The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	71076	124924	2248099	transposase,protease,tRNA	Bacillus_phage(55.56%)	56	NA	NA
WP_015081863.1|71076_71967_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675148.1|72170_72638_+	DUF3013 domain-containing protein	NA	NA	NA	NA	NA
WP_011675149.1|72667_74221_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.9	1.2e-45
WP_015081864.1|74295_74580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081865.1|74613_75354_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015081866.1|75340_75829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675153.1|75841_76795_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_015081867.1|76914_77667_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_015081868.1|77696_78653_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011675156.1|78853_81076_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	28.3	2.2e-13
WP_011675157.1|82281_82737_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_011675159.1|83740_84364_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_011675160.1|84497_85895_+	amino acid permease	NA	NA	NA	NA	NA
WP_015081870.1|86064_86706_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011675162.1|86736_87246_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041931726.1|87412_88057_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_015081872.1|88230_90828_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_015081873.1|90957_91995_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	36.1	4.1e-47
WP_011834224.1|92243_92510_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_011675166.1|92512_94240_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_011675167.1|94414_94723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675168.1|94812_95112_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011675169.1|95216_95504_+	serine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_015081874.1|95783_96719_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011675171.1|96859_97318_+	hypothetical protein	NA	A0A1P8BMN5	Lactococcus_phage	63.4	4.1e-15
WP_014571854.1|97486_98269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080513934.1|98421_98775_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_015081875.1|98897_100061_+	MFS transporter	NA	NA	NA	NA	NA
WP_003137511.1|100443_100704_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_080562003.1|100715_101555_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	1.6e-49
WP_041931727.1|101999_102368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082454.1|103648_104407_+|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	99.6	4.5e-136
WP_081172352.1|104502_105594_+	permease	NA	NA	NA	NA	NA
WP_015081876.1|106542_107736_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_015081877.1|107764_109144_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_015081878.1|109160_110357_-	MFS transporter	NA	NA	NA	NA	NA
WP_011675184.1|110549_111125_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015081879.1|111281_111635_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_015081880.1|111631_112441_+	protein translocase component YidC	NA	NA	NA	NA	NA
WP_011834239.1|112528_113443_+	protein jag	NA	NA	NA	NA	NA
WP_003131818.1|113574_113709_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_015081881.1|113885_114797_+	aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011675189.1|114866_115181_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015081882.1|115243_115924_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003131820.1|116218_116485_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_011675192.1|116484_116916_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003131822.1|117016_117340_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_015081883.1|117369_117921_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_015081884.1|118010_118751_-	KR domain-containing protein	NA	NA	NA	NA	NA
WP_011675196.1|118770_119082_-	DUF2316 domain-containing protein	NA	NA	NA	NA	NA
WP_015081885.1|119091_119877_-	KR domain-containing protein	NA	NA	NA	NA	NA
WP_011675198.1|119995_120541_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015081886.1|120606_122550_-	1,4-alpha-glucan-branching protein	NA	NA	NA	NA	NA
WP_014571867.1|122669_122990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003137511.1|123812_124073_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_010905103.1|124084_124924_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	9.3e-50
>prophage 2
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	312804	355048	2248099	tRNA,bacteriocin,integrase,capsid,transposase	Lactococcus_phage(76.0%)	48	312772:312788	339823:339839
312772:312788	attL	AAAAAAATACTGACAGA	NA	NA	NA	NA
WP_011675373.1|312804_313281_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_081172367.1|313903_314227_-	hypothetical protein	NA	Q9AZI1	Lactococcus_phage	86.0	8.5e-44
WP_081172368.1|314327_314657_-	hypothetical protein	NA	Q9AZE0	Lactococcus_phage	97.2	1.7e-52
WP_081172369.1|315740_316979_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	61.1	3.2e-139
WP_081172370.1|317319_318954_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	88.4	8.4e-281
WP_081172371.1|318964_319759_-	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	91.7	2.5e-145
WP_081172372.1|319755_320091_-	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	94.4	2.1e-53
WP_025017252.1|320077_320272_-	hypothetical protein	NA	Q9AZE8	Lactococcus_phage	98.4	8.7e-28
WP_081172373.1|320268_320523_-	hypothetical protein	NA	Q9AZE9	Lactococcus_phage	89.3	3.6e-37
WP_081172374.1|320519_320759_-	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	94.9	4.4e-37
WP_021212125.1|320801_321083_-	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	95.7	1.0e-45
WP_021212124.1|321079_321331_-	XRE family transcriptional regulator	NA	Q9AZJ2	Lactococcus_phage	92.7	3.3e-35
WP_081172375.1|321327_321852_-	hypothetical protein	NA	Q9AZJ3	Lactococcus_phage	65.5	2.8e-60
WP_081172376.1|321848_322046_-	hypothetical protein	NA	Q9AZF2	Lactococcus_phage	93.5	1.1e-25
WP_081172377.1|322061_322283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172378.1|322908_323598_-	hypothetical protein	NA	R9QNB1	Lactococcus_phage	80.4	9.5e-93
WP_044009604.1|323762_323957_-	hypothetical protein	NA	R9QNG3	Lactococcus_phage	43.5	2.1e-05
WP_081172379.1|324764_324959_+	hypothetical protein	NA	Q9AZK1	Lactococcus_phage	95.3	1.5e-27
WP_021213413.1|325253_326150_+	hypothetical protein	NA	A3QSC6	Clostridium_virus	33.3	1.1e-43
WP_081172380.1|326292_326541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172381.1|327064_327256_+	hypothetical protein	NA	Q9AZK4	Lactococcus_phage	84.7	3.0e-20
WP_081172382.1|327406_327571_+|bacteriocin	bacteriocin	bacteriocin	Q9AZK6	Lactococcus_phage	92.6	6.3e-19
WP_081172383.1|328138_329329_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	46.1	1.1e-88
WP_015081999.1|329524_330415_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080600819.1|330491_331067_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_031286608.1|331773_332634_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015082001.1|332778_333639_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015082002.1|333784_334648_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015082003.1|334716_335487_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011675379.1|335502_336363_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011675380.1|336486_337593_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	30.7	1.2e-20
WP_015082004.1|337592_338288_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011834403.1|338330_338879_+	DUF3816 family protein	NA	NA	NA	NA	NA
WP_010905285.1|341819_342113_+	transcriptional regulator	NA	NA	NA	NA	NA
339823:339839	attR	AAAAAAATACTGACAGA	NA	NA	NA	NA
WP_041931736.1|342036_342816_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.0	5.3e-15
WP_015082006.1|342808_343759_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.3	6.0e-13
WP_015082007.1|343759_344698_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011675387.1|344781_345723_+	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011834410.1|345784_346690_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081172384.1|346761_347652_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082009.1|347759_348935_-	MFS transporter	NA	NA	NA	NA	NA
WP_011675391.1|348947_349766_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.3	2.9e-64
WP_011675392.1|349907_350255_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015082010.1|350298_350691_+	VOC family protein	NA	NA	NA	NA	NA
WP_011675395.1|350869_351571_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011675396.1|351748_352312_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_015082012.1|352377_353904_+	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.5	4.8e-20
WP_015082013.1|354157_355048_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	414537	426694	2248099		uncultured_virus(30.0%)	15	NA	NA
WP_011675460.1|414537_414855_+	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_015082041.1|414960_415587_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_015082042.1|415748_417089_+	NADH oxidase (H(2)O-forming)	NA	NA	NA	NA	NA
WP_015082043.1|417179_417569_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	48.6	1.3e-22
WP_011675464.1|417687_417972_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_011675465.1|418058_419687_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_011675466.1|419738_420551_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_021165900.1|420519_420729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675468.1|420740_422168_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_003131580.1|422160_422862_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_015082045.1|423039_423675_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	1.6e-73
WP_011675470.1|423807_424668_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_015082046.1|424717_425500_+	phosphorelay inhibitor	NA	NA	NA	NA	NA
WP_011675472.1|425492_425819_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_041931741.1|425818_426694_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.3	5.4e-101
>prophage 4
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	584998	647898	2248099	transposase,protease,tRNA	Bacillus_phage(18.75%)	49	NA	NA
WP_015082137.1|584998_585889_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041931749.1|585932_586664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675755.1|586695_586971_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_011675756.1|587073_587250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011834603.1|587382_588315_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_015082139.1|588376_589162_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011675759.1|589328_589748_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_015082140.1|589777_590338_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_015082141.1|590471_591890_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	33.0	8.4e-35
WP_041931750.1|592071_594093_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.9	4.2e-64
WP_015082143.1|594307_596323_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.6	3.8e-57
WP_080600823.1|596375_596546_-	DUF3042 domain-containing protein	NA	NA	NA	NA	NA
WP_011675765.1|596740_597406_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.8	2.3e-19
WP_011675766.1|597537_598422_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_015082144.1|598567_599236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075070707.1|599406_600303_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.2	1.8e-35
WP_080600854.1|600551_601196_-	glycoside hydrolase, family 25	NA	A0A1P8BMN5	Lactococcus_phage	56.9	2.4e-13
WP_015082146.1|601675_602023_-	XRE family transcriptional regulator	NA	A0A182BQC8	Lactococcus_phage	74.6	2.0e-43
WP_015082147.1|602787_603711_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_011675772.1|603703_604405_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015082148.1|604577_606806_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	6.7e-79
WP_011834623.1|606929_607442_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	5.3e-32
WP_015082149.1|607657_608221_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_015082150.1|608356_609997_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014573028.1|610057_610528_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011834627.1|613358_613814_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082152.1|613803_616254_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	2.2e-123
WP_015082153.1|616388_616946_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010905473.1|617133_618435_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
WP_014573010.1|618538_619210_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.2e-29
WP_015082154.1|619211_620285_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014573008.1|620296_620866_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082155.1|621052_622576_-	long-chain acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_080600855.1|622823_623687_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_015082157.1|623946_626310_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	31.8	3.6e-107
WP_011675632.1|626438_627098_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_021036849.1|627100_628318_+	MFS transporter	NA	NA	NA	NA	NA
WP_003129585.1|628314_628461_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_041931753.1|628838_630101_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_014573002.1|630205_633619_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_015082159.1|635084_637631_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_015082160.1|637650_638889_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011834647.1|638928_639528_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.1e-52
WP_075070705.1|639746_640253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129597.1|640422_640821_+	arsenate reductase	NA	NA	NA	NA	NA
WP_080513983.1|641202_642171_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015082163.1|645431_645665_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	35.1	2.1e-07
WP_010905103.1|645702_646542_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	9.3e-50
WP_081172393.1|647007_647898_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	771560	897527	2248099	transposase,integrase,tRNA	Bacillus_phage(18.52%)	107	878171:878187	903168:903184
WP_015082226.1|771560_773561_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.3	4.9e-89
WP_011675925.1|774137_774377_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011675926.1|774398_775130_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011675928.1|775535_776045_+	queuosine transporter QueT	NA	E7DN70	Pneumococcus_phage	33.1	2.0e-10
WP_004234939.1|776888_777179_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010905146.1|777274_778036_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.6	5.3e-44
WP_015082229.1|780902_781925_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015082230.1|781936_783124_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_015082231.1|783141_784275_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	3.1e-24
WP_081172399.1|784271_785123_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_081172400.1|785161_786163_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011675937.1|786186_786759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082234.1|786937_787633_+	ribonuclease 3	NA	M4QMG4	Micromonas_pusilla_virus	32.6	3.4e-21
WP_015082235.1|787622_791147_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_041931762.1|791389_793558_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.0e-140
WP_041931763.1|793652_794063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051013164.1|794155_795274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082239.1|795270_796032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931876.1|796949_797759_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011675947.1|797768_798320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082242.1|798381_799776_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.3	1.9e-15
WP_014572881.1|799956_800931_+	ribose-phosphate pyrophosphokinase 1	NA	A0A2K9L2G2	Tupanvirus	36.6	2.2e-42
WP_015082243.1|801054_801726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675950.1|801796_804286_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.1	0.0e+00
WP_015082244.1|805683_807102_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_081172401.1|807213_808578_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011675953.1|808724_809528_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015082247.1|809664_810027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004234939.1|810141_810432_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010905146.1|810527_811289_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.6	5.3e-44
WP_011675781.1|811449_812709_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015082248.1|812849_814856_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081172402.1|814968_815640_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_011675784.1|815659_816523_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_011835521.1|816643_817099_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_011675786.1|817117_817318_+	copper chaperone	NA	NA	NA	NA	NA
WP_011675787.1|817504_819667_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.0	4.3e-99
WP_015082250.1|819868_822520_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675790.1|822590_823376_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_031286465.1|823690_824821_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015082251.1|825074_826301_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_015082252.1|826495_827947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082253.1|828065_828734_+	DNA-binding response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	31.2	5.0e-06
WP_014572868.1|828882_830031_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	5.8e-18
WP_015082254.1|830169_830886_+	uridine phosphorylase	NA	NA	NA	NA	NA
WP_015082255.1|830903_831617_+	nicotinamide mononucleotide transporter	NA	A0A1S6UAV8	Serratia_phage	23.6	5.5e-11
WP_015082256.1|831712_833722_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_015082257.1|833819_834980_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_011675799.1|835956_836292_+	XRE family transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	48.4	7.8e-08
WP_015082259.1|836402_838772_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_051013166.1|839816_840371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082260.1|840443_841334_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
WP_021212525.1|841399_841837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931764.1|841920_842181_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	40.0	6.5e-10
WP_041931765.1|842194_843022_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.7e-49
WP_015082262.1|843073_843898_-	putative glycosyltransferase	NA	NA	NA	NA	NA
WP_015082263.1|844203_845622_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_011675803.1|845750_846110_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011675804.1|846153_847257_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	6.3e-30
WP_011675805.1|847417_847846_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_015082264.1|847984_849292_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675807.1|849420_850338_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	9.0e-22
WP_015082265.1|850334_851837_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_015082266.1|852098_854633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082267.1|854619_855147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931766.1|855156_855534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082268.1|855549_856128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081172403.1|856109_857000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081172404.1|857188_859231_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.9	5.8e-61
WP_011675815.1|859389_860277_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.0	2.1e-39
WP_031286477.1|860447_861701_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_011675817.1|861703_861943_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
WP_015082270.1|862169_863060_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675819.1|863118_864264_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	4.5e-47
WP_015082271.1|864488_865346_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_015082272.1|865346_865847_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572851.1|865922_866729_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011675823.1|866725_867172_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015082273.1|867351_869019_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015082274.1|869718_870285_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011835491.1|870379_870901_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011835489.1|872079_873033_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
WP_015082275.1|873188_873569_+	Cell division protein FtsL, DivIC superfamily	NA	NA	NA	NA	NA
WP_081172405.1|873565_875863_+	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_015082277.1|875937_876927_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_011675833.1|877125_877410_+	hypothetical protein	NA	NA	NA	NA	NA
878171:878187	attL	ATGTTGTCATTGAATCA	NA	NA	NA	NA
WP_011835483.1|879185_879848_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.4e-21
WP_041931767.1|880207_881095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082279.1|881353_882244_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675837.1|882330_883005_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_011675838.1|883164_883509_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_081172406.1|884438_884900_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_081172525.1|885422_885665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082281.1|885657_886986_+	glycosyltransferase family 2 cellulose synthase (CESA) superfamily	NA	NA	NA	NA	NA
WP_011835479.1|887216_887774_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_015082283.1|887836_888082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931768.1|888354_889080_+	nicotinamide mononucleotide transporter	NA	A0A2P0ZKW0	Lactobacillus_phage	28.7	1.1e-14
WP_014572836.1|889632_890058_+	universal stress protein	NA	NA	NA	NA	NA
WP_015082285.1|890225_890588_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_011675849.1|890649_891183_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080600829.1|891341_891854_+	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_015082286.1|891854_892745_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041931770.1|892879_894751_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003131392.1|894939_895272_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_015082287.1|895407_896382_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	28.3	1.9e-30
WP_041931880.1|896569_896908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003137511.1|897266_897527_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
903168:903184	attR	ATGTTGTCATTGAATCA	NA	NA	NA	NA
>prophage 6
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	994480	1018178	2248099	transposase	Bacillus_phage(18.75%)	23	NA	NA
WP_015082336.1|994480_995173_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.3	4.2e-32
WP_015082337.1|995165_996101_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675984.1|996210_997188_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_011675985.1|997571_999740_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	3.3e-256
WP_015082339.1|999876_1000299_-	protein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.7e-12
WP_011675987.1|1000300_1000519_-	NrdH-redoxin	NA	C3U2K9	Lactococcus_phage	47.6	5.8e-12
WP_011675988.1|1000692_1001334_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_081172410.1|1001612_1003547_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	5.4e-125
WP_015082341.1|1003653_1004190_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_015082342.1|1004182_1005016_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	38.7	1.5e-20
WP_041931779.1|1005613_1008088_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.0e-96
WP_010890648.1|1008905_1009586_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_041931780.1|1009598_1009835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082345.1|1010326_1011415_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.8	8.4e-51
WP_011675996.1|1011414_1012062_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.7	5.5e-42
WP_015082346.1|1012073_1013270_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.3	7.4e-109
WP_014572751.1|1013296_1013761_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.3	1.4e-39
WP_011669038.1|1013942_1014203_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	1.1e-09
WP_081172527.1|1014214_1015054_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	6.0e-49
WP_080600831.1|1015086_1016022_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572493.1|1016087_1016468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676002.1|1016757_1017210_+	signal peptidase II	NA	NA	NA	NA	NA
WP_015082348.1|1017272_1018178_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	3.5e-10
>prophage 7
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	1133306	1198490	2248099	transposase,protease	Lactococcus_phage(23.08%)	60	NA	NA
WP_011676271.1|1133306_1134542_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	2.4e-134
WP_015082414.1|1134538_1135126_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011676273.1|1135179_1135530_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011676274.1|1135609_1136659_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	45.1	8.7e-37
WP_015082415.1|1136655_1137729_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_014572580.1|1137731_1138232_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015082416.1|1138247_1139531_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_081172421.1|1139659_1140298_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	5.4e-50
WP_015082417.1|1140477_1141764_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011676280.1|1141768_1142659_+	homoserine kinase	NA	NA	NA	NA	NA
WP_015082418.1|1142912_1143512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082419.1|1143554_1144454_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_015082420.1|1144913_1146194_+	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	38.4	6.0e-32
WP_081172423.1|1146190_1146979_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021212202.1|1146980_1147781_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015082423.1|1147828_1148896_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041931789.1|1148911_1149097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082424.1|1150104_1151298_-	MFS transporter	NA	NA	NA	NA	NA
WP_015082425.1|1151594_1152776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082426.1|1152808_1154470_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_081172425.1|1155071_1155305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082427.1|1155411_1155756_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082428.1|1155984_1156743_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_081172427.1|1156832_1157723_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021037225.1|1157935_1158250_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082430.1|1159007_1159424_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_011676176.1|1159788_1160199_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082431.1|1160370_1161228_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	30.4	2.4e-29
WP_015082432.1|1161265_1162156_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080600859.1|1162573_1163413_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	1.8e-48
WP_015082433.1|1163424_1163685_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	2.5e-09
WP_015082434.1|1164028_1164733_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_011676170.1|1165754_1167125_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	56.0	3.8e-141
WP_021165386.1|1167169_1168777_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015082436.1|1168778_1169399_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080600858.1|1169572_1170637_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015082438.1|1170664_1171921_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015082439.1|1172075_1173740_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_015082440.1|1173846_1174992_-	MFS transporter	NA	NA	NA	NA	NA
WP_014572641.1|1175099_1175498_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015082441.1|1175814_1176705_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676161.1|1177285_1177618_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082442.1|1177822_1179826_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	3.2e-80
WP_011676158.1|1180144_1180624_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_021165370.1|1183882_1184107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082445.1|1184218_1185289_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_015082446.1|1185288_1186245_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_015082447.1|1187024_1188332_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_015082448.1|1188332_1188941_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_041931790.1|1188952_1189723_+	aminoglycoside 3'-phosphotransferase	NA	A0A193CJY5	Infectious_laryngotracheitis_virus	26.1	5.6e-09
WP_015082449.1|1189767_1190376_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_015082450.1|1190375_1191116_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_015082451.1|1191084_1191864_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011676145.1|1191860_1192499_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_015082452.1|1192499_1193285_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011835164.1|1193317_1194277_-	rhodanese domain-containing protein	NA	NA	NA	NA	NA
WP_015082453.1|1194699_1196241_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.5	8.9e-06
WP_041931791.1|1196276_1196456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003331414.1|1196496_1197255_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|1197266_1198490_-|transposase	IS21 family transposase IS712	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
>prophage 8
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	1216415	1279461	2248099	transposase,tRNA	Bacillus_phage(40.0%)	56	NA	NA
WP_014572600.1|1216415_1217762_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_015082466.1|1217811_1218882_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_015082467.1|1219528_1220230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165346.1|1220408_1220639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082468.1|1221487_1222555_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.9	2.7e-54
WP_004234939.1|1223068_1223359_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080600835.1|1223376_1223718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931793.1|1223753_1224017_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.0	2.7e-08
WP_080600859.1|1224028_1224868_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	1.8e-48
WP_015082470.1|1225887_1226745_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_015082471.1|1226734_1229008_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014572659.1|1229167_1229821_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015082472.1|1229913_1232646_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	1.9e-43
WP_015082473.1|1233120_1234407_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011676184.1|1234396_1234636_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
WP_041931794.1|1234671_1235895_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	2.4e-22
WP_015082475.1|1235894_1237394_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	30.0	1.8e-40
WP_021212171.1|1237418_1237550_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_015082476.1|1237732_1238389_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015082477.1|1238381_1239182_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015082478.1|1239194_1239947_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_081172431.1|1241286_1242177_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081172432.1|1242233_1242974_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.5	4.0e-20
WP_015082481.1|1243484_1244321_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_011676192.1|1244317_1245877_-	MFS transporter	NA	NA	NA	NA	NA
WP_015082163.1|1246015_1246249_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	35.1	2.1e-07
WP_010905103.1|1246286_1247126_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	9.3e-50
WP_015082482.1|1247936_1248302_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011676195.1|1248371_1248887_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_015082483.1|1249140_1249566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676197.1|1249813_1250002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676198.1|1250015_1250774_-	XRE family transcriptional regulator	NA	R9TNM0	Vibrio_phage	26.6	3.7e-05
WP_015082484.1|1250892_1252677_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.5e-44
WP_015082485.1|1252660_1254478_-	multidrug resistance ABC transporter ATP-binding and permease	NA	W8CYL7	Bacillus_phage	27.4	1.1e-44
WP_015082486.1|1254615_1255866_-	glycoside hydrolase family 25	NA	A0A2H4PQN5	Staphylococcus_phage	26.3	2.1e-05
WP_015082487.1|1255879_1256470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082488.1|1256523_1257111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835093.1|1257421_1258042_-	riboflavin transporter RibU	NA	NA	NA	NA	NA
WP_011676202.1|1258390_1259110_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011676203.1|1259096_1259663_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.4	9.5e-14
WP_015082490.1|1259655_1260384_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.5	4.5e-08
WP_015082491.1|1260414_1261131_-	XerD-like tyrosine recombinase	NA	NA	NA	NA	NA
WP_011676206.1|1261108_1261570_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_015082492.1|1261600_1262104_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014572683.1|1262142_1262748_-	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015082493.1|1262748_1263564_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003130191.1|1263739_1263979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082494.1|1264129_1265389_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014572686.1|1265503_1266943_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_015082495.1|1266942_1271412_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_015082496.1|1271580_1272192_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_015082497.1|1272224_1273247_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011676215.1|1273406_1274162_+	potassium transporter KefA	NA	NA	NA	NA	NA
WP_015082498.1|1275647_1277159_-	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_041931795.1|1277201_1278092_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082500.1|1278570_1279461_-|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	1499948	1566415	2248099	transposase,bacteriocin,tRNA	Lactococcus_phage(25.0%)	55	NA	NA
WP_015082638.1|1499948_1500986_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015082639.1|1501057_1501660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676623.1|1501708_1501879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011834866.1|1501906_1503220_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_015082640.1|1503369_1504536_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_015082641.1|1504536_1505610_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_015082642.1|1505852_1507202_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011676628.1|1507370_1507712_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_015082643.1|1507796_1509038_-	ammonium transporter	NA	NA	NA	NA	NA
WP_021211938.1|1509223_1510696_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	5.1e-27
WP_015082645.1|1510708_1511401_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	3.1e-35
WP_011834860.1|1511556_1512087_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_011676633.1|1512219_1512465_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
WP_051013198.1|1513253_1513850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082647.1|1513957_1514728_+	hypothetical protein	NA	Q38326	Lactococcus_phage	74.0	1.9e-65
WP_011676639.1|1514888_1515962_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.5e-60
WP_011676640.1|1516049_1516982_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.5	1.3e-23
WP_081172452.1|1517230_1518523_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	1.1e-60
WP_011676642.1|1518622_1519144_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015082648.1|1519435_1520134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676644.1|1520238_1520538_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021037569.1|1520527_1521445_+	cation transporter	NA	NA	NA	NA	NA
WP_015082651.1|1523033_1523846_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.5e-41
WP_081172453.1|1524082_1524973_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082654.1|1526461_1526704_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_015082655.1|1526819_1527146_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_015082656.1|1527132_1527840_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015082657.1|1528034_1528607_+	NADP oxidoreductase coenzyme F420-dependent	NA	NA	NA	NA	NA
WP_015082658.1|1528676_1529219_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015082659.1|1529243_1530800_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015082660.1|1531044_1531935_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082662.1|1533958_1535671_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
WP_015082663.1|1536020_1536692_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.3	2.8e-20
WP_011676659.1|1536731_1537625_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011676660.1|1537953_1538409_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	38.9	1.0e-26
WP_015082664.1|1538418_1539495_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015082665.1|1539590_1540454_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_015082666.1|1540802_1541054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082667.1|1541221_1543198_-	transketolase	NA	NA	NA	NA	NA
WP_015082668.1|1543365_1544766_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_011676666.1|1544818_1545118_-	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
WP_015082669.1|1547234_1547876_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_015082670.1|1548825_1550244_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011676673.1|1551197_1552724_-	MFS transporter	NA	NA	NA	NA	NA
WP_081172455.1|1552909_1553986_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_011676494.1|1556160_1556841_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082673.1|1556905_1558336_-	MFS transporter	NA	NA	NA	NA	NA
WP_011834820.1|1558694_1559000_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011676497.1|1559004_1559229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572291.1|1559443_1560334_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572290.1|1560315_1560516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172457.1|1561832_1562567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003331414.1|1563996_1564755_+	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_015081738.1|1564826_1565507_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	1.2e-108
WP_081172459.1|1565557_1566415_-|transposase	transposase	transposase	A0A059NT83	Lactococcus_phage	99.6	3.6e-158
>prophage 10
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	1832694	1842991	2248099	integrase,transposase	Lactococcus_phage(62.5%)	13	1832291:1832313	1843011:1843033
1832291:1832313	attL	AACGTAACTAAAAACGTAACTAA	NA	NA	NA	NA
WP_015082809.1|1832694_1833633_-	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	50.6	1.0e-81
WP_011676902.1|1833550_1835152_-	membrane protein	NA	NA	NA	NA	NA
WP_081172533.1|1835241_1836081_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	3.5e-49
WP_003137511.1|1836092_1836353_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_021212698.1|1836464_1836860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082812.1|1836862_1837282_-	deoxyuridine 5-triphosphate nucleotidohydrolase	NA	A5GYP0	Lactococcus_phage	95.7	9.0e-70
WP_003331414.1|1837513_1838272_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_015082455.1|1838283_1839507_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	6.4e-233
WP_015082813.1|1839582_1840107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600863.1|1840387_1840954_+	helix-turn-helix domain-containing protein	NA	A5GYQ3	Lactococcus_phage	72.2	5.1e-60
WP_015082815.1|1840959_1841394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573177.1|1841407_1841743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021212288.1|1841809_1842991_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	47.5	2.0e-90
1843011:1843033	attR	AACGTAACTAAAAACGTAACTAA	NA	NA	NA	NA
>prophage 11
NZ_CP015907	Lactococcus lactis subsp. cremoris strain UC109 chromosome, complete genome	2248099	2044439	2102880	2248099	transposase,protease,tRNA	Bacillus_phage(35.71%)	58	NA	NA
WP_081172505.1|2044439_2045330_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082866.1|2046582_2047722_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A2K9VDE3	Lactobacillus_phage	55.4	1.5e-119
WP_015082867.1|2047708_2048686_-	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_015082868.1|2048883_2050176_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	33.7	1.0e-39
WP_041931920.1|2050460_2051384_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_015082870.1|2051603_2051885_+	DUF3270 domain-containing protein	NA	NA	NA	NA	NA
WP_011677044.1|2051914_2052736_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011677066.1|2052854_2053481_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_015082871.1|2053513_2054533_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011677068.1|2054525_2055296_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	4.9e-29
WP_051013186.1|2055314_2056205_-	hypothetical protein	NA	A0A076G4Q2	Staphylococcus_phage	26.6	6.5e-09
WP_051013188.1|2056306_2056630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600867.1|2056718_2057558_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	4.6e-49
WP_011669038.1|2057569_2057830_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	1.1e-09
WP_011677070.1|2058098_2058497_+	HIT family protein	NA	NA	NA	NA	NA
WP_011677071.1|2058511_2058733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573252.1|2058744_2059089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677073.1|2059166_2059856_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011677074.1|2060242_2060668_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_015082873.1|2060803_2061568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082874.1|2061567_2062446_-	bacitracin transport ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.4	1.9e-05
WP_011677077.1|2062512_2062722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677078.1|2062755_2063277_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_015082876.1|2063451_2064309_-	RNA-binding domain protein	NA	NA	NA	NA	NA
WP_011677080.1|2064353_2064812_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011677081.1|2064896_2065454_-	ribosome-recycling factor	NA	NA	NA	NA	NA
WP_004254608.1|2065609_2066326_-	UMP kinase	NA	NA	NA	NA	NA
WP_011677082.1|2066410_2066863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082877.1|2066992_2068180_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677084.1|2068338_2069526_-	acetate kinase	NA	NA	NA	NA	NA
WP_081172507.1|2069717_2070656_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677086.1|2070743_2070995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677087.1|2071095_2072937_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	1.2e-17
WP_015082879.1|2073104_2073578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600868.1|2073700_2074540_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	4.6e-49
WP_003137511.1|2074551_2074812_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_041931832.1|2074848_2075223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082881.1|2075305_2076196_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082882.1|2076256_2076715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082883.1|2076729_2077344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082884.1|2077683_2078412_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011677095.1|2078604_2078826_+	DUF910 domain-containing protein	NA	NA	NA	NA	NA
WP_011677096.1|2078859_2079831_+	glucokinase	NA	NA	NA	NA	NA
WP_011677097.1|2079833_2080220_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015082885.1|2080335_2080782_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.6	1.6e-16
WP_015082886.1|2080947_2081535_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011677101.1|2082570_2083665_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011677102.1|2083740_2084232_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_015082889.1|2084307_2085801_-	amino acid permease	NA	NA	NA	NA	NA
WP_015082890.1|2087384_2088329_-	carbamate kinase	NA	NA	NA	NA	NA
WP_015082892.1|2090058_2091123_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_015082893.1|2091288_2092521_-	arginine deiminase	NA	NA	NA	NA	NA
WP_011677109.1|2093827_2095522_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
WP_015082894.1|2095589_2096048_+	arginine repressor	NA	NA	NA	NA	NA
WP_081172509.1|2096207_2097539_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_041931833.1|2097739_2098339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082897.1|2098555_2101660_-	DNA/RNA helicase SWF/SNF family	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_041931764.1|2102619_2102880_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	40.0	6.5e-10
>prophage 1
NZ_CP016707	Lactococcus lactis subsp. cremoris strain UC109 plasmid pUC109A, complete sequence	64175	12579	62452	64175	transposase,bacteriocin,integrase	Lactococcus_phage(37.5%)	56	28209:28226	42794:42811
WP_003331415.1|12579_13803_+|transposase	IS21 family transposase IS712	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|13814_14573_+	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_081172557.1|14621_15374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172559.1|15399_15813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172561.1|15910_16186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172563.1|16200_18036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172565.1|18050_18542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172569.1|18552_18939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172571.1|19359_19554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172573.1|20375_20672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081172574.1|20695_21283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172575.1|21416_22097_+	DDE domain-containing protein	NA	A0A1X9I6C6	Streptococcus_phage	84.1	5.0e-110
WP_021215324.1|22481_23210_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058213251.1|23206_23956_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081042780.1|23961_24873_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.7	4.4e-45
WP_081172577.1|25060_25951_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002892257.1|26102_26801_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.0	3.9e-33
WP_021213220.1|26797_28168_+	sensor histidine kinase	NA	NA	NA	NA	NA
28209:28226	attL	GGTTCTGTTGCAAAGTTT	NA	NA	NA	NA
WP_081172578.1|28281_28962_+	DDE domain-containing protein	NA	A0A1X9I6C6	Streptococcus_phage	85.4	2.0e-111
WP_081172579.1|29252_29597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011834703.1|29649_30204_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	49.7	1.8e-41
WP_003331415.1|30863_32087_+|transposase	IS21 family transposase IS712	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|32098_32857_+	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_080600874.1|32905_33502_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	39.5	9.3e-28
WP_003137511.1|33513_33774_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015081775.1|34425_35262_+	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	50.5	1.9e-74
WP_081172581.1|35741_36902_+	MFS transporter	NA	NA	NA	NA	NA
WP_021214628.1|37231_37654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080600873.1|37650_38142_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	35.9	9.7e-15
WP_021166320.1|38421_38832_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011669047.1|39264_41190_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	36.6	5.7e-34
WP_015081772.1|41194_41776_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.4	1.4e-36
WP_080600872.1|41876_42077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931732.1|42076_42757_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	8.5e-110
WP_012898583.1|42908_43109_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	92.4	6.9e-28
42794:42811	attR	AAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_081172582.1|43403_44294_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002355386.1|48128_48752_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_011669074.1|49017_49593_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011669075.1|49737_50007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669076.1|50193_50556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573523.1|50565_50853_-|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_041931947.1|50965_51646_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.9	4.4e-106
WP_014573656.1|51837_52176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021164873.1|52865_53096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669083.1|53145_53442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004234939.1|55013_55304_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010905146.1|55399_56161_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.6	5.3e-44
WP_011669084.1|56608_56809_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	97.0	9.6e-30
WP_003132324.1|57085_57286_-	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	1.6e-13
WP_014573531.1|57416_57617_-	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	51.9	2.8e-05
WP_041931947.1|58595_59276_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.9	4.4e-106
WP_041931939.1|59673_60006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600870.1|60195_60384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080562023.1|60338_60530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172584.1|60645_62112_+	DNA polymerase	NA	Q6DMX4	Streptococcus_phage	51.3	7.7e-124
WP_080514012.1|62071_62452_+	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	75.6	3.3e-10
>prophage 1
NZ_CP016708	Lactococcus lactis subsp. cremoris strain UC109 plasmid pUC109B, complete sequence	48261	41110	47681	48261	bacteriocin,transposase	Streptococcus_phage(50.0%)	10	NA	NA
WP_003132842.1|41110_41407_+	hypothetical protein	NA	A0A1S5SEW3	Streptococcus_phage	39.3	4.2e-05
WP_003132844.1|41441_41663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003132846.1|42012_42567_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.6	3.6e-42
WP_011676114.1|43052_43718_-	alpha-acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_013646119.1|43884_44565_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_023349284.1|44641_45478_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	50.5	4.1e-74
WP_011915238.1|45765_46101_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_041931931.1|46295_46574_+	DNA polymerase	NA	X2KQX9	Campylobacter_phage	46.0	7.2e-07
WP_011869582.1|46622_47078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081768.1|47081_47681_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	41.0	2.5e-12
