The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015027	Sporosarcina sp. P33 chromosome, complete genome	3235441	255892	266902	3235441	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_081244711.1|255892_257662_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	29.0	7.0e-23
WP_081242057.1|257783_259046_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	22.2	3.9e-15
WP_081242058.1|259461_259908_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_081242059.1|259926_262125_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.8	1.3e-10
WP_081242060.1|262272_262785_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.3	5.0e-30
WP_081242061.1|262775_264824_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1G5SBU4	Enterococcus_phage	23.2	1.2e-10
WP_081242062.1|265012_266902_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.4	2.8e-33
>prophage 2
NZ_CP015027	Sporosarcina sp. P33 chromosome, complete genome	3235441	816448	932239	3235441	plate,terminase,transposase,portal,tail,holin,protease,integrase,capsid	Bacillus_phage(29.41%)	113	819192:819213	933387:933402
WP_099662801.1|816448_817614_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	6.2e-36
WP_155961302.1|818030_818195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081242547.1|818280_818922_-	hypothetical protein	NA	NA	NA	NA	NA
819192:819213	attL	TTGATCTGCGCTGCAGCCGGAC	NA	NA	NA	NA
WP_081242549.1|820336_821179_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	33.3	8.2e-30
819192:819213	attL	TTGATCTGCGCTGCAGCCGGAC	NA	NA	NA	NA
WP_081242550.1|821331_821514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242551.1|821661_822075_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_081242552.1|822478_822907_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155961303.1|822965_823586_-	endonuclease V	NA	NA	NA	NA	NA
WP_081242554.1|824170_824911_-	hypothetical protein	NA	NA	NA	NA	NA
823780:823801	attR	TTGATCTGCGCTGCAGCCGGAC	NA	NA	NA	NA
WP_081242555.1|824894_825389_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
823780:823801	attR	TTGATCTGCGCTGCAGCCGGAC	NA	NA	NA	NA
WP_081244743.1|826177_826486_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081242556.1|826501_827695_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_081242557.1|828308_829622_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_081242558.1|829990_830764_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_081242559.1|830890_831553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242560.1|832237_833161_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_081242561.1|833393_833657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242562.1|834093_835164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081242563.1|835720_836998_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081242564.1|837385_838522_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.1	2.2e-25
WP_081242565.1|838514_839168_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081244744.1|839167_840061_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081242566.1|840189_840465_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_081244745.1|840642_841608_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_081242567.1|841671_842760_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_081242568.1|843172_844342_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_081242569.1|844681_845842_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_081242570.1|846106_846958_+	DegV family protein	NA	NA	NA	NA	NA
WP_081242571.1|847084_847399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242572.1|847915_848179_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_081242573.1|848181_849531_+	N-6 DNA methylase	NA	A0A076FHE5	Aureococcus_anophage	34.4	5.2e-10
WP_081242574.1|849536_850625_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.9	2.8e-46
WP_081242575.1|850849_853465_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_081242576.1|853602_855663_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_081242577.1|855959_856721_-	AIM24 family protein	NA	NA	NA	NA	NA
WP_081242578.1|856967_857162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242579.1|857218_858151_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_081242580.1|858147_859347_-	TniQ family protein	NA	NA	NA	NA	NA
WP_081242581.1|859706_860270_-	YdhK family protein	NA	NA	NA	NA	NA
WP_081242582.1|860372_860699_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_081242583.1|860818_861892_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_081242584.1|862012_863515_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_081242585.1|863801_864614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155961304.1|865037_866176_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	65.3	5.4e-101
WP_081242586.1|866255_867227_+	adhesin	NA	NA	NA	NA	NA
WP_081242587.1|867443_867848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155961305.1|867987_869529_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_081242588.1|869762_872180_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.1	6.5e-128
WP_081242589.1|872332_872536_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_081242590.1|872627_872915_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_081244747.1|872934_873345_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_081242591.1|874608_875655_-	hypothetical protein	NA	S5MM68	Bacillus_phage	35.6	7.9e-14
WP_081242592.1|875970_877329_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	51.3	2.8e-120
WP_081242593.1|878319_878595_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_081242563.1|878985_880263_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081242594.1|880411_881089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155961395.1|881355_882762_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_081242595.1|883471_884095_+	nitrite reductase	NA	NA	NA	NA	NA
WP_155961396.1|884523_885084_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_081242597.1|885125_886022_-	copper-binding protein	NA	NA	NA	NA	NA
WP_081242598.1|886225_888289_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	1.4e-78
WP_081242599.1|888443_888827_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_081242600.1|888909_889716_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_081242601.1|889754_890939_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_081242602.1|890938_892588_-	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_081242603.1|892623_893334_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_081242604.1|893369_894104_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_081244749.1|894124_895039_-	sialidase	NA	NA	NA	NA	NA
WP_081242605.1|895053_895731_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.5	1.3e-38
WP_081242606.1|895751_897113_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	4.9e-40
WP_155961306.1|897252_897858_+	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_081242609.1|898134_898707_-	hypothetical protein	NA	A0A288WFY4	Bacillus_phage	38.8	3.4e-27
WP_081242610.1|898850_900047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242611.1|900158_901052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155961307.1|901636_901801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081242612.1|902023_903358_+	cell division protein FtsK	NA	U5PWN3	Bacillus_virus	62.0	1.3e-143
WP_081242613.1|903308_903902_+	hypothetical protein	NA	A0A1S5QTS6	Bacillus_phage	52.6	4.6e-51
WP_081242614.1|903915_904452_+	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	66.7	4.7e-23
WP_081242615.1|904632_905538_-	hypothetical protein	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	42.9	1.1e-43
WP_081242616.1|905537_905831_-|holin	phage holin	holin	A0A142F1N6	Bacillus_phage	49.5	7.8e-20
WP_081242617.1|905844_906252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242618.1|906344_906527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242619.1|906546_906777_-	XkdX family protein	NA	NA	NA	NA	NA
WP_081242620.1|906773_906986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242621.1|906999_909444_-	hypothetical protein	NA	A0A172JII4	Bacillus_phage	42.5	3.7e-54
WP_081244750.1|909448_910477_-	hypothetical protein	NA	H7BWD2	unidentified_phage	50.9	9.9e-94
WP_155961308.1|910752_911121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242623.1|911162_911534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242624.1|911526_911856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242625.1|911855_912731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242626.1|912723_913836_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.6	1.5e-84
WP_081242627.1|913832_914162_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	50.5	1.5e-16
WP_081242628.1|914158_914548_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_081242629.1|914560_915052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242630.1|915048_916071_-	hypothetical protein	NA	A0A0C5AJ59	Bacteriophage	40.2	6.2e-64
WP_081242631.1|916055_916262_-	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	43.1	2.3e-10
WP_081242632.1|916258_919774_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	62.2	1.4e-94
WP_081242633.1|919922_920312_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_081242634.1|920313_920835_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	45.7	2.4e-40
WP_081242635.1|920853_922275_-|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.4	3.9e-141
WP_081242636.1|922277_922646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242637.1|922635_923136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242638.1|923132_923729_-	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	35.4	3.4e-22
WP_081242639.1|923725_924058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242640.1|924054_924453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081244751.1|924466_925489_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	37.8	2.5e-65
WP_081242641.1|925516_925876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242642.1|925872_927027_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	52.4	9.5e-53
WP_081242643.1|927023_928595_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	54.8	1.0e-158
WP_081244753.1|928608_928839_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	47.1	3.0e-11
WP_081244752.1|928847_930647_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	54.7	3.3e-185
WP_081242644.1|930603_931158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242645.1|931669_932239_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	48.9	6.5e-39
933387:933402	attR	ATAAAAAACAGGCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP015027	Sporosarcina sp. P33 chromosome, complete genome	3235441	935408	947432	3235441	integrase	Bacillus_phage(20.0%)	18	931050:931064	946136:946150
931050:931064	attL	CTTTTTCATCCACCA	NA	NA	NA	NA
WP_081242654.1|935408_935969_-	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	55.4	1.0e-44
WP_081242655.1|936123_936969_-	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_081242656.1|936991_937456_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	74.1	5.2e-42
WP_081242657.1|937597_937822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155961309.1|937836_938007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242658.1|938019_938886_-	AAA family ATPase	NA	U5PWH5	Bacillus_phage	41.2	2.5e-50
WP_081242659.1|938809_939652_-	replication protein	NA	V5UQV4	Oenococcus_phage	40.6	2.6e-44
WP_081242660.1|939761_940040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242661.1|940040_940322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242662.1|940430_940763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242663.1|940759_941506_-	hypothetical protein	NA	A0A1W6JPM7	Staphylococcus_phage	42.6	1.8e-41
WP_081242664.1|941502_941703_-	helix-turn-helix domain-containing protein	NA	A0A0S2GLE9	Bacillus_phage	55.0	1.0e-10
WP_081242665.1|941660_941930_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081242666.1|942075_942480_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	58.4	1.7e-17
WP_081242667.1|942604_942829_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081242668.1|942990_944061_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	52.3	1.8e-90
WP_081242669.1|944561_945029_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	62.5	2.5e-44
WP_081242670.1|945074_947432_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.6	3.5e-86
946136:946150	attR	CTTTTTCATCCACCA	NA	NA	NA	NA
