The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020464	Lactobacillus rhamnosus strain Pen chromosome, complete genome	2884966	683076	765540	2884966	bacteriocin,protease,transposase	Bacillus_phage(18.75%)	79	NA	NA
WP_005714569.1|683076_683418_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005692222.1|683708_684041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711134.1|684213_685641_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	3.0e-32
WP_005711133.1|685695_686136_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005711130.1|686456_687263_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005711129.1|687312_687498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711123.1|687889_688075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711122.1|688134_688320_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005714566.1|688787_688946_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_005714564.1|689123_689423_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005711118.1|689672_689918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711112.1|690892_691153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711108.1|692052_693348_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005714562.1|693527_693683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711104.1|693977_696170_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	3.6e-37
WP_005711102.1|696182_697562_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_005714559.1|697680_698034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711099.1|698213_699569_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005714157.1|699663_700200_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_123811849.1|700151_701045_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.3e-37
WP_005709782.1|701344_702427_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005709780.1|702552_702843_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005709779.1|702870_703647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005709777.1|703690_704476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687855.1|704472_704805_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005714556.1|704935_705583_-	helix-turn-helix transcriptional regulator	NA	B5LPU3	Bacillus_virus	42.3	3.4e-07
WP_005709771.1|705874_706930_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005709769.1|707122_708322_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_005709767.1|708326_709115_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005687861.1|709291_709849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179214911.1|710123_713075_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005714553.1|713076_714432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709760.1|714422_715976_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_005709757.1|715982_716807_+	class C sortase	NA	NA	NA	NA	NA
WP_005709755.1|717331_718057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709753.1|718053_718722_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.2e-33
WP_005714551.1|718732_719902_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005714549.1|720922_721465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709747.1|722040_722226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107711099.1|722271_722421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709745.1|722674_723511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	9.6e-47
WP_005709743.1|723591_724848_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	7.8e-109
WP_005714547.1|724919_726152_-	MFS transporter	NA	NA	NA	NA	NA
WP_005714546.1|726842_727097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|727296_727503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005686089.1|727692_727950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714545.1|728149_729328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005709732.1|729455_730673_+	MFS transporter	NA	NA	NA	NA	NA
WP_005709730.1|730665_731409_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005692303.1|731436_732666_+	MFS transporter	NA	NA	NA	NA	NA
WP_005709728.1|732662_733853_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_005686092.1|733980_734190_+	CsbD family protein	NA	NA	NA	NA	NA
WP_032951926.1|734352_734517_+	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_104216446.1|734488_735469_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005686095.1|735714_735999_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_005714543.1|736017_737136_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005692313.1|737293_737965_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_072137620.1|738136_738724_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_081155014.1|739023_741654_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.5	2.8e-84
WP_005709719.1|741873_743928_-	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	1.6e-63
WP_005714541.1|744079_744955_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.4e-11
WP_005709716.1|744968_746165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005709714.1|746161_747262_-	ABC transporter	NA	NA	NA	NA	NA
WP_081155016.1|747478_748825_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.2	8.1e-72
WP_005709712.1|748969_750289_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	4.0e-63
WP_005714520.1|750463_751645_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	49.1	3.3e-101
WP_005713617.1|751679_752276_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	60.6	2.4e-68
WP_005714535.1|752648_752939_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005713603.1|753583_754123_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	1.5e-37
WP_005686111.1|754142_755507_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686113.1|755527_756643_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_005692335.1|756734_757631_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005692336.1|757772_758678_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.5	1.7e-33
WP_005692337.1|758679_759438_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005714532.1|759721_761038_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005713599.1|761536_763165_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005686116.1|763296_763683_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005713598.1|763679_764696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005713596.1|764709_765540_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP020464	Lactobacillus rhamnosus strain Pen chromosome, complete genome	2884966	2199771	2278156	2884966	transposase,protease,integrase,capsid,tail,tRNA,holin,portal,terminase,head	Lactobacillus_phage(90.74%)	91	2235557:2235616	2298517:2298592
WP_005687266.1|2199771_2200281_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_005687265.1|2200867_2201710_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005713283.1|2201775_2202723_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_005713651.1|2202906_2203896_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_003564153.1|2204010_2204280_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005688651.1|2204329_2204704_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_005713281.1|2204947_2205988_+	lactonase family protein	NA	NA	NA	NA	NA
WP_005713280.1|2206192_2207011_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005713279.1|2207030_2207669_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005713278.1|2207884_2208943_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005713277.1|2209086_2209989_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005687253.1|2209988_2210786_-	NAD kinase	NA	NA	NA	NA	NA
WP_005713649.1|2210787_2211465_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005713275.1|2211631_2212225_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_005687248.1|2212294_2212930_+	DsbA family protein	NA	NA	NA	NA	NA
WP_005713647.1|2213170_2214238_-	competence protein	NA	NA	NA	NA	NA
WP_081155084.1|2214404_2215748_-	PFL family protein	NA	NA	NA	NA	NA
WP_005687240.1|2215898_2216165_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_005713267.1|2216379_2217708_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005713644.1|2217834_2219043_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_005688627.1|2219149_2219623_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_005713643.1|2220018_2220519_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005713261.1|2220515_2221346_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005688621.1|2221478_2221694_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_005713259.1|2221779_2222490_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005713257.1|2222494_2224138_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005713254.1|2224726_2227138_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
WP_020751877.1|2227558_2228230_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005713248.1|2228294_2229020_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_005687221.1|2229016_2230495_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_081155085.1|2230716_2231187_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005713241.1|2231363_2232857_-	MFS transporter	NA	NA	NA	NA	NA
WP_005713641.1|2233387_2234572_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
WP_005713236.1|2234750_2235404_+	hypothetical protein	NA	NA	NA	NA	NA
2235557:2235616	attL	ATGGAGGATACAGGGCTCGAACCTGTGACCCTCTGCTTGTAAGGCAGACGCTCTCCCAAC	NA	NA	NA	NA
WP_005709578.1|2235819_2237277_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005711084.1|2237898_2238123_-	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	98.6	6.1e-33
WP_005711086.1|2238167_2239466_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	86.8	1.0e-212
WP_005714728.1|2239476_2239890_-|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	94.8	2.4e-43
WP_003581984.1|2239904_2240180_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_005688592.1|2240235_2240379_-	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	97.9	3.5e-18
WP_005711092.1|2240375_2240705_-	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	99.1	4.2e-54
WP_044434646.1|2240720_2243675_-|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	77.5	0.0e+00
WP_044434643.1|2243675_2245592_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	63.7	4.2e-223
WP_005712773.1|2245592_2250455_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	93.0	0.0e+00
WP_003661382.1|2250577_2250991_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_005712772.1|2251089_2251707_-|tail	phage major tail protein, phi13 family	tail	U5U3Z7	Lactobacillus_phage	97.6	2.0e-110
WP_005712770.1|2251740_2252127_-	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	96.1	1.6e-68
WP_005712768.1|2252126_2252513_-	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
WP_005712766.1|2252512_2252842_-|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	97.2	1.5e-56
WP_003564855.1|2252831_2253191_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.6e-59
WP_005712764.1|2253201_2253441_-	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	97.5	1.6e-31
WP_005712762.1|2253458_2254661_-|capsid	phage major capsid protein	capsid	A0A2D1GPG3	Lactobacillus_phage	94.2	5.4e-208
WP_005714756.1|2254702_2255332_-|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	94.3	1.0e-109
WP_005712758.1|2255285_2256539_-|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	91.8	5.2e-222
WP_003661399.1|2256544_2256736_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_081155087.1|2256747_2258460_-|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	97.2	0.0e+00
WP_005712753.1|2258481_2258937_-|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
WP_179214909.1|2259137_2259890_-	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	98.4	2.3e-140
WP_005712746.1|2260134_2260458_-	hypothetical protein	NA	A0A0P0IJY9	Lactobacillus_phage	87.5	3.9e-49
WP_005712745.1|2260461_2260992_-	HNH endonuclease	NA	U5U4N5	Lactobacillus_phage	96.6	5.8e-98
WP_005712743.1|2260978_2262196_-	GcrA cell cycle regulator	NA	A8YQN3	Lactobacillus_phage	97.5	2.5e-237
WP_005712739.1|2263075_2264149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714759.1|2264542_2264986_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	95.2	4.0e-76
WP_005712735.1|2265055_2265277_-	hypothetical protein	NA	A0A0P0IXA5	Lactobacillus_phage	51.4	4.6e-09
WP_005712733.1|2265404_2265614_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	95.7	1.6e-30
WP_005712732.1|2265610_2265991_-	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	71.1	1.5e-47
WP_005712731.1|2265980_2266157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005712730.1|2266146_2266689_-	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	46.2	3.1e-30
WP_005712729.1|2266685_2266868_-	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	91.7	2.9e-25
WP_005714760.1|2266864_2267566_-	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	94.8	1.4e-123
WP_005714761.1|2267577_2267913_-	hypothetical protein	NA	U5U3Z2	Lactobacillus_phage	97.3	2.2e-34
WP_003607027.1|2267926_2268292_-	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
WP_005712725.1|2268288_2268543_-	hypothetical protein	NA	U5U728	Lactobacillus_phage	91.7	3.3e-35
WP_005712723.1|2268529_2268874_-	hypothetical protein	NA	B4XYS8	Lactobacillus_phage	91.6	3.6e-48
WP_005712721.1|2268870_2269653_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	92.3	7.7e-131
WP_005712719.1|2269639_2270437_-	hypothetical protein	NA	Q6J1V6	Lactobacillus_phage	70.2	1.2e-91
WP_005712717.1|2270451_2271009_-	DUF669 domain-containing protein	NA	B4XYS5	Lactobacillus_phage	94.1	3.8e-100
WP_005712715.1|2271012_2271720_-	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	97.0	5.9e-130
WP_005712713.1|2271720_2272206_-	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	97.5	2.2e-80
WP_005712711.1|2272224_2272428_-	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	89.6	2.7e-27
WP_005712709.1|2272432_2272585_-	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	100.0	2.4e-20
WP_005712707.1|2272669_2273026_-	DUF771 domain-containing protein	NA	B4XYS0	Lactobacillus_phage	100.0	1.1e-63
WP_003564805.1|2273100_2273301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712705.1|2273297_2273447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714763.1|2273443_2273695_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	98.6	4.2e-30
WP_005712701.1|2273852_2274626_+	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	93.8	4.0e-132
WP_005712700.1|2274697_2274916_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_005714764.1|2275006_2276188_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	25.5	2.0e-18
WP_005714766.1|2276297_2276519_-	hypothetical protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
WP_005712694.1|2276657_2276921_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	41.3	1.9e-09
WP_005714768.1|2277028_2278156_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	9.8e-212
2298517:2298592	attR	ATGGAGGATACAGGGCTCGAACCTGTGACCCTCTGCTTGTAAGGCAGACGCTCTCCCAACTGAGCTAATCCTCCAT	NA	NA	NA	NA
