_495819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626877.1|495891_496176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626878.1|496240_496684_-	hypothetical protein	NA	S5MLV8	Bacillus_phage	49.0	9.0e-28
WP_080626879.1|496742_497411_-	AAA family ATPase	NA	F8WPX9	Bacillus_phage	47.1	3.5e-39
WP_080626880.1|497441_497987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626881.1|498010_498550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626882.1|498579_499581_-	AAA family ATPase	NA	A0A0E3T6D1	Bacillus_phage	47.5	9.7e-70
WP_080626883.1|499570_499828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626884.1|499891_500842_-	hypothetical protein	NA	A0A1D6X8A5	Bacillus_phage	43.4	1.9e-51
WP_080626885.1|500950_501991_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3JQ77	Bacillus_phage	67.4	9.9e-134
WP_080626886.1|502066_504397_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0E3M3E9	Bacillus_phage	57.6	3.2e-257
>prophage 6
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	828616	895880	4405338	terminase,plate,holin,coat,portal,tail	Bacillus_phage(27.78%)	81	NA	NA
WP_009328811.1|828616_829066_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|829216_829705_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|829836_830349_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|830419_830818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|830866_831253_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|831399_831756_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|832042_832252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|832331_832463_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|832592_832850_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|832888_835171_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|835292_835550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|835589_836177_-	DedA family protein	NA	NA	NA	NA	NA
WP_009328799.1|837254_838145_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|838167_838563_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|838727_839147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|839156_839666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|839730_840453_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|840443_840776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|840969_841458_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|841538_842486_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|842794_843919_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_011197788.1|843908_845084_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|845129_846320_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|846493_847063_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|847052_847337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|847512_848886_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_080626900.1|849190_850177_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|850778_850862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|851300_851480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|851513_852092_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|852178_852466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|852673_853564_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|853884_855714_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_080626901.1|855741_857460_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|857517_858405_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|858496_859369_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|859416_859794_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|859837_860386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|860838_861573_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|861628_863053_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_075223542.1|863068_863647_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075223543.1|863659_863995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|864023_864437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|864811_865294_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|867564_868212_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|868225_868882_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|869070_869424_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|869596_869857_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|869846_870143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624211.1|870143_870974_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_035317447.1|870873_871674_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	6.1e-59
WP_003180798.1|871944_872286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|872282_872486_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|872606_873110_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|873252_874053_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|874049_875348_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|875351_876866_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|876873_877722_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|877739_878675_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|878762_879143_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|879139_879496_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_080626902.1|879492_879981_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.2	3.8e-35
WP_003180824.1|879993_880434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|880434_880659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|880658_882005_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|882006_882450_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|882632_883082_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|883123_883261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080626903.1|883264_887047_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|887039_887696_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|887752_888733_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|888729_889038_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|889056_889482_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|889474_890518_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|890504_891425_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|891438_891825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|891840_893046_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|893083_894115_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|894217_894487_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|894501_894765_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|894815_895880_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
>prophage 7
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	1896796	1908976	4405338		Staphylococcus_phage(55.56%)	15	NA	NA
WP_080626939.1|1896796_1897390_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.0e-14
WP_009327962.1|1897379_1898135_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|1898317_1898413_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|1898533_1899055_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|1899065_1899440_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|1899541_1900006_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|1900040_1901237_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|1901258_1901906_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183120.1|1901917_1903006_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	6.6e-64
WP_003183123.1|1903366_1903711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183125.1|1903973_1906160_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|1906286_1906724_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|1906882_1907188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|1907177_1908308_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_080626940.1|1908538_1908976_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	43.3	3.2e-17
>prophage 8
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	2300487	2393935	4405338	protease,head,plate,terminase,tRNA,holin,coat,tail,capsid	Bacillus_phage(78.0%)	101	NA	NA
WP_003183980.1|2300487_2301633_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	5.5e-85
WP_069500660.1|2301661_2302690_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2302730_2302931_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2302923_2303928_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_003183986.1|2303937_2304543_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2304665_2305187_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003183988.1|2305429_2306080_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2306357_2306537_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2306632_2307097_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003183992.1|2307157_2307868_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2308281_2308461_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_003183994.1|2308552_2308879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2309020_2309743_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080626953.1|2311415_2312051_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184005.1|2312223_2313276_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003184007.1|2313391_2314501_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2314522_2315362_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2315342_2316917_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|2317017_2318196_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2318164_2318707_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2318750_2319620_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2319628_2320072_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_080626954.1|2320185_2321472_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2321504_2322083_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2322308_2322590_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2322602_2322944_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2322956_2323265_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2323421_2324288_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|2324280_2325072_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2325217_2325646_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_061578553.1|2325645_2325966_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2326010_2326817_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2326819_2327500_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2327554_2328073_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2328069_2328978_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2329008_2330019_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_080626955.1|2330618_2331203_+	hypothetical protein	NA	Q9ZXD6	Bacillus_phage	26.1	6.3e-05
WP_080626956.1|2331301_2331670_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_035338316.1|2331892_2333014_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_025807654.1|2333266_2334883_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|2334895_2335312_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_080626957.1|2335342_2336296_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	1.2e-61
WP_069500507.1|2336343_2336607_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_069500916.1|2336622_2336892_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_039072971.1|2336955_2337138_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_069500506.1|2337134_2337458_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	5.8e-08
WP_080626958.1|2337470_2338910_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	40.5	9.4e-58
WP_080626959.1|2338948_2340502_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	77.2	7.3e-234
WP_080626960.1|2340538_2342248_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.1	3.6e-218
WP_017475032.1|2342260_2343097_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
WP_080626961.1|2343096_2346987_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	65.1	0.0e+00
WP_009329202.1|2347184_2347520_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_080626962.1|2347580_2348189_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	1.4e-55
WP_009329204.1|2348188_2348569_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	3.0e-32
WP_009329205.1|2348565_2348949_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	70.9	4.1e-45
WP_009329206.1|2348941_2349316_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	63.9	1.2e-36
WP_080626963.1|2349245_2349596_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	59.1	2.8e-32
WP_009329208.1|2349611_2350061_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|2350086_2351403_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_025807960.1|2351443_2352073_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330378.1|2353493_2355203_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_017475039.1|2355821_2356148_-	hypothetical protein	NA	Q9T203	Bacillus_phage	56.5	3.7e-31
WP_003185368.1|2357511_2357736_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|2358485_2358866_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|2358978_2359356_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_009329249.1|2359371_2359887_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_017695850.1|2359890_2360061_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_017474566.1|2360057_2360597_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_080626964.1|2360593_2361031_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	1.5e-62
WP_080626965.1|2361008_2361380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626966.1|2361601_2364034_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_017474381.1|2364094_2364535_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.0	2.9e-71
WP_017474382.1|2364553_2364907_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	56.6	3.9e-26
WP_080626967.1|2364896_2365832_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.0	3.2e-160
WP_057957666.1|2365835_2366393_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_069500681.1|2366586_2366856_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	55.8	9.0e-23
WP_048355993.1|2366852_2367044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080626968.1|2367194_2367434_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	3.3e-16
WP_048355991.1|2367683_2368127_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.9	4.9e-42
WP_048355990.1|2368158_2368638_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.9	1.3e-43
WP_080626969.1|2368677_2370066_+	recombinase family protein	NA	Q9T200	Bacillus_phage	60.5	6.9e-159
WP_009329283.1|2370078_2370465_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003184048.1|2370519_2371092_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|2371245_2372277_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|2372480_2373230_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|2373372_2374677_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|2374752_2377395_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|2377856_2378048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|2378067_2379090_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|2379117_2380575_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|2380723_2382019_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|2382044_2383019_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_080626970.1|2383022_2383814_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009329302.1|2383803_2384745_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011198166.1|2384784_2385615_-	cytochrome c	NA	NA	NA	NA	NA
WP_009329306.1|2385620_2386982_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2387170_2387656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2387704_2388292_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_080626971.1|2388288_2390613_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	7.7e-187
WP_080626972.1|2390831_2392487_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2392669_2393935_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 9
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	2736240	2775789	4405338	protease,terminase,holin,coat,portal,head,capsid,integrase,tail,transposase	Bacillus_phage(63.89%)	49	2733941:2734000	2775882:2775957
2733941:2734000	attL	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAA	NA	NA	NA	NA
WP_087635001.1|2736240_2736675_+	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	47.9	3.4e-27
WP_080627000.1|2736671_2737076_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_080627001.1|2737077_2737275_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	65.0	3.9e-15
WP_080627002.1|2737571_2739071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080627003.1|2739085_2739484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627004.1|2739529_2740609_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	53.0	5.2e-45
WP_080627005.1|2740660_2740924_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.3e-31
WP_071583811.1|2740939_2741209_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.3e-25
WP_080627006.1|2741271_2741454_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_080627007.1|2741450_2741774_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_080627106.1|2741786_2743133_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	42.3	1.9e-65
WP_080627008.1|2743149_2745795_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	1.4e-293
WP_080627009.1|2745831_2747544_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.6	1.2e-216
WP_080627010.1|2747556_2748393_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.1	1.3e-107
WP_080627011.1|2748392_2752862_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-70
WP_043054229.1|2753070_2753436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054228.1|2753489_2754107_-|tail	tail protein	tail	NA	NA	NA	NA
WP_043054227.1|2754121_2754505_-	phage protein	NA	NA	NA	NA	NA
WP_043054226.1|2754501_2754900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627012.1|2754899_2755208_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	9.7e-13
WP_003185351.1|2755197_2755500_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_065643430.1|2755520_2755946_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.0	2.9e-15
WP_075646713.1|2755968_2757249_-|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.8	2.6e-75
WP_080627013.1|2757318_2758050_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	8.9e-57
WP_071583905.1|2757994_2759305_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.3	3.2e-105
WP_035316082.1|2759305_2759497_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_071583906.1|2759509_2761219_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	63.8	2.1e-210
WP_071583907.1|2761215_2761731_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	6.3e-33
WP_080627014.1|2761961_2762336_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.8e-29
WP_080627015.1|2762362_2762671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|2762885_2763110_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003185369.1|2763848_2764229_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_080627017.1|2764603_2765428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627107.1|2765511_2765706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627018.1|2765829_2766345_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_003185375.1|2766347_2766518_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
WP_080627019.1|2766514_2767054_-	nuclease	NA	Q9ZXC2	Bacillus_phage	91.1	5.9e-90
WP_080627020.1|2767050_2767488_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	4.2e-62
WP_080627021.1|2767756_2770195_-	DNA primase	NA	D6R422	Bacillus_phage	80.3	0.0e+00
WP_061578359.1|2770255_2770696_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
WP_080627022.1|2770695_2771628_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.4	1.2e-154
WP_080627023.1|2771631_2772189_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.6e-69
WP_080627024.1|2772281_2772524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080627025.1|2772617_2772884_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.2	9.5e-17
WP_017474831.1|2773007_2773277_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	50.0	8.4e-21
WP_026587143.1|2773282_2773468_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_080627026.1|2773736_2774165_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	65.2	1.2e-45
WP_080627027.1|2774173_2774596_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	61.6	2.0e-45
WP_080627028.1|2774640_2775789_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	34.6	3.6e-52
2775882:2775957	attR	CAAACGCTTCTCAAGCTCTGCTTTTTTCTCTTCGAAGCCAGGCTTGCCGAGAAGGGCGAACATGTTGACTTTGTAT	NA	NA	NA	NA
>prophage 10
NZ_CP014794	Bacillus licheniformis strain SCCB 37, complete genome	4405338	4376294	4404794	4405338	protease,terminase,tRNA,portal,head,integrase	Bacillus_phage(40.91%)	42	4384886:4384901	4397952:4397967
WP_003179225.1|4376294_4376771_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003179227.1|4376751_4377441_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003179229.1|4377453_4377912_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003179232.1|4377901_4378927_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	2.1e-67
WP_080624180.1|4379166_4381092_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.3	4.2e-61
WP_003179234.1|4381238_4381745_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003179237.1|4381748_4382396_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003179239.1|4382438_4382618_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_011201569.1|4382624_4383401_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.7	5.3e-15
WP_003179243.1|4383446_4383641_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003179245.1|4383637_4384372_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|4384597_4384882_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
4384886:4384901	attL	ATAAATAAAAACGAGA	NA	NA	NA	NA
WP_003179250.1|4384926_4386561_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.1e-159
WP_025807787.1|4386642_4387860_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.9	8.0e-143
WP_025807788.1|4387873_4388506_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	62.4	1.9e-71
WP_025807791.1|4388670_4388919_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	65.8	1.1e-19
WP_025807793.1|4388945_4389140_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025807794.1|4389152_4389854_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	67.8	4.4e-85
WP_025807795.1|4389866_4390265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807797.1|4390363_4390708_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	55.8	6.6e-10
WP_025807799.1|4390712_4390922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330098.1|4390911_4391124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025807801.1|4391178_4391397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017475008.1|4391498_4391717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807804.1|4391709_4392588_+	replication protein	NA	V9QKF6	Oenococcus_phage	44.6	4.7e-52
WP_025807806.1|4392571_4393405_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.0	5.4e-34
WP_025807808.1|4393728_4394277_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	5.2e-09
WP_017474694.1|4394381_4394531_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_017474644.1|4394601_4394802_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.9	4.2e-09
WP_017474645.1|4394837_4395071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474597.1|4395584_4395833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808209.1|4396130_4396571_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.1	2.3e-36
WP_080627099.1|4396570_4397113_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	3.3e-56
WP_025808178.1|4397342_4398146_+	hypothetical protein	NA	NA	NA	NA	NA
4397952:4397967	attR	ATAAATAAAAACGAGA	NA	NA	NA	NA
WP_048407332.1|4398486_4398708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080869.1|4398943_4399585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080627100.1|4399744_4400119_+	HNH endonuclease	NA	Q38456	Bacillus_phage	81.5	4.4e-60
WP_017475039.1|4400087_4400414_+	hypothetical protein	NA	Q9T203	Bacillus_phage	56.5	3.7e-31
WP_009330377.1|4400500_4401034_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_009330378.1|4401033_4402743_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_009330392.1|4402930_4404175_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	1.4e-206
WP_025807960.1|4404164_4404794_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
