The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	406458	418615	2379714	tRNA	uncultured_virus(30.0%)	14	NA	NA
WP_011675460.1|406458_406776_+	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_011675461.1|406881_407508_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_021165897.1|407669_409010_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021165898.1|409100_409490_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	47.4	2.0e-23
WP_011675464.1|409608_409893_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_021213999.1|409979_411608_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.4	1.7e-156
WP_011675466.1|411659_412472_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_011675468.1|412661_414089_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_003131580.1|414081_414783_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_015082045.1|414960_415596_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	1.6e-73
WP_011675470.1|415728_416589_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_064305123.1|416638_417421_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_011675472.1|417413_417740_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_021165901.1|417739_418615_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.1	6.0e-100
>prophage 2
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	578154	632629	2379714	tRNA,transposase,protease	Bacillus_phage(25.0%)	40	NA	NA
WP_116368833.1|578154_579547_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.0	1.3e-56
WP_021166347.1|581174_583190_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.8	2.6e-58
WP_021166348.1|583242_583413_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_011675765.1|583607_584273_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.8	2.3e-19
WP_011675766.1|584404_585289_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_021166349.1|585434_586103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675768.1|586267_587170_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.2	1.8e-35
WP_021166351.1|588543_588891_-	XRE family transcriptional regulator	NA	A0A182BQC8	Lactococcus_phage	75.4	1.2e-43
WP_015082147.1|589655_590579_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_021166352.1|590571_591273_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021166353.1|591445_593674_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	8.7e-79
WP_011834623.1|593798_594311_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	5.3e-32
WP_021166354.1|594501_595065_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_021166355.1|595200_596841_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014573028.1|596901_597372_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_116368835.1|597463_598838_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	1.3e-51
WP_021166358.1|599054_599510_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166359.1|599499_601950_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.2	6.3e-123
WP_011834629.1|602084_602642_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010905473.1|602829_604131_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
WP_021166361.1|604172_604853_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.3e-29
WP_081146204.1|604854_605928_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014573008.1|605939_606509_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166362.1|606695_608219_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_021166363.1|608412_609330_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_021166364.1|609504_611868_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	31.8	8.0e-107
WP_021166365.1|611996_612656_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_021166366.1|612658_613876_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003129585.1|613872_614019_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011675634.1|614396_615659_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021166367.1|615763_619177_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_064305132.1|620624_623171_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_081146206.1|623190_624429_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_064305133.1|624468_625068_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	3.2e-52
WP_011675638.1|625263_625794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129597.1|625963_626362_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_011675640.1|626743_627907_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015081777.1|627997_628756_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	99.6	2.6e-136
WP_064305106.1|628767_629991_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
WP_101944661.1|631518_632629_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
>prophage 3
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	833299	931898	2379714	transposase,plate,tail,terminase,integrase,holin,head,capsid,portal	Lactococcus_phage(74.29%)	109	833910:833928	882831:882849
WP_152023825.1|833299_834672_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	7.8e-54
833910:833928	attL	CCTAGCTTCTTCATTAAGC	NA	NA	NA	NA
WP_064305190.1|834723_835344_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.9	8.0e-99
WP_014572475.1|836012_836555_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.1	5.8e-61
WP_011676403.1|836584_836887_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	51.7	6.0e-07
WP_021166271.1|837168_838113_+	cation transporter	NA	NA	NA	NA	NA
WP_021166270.1|838166_838598_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_064305189.1|838668_839589_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	37.7	1.9e-32
WP_031286733.1|839777_840374_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011676397.1|841702_841891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676396.1|841903_842566_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_021166267.1|842552_842945_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_064305188.1|843212_844268_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.2	1.1e-60
WP_011676393.1|844454_845162_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166266.1|845169_845610_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_011676391.1|845707_847261_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.3	1.0e-33
WP_011676390.1|847250_847961_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	30.1	5.3e-06
WP_011676389.1|848144_848480_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_021166264.1|849094_850174_-|integrase	site-specific integrase	integrase	A5GYP9	Lactococcus_phage	99.2	4.7e-203
WP_021166263.1|850295_850874_-	SHOCT domain-containing protein	NA	Q9AZQ9	Lactococcus_phage	98.4	3.1e-97
WP_031286732.1|850957_851794_-	helix-turn-helix domain-containing protein	NA	Q9AZQ8	Lactococcus_phage	99.6	5.1e-157
WP_031286731.1|852010_852190_+	putative transcriptional regulator	NA	A0A1B1IMU6	Lactococcus_phage	100.0	4.0e-27
WP_015966780.1|852210_852453_+	hypothetical protein	NA	Q77JL3	Lactococcus_phage	100.0	5.2e-38
WP_021166261.1|852465_853290_+	hypothetical protein	NA	Q38330	Lactococcus_phage	81.8	9.3e-119
WP_021166260.1|853302_853593_+	hypothetical protein	NA	Q9AZW0	Lactococcus_phage	97.9	7.9e-49
WP_021166259.1|853659_853896_+	DUF1408 domain-containing protein	NA	Q9MC36	Lactococcus_phage	96.2	6.7e-38
WP_021166258.1|854000_854519_+	hypothetical protein	NA	Q9XJE3	Lactococcus_phage	95.3	3.6e-84
WP_064305187.1|854527_855286_+	hypothetical protein	NA	Q0ILF6	Lactococcus_phage	97.2	3.4e-144
WP_021166254.1|855278_855704_+	single-stranded DNA-binding protein	NA	Q9AZV6	Lactococcus_phage	95.0	1.7e-71
WP_015966802.1|855832_856615_+	phage replisome organiser protein	NA	Q9XJE6	Lactococcus_phage	100.0	3.7e-125
WP_021166253.1|856614_857340_+	hypothetical protein	NA	A0A1P8BKN5	Lactococcus_phage	97.9	1.7e-132
WP_003132944.1|857336_858095_+	site-specific DNA-methyltransferase	NA	Q9XJE8	Lactococcus_phage	99.6	1.6e-146
WP_021166252.1|858084_858474_+	RusA family crossover junction endodeoxyribonuclease	NA	R9QLL1	Lactococcus_phage	96.9	2.3e-67
WP_021166251.1|858477_858672_+	hypothetical protein	NA	Q38101	Lactococcus_phage	98.4	3.3e-27
WP_031286728.1|858664_858904_+	DUF1031 family protein	NA	Q94M89	Lactococcus_phage	97.5	1.7e-36
WP_021166249.1|859015_859195_+	DUF1497 domain-containing protein	NA	A0A1P8BMJ6	Lactococcus_phage	98.3	3.5e-23
WP_021166248.1|859184_859754_+	DUF658 family protein	NA	Q9B002	Lactococcus_phage	96.3	3.8e-87
WP_011676533.1|859764_860025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021166247.1|860025_860232_+	DUF1125 domain-containing protein	NA	Q9MC26	Lactococcus_phage	98.5	3.4e-30
WP_021166246.1|860224_860854_+	DUF1642 domain-containing protein	NA	Q9AZ77	Lactococcus_phage	65.4	1.2e-65
WP_021166245.1|860850_861270_+	dUTP diphosphatase	NA	Q77K24	Lactococcus_phage	99.3	1.5e-72
WP_021166244.1|861274_861544_+	hypothetical protein	NA	A0A1P8BKH9	Lactococcus_phage	87.5	2.5e-41
WP_021166243.1|861540_861855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134799462.1|861866_862256_+	hypothetical protein	NA	A0A1P8BM10	Lactococcus_phage	97.5	4.2e-37
WP_021166241.1|862252_862579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031286727.1|862620_862956_+	DUF1140 family protein	NA	Q77MW4	Lactococcus_phage	90.9	2.4e-49
WP_021166239.1|862974_863205_+	hypothetical protein	NA	A0A1P8BMS6	Lactococcus_phage	43.6	5.4e-08
WP_015966898.1|863201_863360_+	DUF1660 domain-containing protein	NA	Q9AZ71	Lactococcus_phage	100.0	9.3e-28
WP_021166237.1|863599_863842_+	hypothetical protein	NA	A6MA87	Lactococcus_virus	69.6	8.7e-25
WP_014573151.1|863922_864345_+	DUF722 domain-containing protein	NA	Q9AYX5	Lactococcus_phage	100.0	5.5e-75
WP_011676523.1|864715_865126_+|terminase	terminase	terminase	Q9AZ67	Lactococcus_phage	100.0	1.4e-67
WP_021165213.1|865118_866507_+|terminase	phage terminase large subunit	terminase	Q2QER6	Lactococcus_phage	100.0	4.5e-275
WP_021165214.1|866507_867866_+|portal	phage portal protein	portal	Q9AZ65	Lactococcus_phage	99.6	3.3e-254
WP_021165215.1|867869_868910_+|capsid	minor capsid protein	capsid	B5SP29	Lactococcus_phage	97.4	2.4e-188
WP_003131938.1|868955_869288_+	hypothetical protein	NA	Q9AYW8	Lactococcus_phage	100.0	1.3e-58
WP_021165216.1|869411_870074_+	DUF4355 domain-containing protein	NA	B5SP30	Lactococcus_phage	99.5	1.4e-77
WP_021165217.1|870075_870894_+|capsid	N4-gp56 family major capsid protein	capsid	Q9AZ61	Lactococcus_phage	98.2	1.5e-140
WP_011676051.1|870893_871094_+	hypothetical protein	NA	B5SP32	Lactococcus_phage	100.0	9.6e-30
WP_021165218.1|871077_871410_+|head,tail	phage head-tail connector protein	head,tail	A0A1L2JXP0	Streptococcus_phage	100.0	4.2e-54
WP_021165219.1|871406_871718_+	hypothetical protein	NA	B5SP34	Lactococcus_phage	97.1	1.8e-54
WP_021165220.1|871714_872041_+	HK97 gp10 family phage protein	NA	A0A1P8BKS5	Lactococcus_phage	97.2	1.7e-52
WP_021165221.1|872037_872427_+	hypothetical protein	NA	Q38611	Lactococcus_phage	95.3	4.0e-64
WP_021165222.1|872437_872947_+|tail	phage major tail protein, TP901-1 family	tail	Q77K19	Lactococcus_phage	96.4	2.9e-86
WP_014572189.1|873062_873413_+	hypothetical protein	NA	B5SP38	Lactococcus_phage	100.0	5.0e-58
WP_021165223.1|873496_873766_+	hypothetical protein	NA	A0A1P8BKT4	Lactococcus_phage	98.9	1.5e-41
WP_003331414.1|874954_875713_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|875724_876948_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_021165306.1|878584_879346_+	hypothetical protein	NA	B5SP41	Lactococcus_phage	97.2	2.0e-139
WP_021213901.1|879345_882102_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q9AZ57	Lactococcus_phage	97.3	0.0e+00
WP_021165307.1|882114_883095_+|plate	phage baseplate upper protein	plate	A0A1P8BKH4	Lactococcus_phage	96.6	2.9e-180
882831:882849	attR	CCTAGCTTCTTCATTAAGC	NA	NA	NA	NA
WP_021165308.1|883084_883870_+	fibronectin type III domain-containing protein	NA	B5SP44	Lactococcus_phage	63.6	1.3e-85
WP_021165309.1|883888_884380_+	hypothetical protein	NA	Q9G096	Lactococcus_phage	97.5	6.6e-88
WP_011676503.1|884393_884618_+|holin	holin	holin	A0A1B1IMU8	Lactococcus_phage	100.0	6.1e-33
WP_015974072.1|887018_887285_+|holin	phage holin	holin	A0A1B1IMU0	Lactococcus_phage	100.0	1.6e-40
WP_064305186.1|887281_888571_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9FZS8	Lactococcus_phage	96.0	3.5e-237
WP_116368845.1|890482_891593_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_011675801.1|891697_892528_-	SP_1767 family glycosyltransferase	NA	NA	NA	NA	NA
WP_014572862.1|892833_894252_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_021165391.1|894380_894740_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_021165392.1|894783_895887_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	6.3e-30
WP_064305184.1|896047_896467_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011675806.1|896614_897922_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064305183.1|898050_898968_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	9.0e-22
WP_011835503.1|898964_900467_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_064305182.1|903106_903610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165395.1|903619_903997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031286442.1|904287_904572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165496.1|905613_907656_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.9	1.5e-61
WP_011835499.1|907844_908702_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.0	2.6e-39
WP_031286477.1|908872_910126_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_011675817.1|910128_910368_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_064305180.1|910594_911485_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165630.1|911543_912689_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	4.5e-47
WP_014572853.1|912913_913771_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_021165631.1|913771_914272_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021165632.1|914347_915154_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_011675823.1|915150_915597_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_021165633.1|915776_917444_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015082274.1|918137_918704_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011835491.1|918798_919320_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_031286508.1|919341_920268_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_032940916.1|920511_921453_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011675830.1|921608_921989_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_021214282.1|921985_924283_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011835486.1|924357_925347_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_011675833.1|925545_925830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165638.1|925980_927498_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675836.1|928627_929515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064305180.1|929773_930664_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_116368847.1|930787_931898_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
>prophage 4
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	941497	992819	2379714	integrase,transposase	Streptococcus_phage(33.33%)	44	966783:966800	987281:987298
WP_064305089.1|941497_942388_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_031286550.1|942522_944358_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003131392.1|944546_944879_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_021165730.1|945013_945988_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.4	7.3e-30
WP_021165731.1|946612_946855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116368849.1|946906_948018_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_021037023.1|949320_949950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572828.1|949946_950945_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_021165122.1|950972_951602_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081146229.1|951668_952478_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014572825.1|952577_953168_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	45.5	3.2e-28
WP_011675859.1|953169_953601_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021165123.1|953597_954203_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	36.9	2.2e-29
WP_021165124.1|954414_955659_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021165125.1|956990_957752_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_021165126.1|958296_959847_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	23.6	1.3e-25
WP_081146230.1|960261_961884_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_011675866.1|963359_964259_+	EamA family transporter	NA	NA	NA	NA	NA
WP_021165129.1|964381_965146_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.0e-26
WP_021165130.1|965126_966707_+	hypothetical protein	NA	NA	NA	NA	NA
966783:966800	attL	GTTTTCTTGTTCAGATTA	NA	NA	NA	NA
WP_021165133.1|967792_968440_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011675870.1|968593_970549_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	3.7e-142
WP_011675871.1|970647_970833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165134.1|971056_971794_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.3	1.2e-80
WP_021165135.1|971966_972608_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_015082299.1|972765_973230_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021165138.1|974766_975486_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_081146231.1|975764_976655_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165141.1|976818_977727_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_015082326.1|982166_983057_+|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
WP_021165148.1|984151_985306_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	29.1	3.3e-29
WP_021165149.1|985302_985536_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_064305143.1|985586_986621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050574191.1|986844_987060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165152.1|987307_987496_-	hypothetical protein	NA	NA	NA	NA	NA
987281:987298	attR	GTTTTCTTGTTCAGATTA	NA	NA	NA	NA
WP_021165153.1|987492_988266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165154.1|988255_988822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165155.1|988996_989479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165156.1|989581_990448_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021165157.1|990549_990942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153950482.1|990952_991105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165159.1|991108_991486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165160.1|991499_991721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064305093.1|991928_992819_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	1049536	1063286	2379714		Enterococcus_phage(25.0%)	11	NA	NA
WP_011675982.1|1049536_1050229_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
WP_021165191.1|1050221_1051157_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675984.1|1051266_1052244_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_064305099.1|1052648_1054817_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.6	5.6e-256
WP_011675986.1|1054953_1055376_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.7e-12
WP_021165193.1|1055377_1055596_-	redoxin NrdH	NA	C3U2K9	Lactococcus_phage	49.2	4.4e-12
WP_011675988.1|1055769_1056411_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_021165194.1|1056689_1058624_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.4	3.1e-125
WP_021165197.1|1059259_1060093_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	40.0	5.3e-21
WP_014572756.1|1060089_1060539_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031301152.1|1060811_1063286_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	6.0e-97
>prophage 6
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	1196109	1248284	2379714	tRNA,transposase,protease	Lactococcus_phage(27.27%)	41	NA	NA
WP_011676268.1|1196109_1196619_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011835213.1|1197050_1197557_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	29.8	2.2e-09
WP_011676271.1|1197805_1199041_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	2.4e-134
WP_011676272.1|1199037_1199625_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011676273.1|1199678_1200029_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011676274.1|1200108_1201158_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	45.1	8.7e-37
WP_021165285.1|1201154_1202228_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_014572580.1|1202230_1202731_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_021165286.1|1202746_1204030_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_162494586.1|1204155_1204797_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.7	7.9e-49
WP_021165288.1|1204977_1206264_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011676280.1|1206268_1207159_+	homoserine kinase	NA	NA	NA	NA	NA
WP_162494582.1|1207342_1208011_+	niacin ECF transporter S component NiaX	NA	NA	NA	NA	NA
WP_021165290.1|1208053_1208953_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_021165291.1|1209412_1210693_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	38.9	2.1e-32
WP_021165292.1|1210689_1211478_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165293.1|1211479_1212280_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165294.1|1212327_1213395_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011676287.1|1213704_1214604_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021165301.1|1216095_1217277_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_088793343.1|1218178_1219290_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_021037230.1|1220055_1220301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572649.1|1224573_1225278_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_021165388.1|1225415_1226237_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031286440.1|1226299_1227670_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	55.7	1.1e-140
WP_021165386.1|1227714_1229322_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101913726.1|1229323_1230037_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011676167.1|1230008_1231181_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_021165385.1|1231208_1232465_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021165384.1|1232619_1234284_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_021165383.1|1234390_1235536_-	MFS transporter	NA	NA	NA	NA	NA
WP_014572641.1|1235643_1236042_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081146249.1|1236358_1237249_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165379.1|1238366_1240370_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	3.2e-80
WP_021165378.1|1240688_1241180_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_081146251.1|1241454_1242135_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	82.7	1.6e-108
WP_064305175.1|1242649_1243540_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_116368857.1|1243564_1245271_+	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_011676155.1|1245267_1246059_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_003331414.1|1246290_1247049_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|1247060_1248284_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
>prophage 7
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	1278831	1423601	2379714	tRNA,lysis,transposase,protease	Bacillus_phage(36.36%)	113	NA	NA
WP_021165348.1|1278831_1280178_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014572599.1|1280227_1281298_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_021165347.1|1281924_1282632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572597.1|1282810_1282957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061777907.1|1284210_1285128_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_011676292.1|1285803_1286136_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011676291.1|1286298_1287366_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.5	1.2e-54
WP_088793343.1|1287768_1288879_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_021214324.1|1289296_1290154_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_011676180.1|1290143_1292417_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014572659.1|1292576_1293230_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_021165342.1|1293322_1296055_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	8.6e-44
WP_021165341.1|1296529_1297816_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011676184.1|1297805_1298045_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_021165340.1|1298080_1299304_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	2.4e-22
WP_064305173.1|1299303_1300803_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	30.0	3.1e-40
WP_021212171.1|1300827_1300959_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_015082476.1|1301141_1301798_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_021165339.1|1302604_1303357_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_081146255.1|1303987_1304878_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165334.1|1305357_1307454_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.4	8.2e-63
WP_064305172.1|1308220_1308901_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.4	7.4e-106
WP_081146257.1|1309174_1310065_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676191.1|1311376_1312213_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_031286423.1|1312209_1313769_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_031286422.1|1313774_1314152_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676194.1|1314601_1314967_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011676195.1|1315036_1315552_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_011676196.1|1315805_1316231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676197.1|1316478_1316667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676198.1|1316680_1317439_-	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	26.6	3.7e-05
WP_021165329.1|1317557_1319342_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	3.0e-45
WP_021165328.1|1319325_1321143_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.4	1.1e-44
WP_021165327.1|1321280_1322531_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014572677.1|1322544_1323135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835093.1|1324086_1324707_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_011676202.1|1325056_1325776_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_021165324.1|1325762_1326329_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.5	2.8e-13
WP_021165323.1|1326321_1327050_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.5	3.4e-08
WP_014572682.1|1327080_1327797_-	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_011676206.1|1327774_1328236_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011676207.1|1328266_1328770_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014572683.1|1328808_1329414_-	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_011676209.1|1329414_1330230_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003130191.1|1330405_1330645_-	YneF family protein	NA	NA	NA	NA	NA
WP_021165322.1|1330795_1332055_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014572686.1|1332169_1333609_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_021214332.1|1333608_1338078_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_021165321.1|1338246_1338858_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011676214.1|1338890_1339913_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_021165320.1|1340073_1340829_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_021165319.1|1342313_1343825_-	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_014572692.1|1343867_1344758_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675659.1|1345235_1346126_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_031286419.1|1346359_1347136_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	5.6e-25
WP_021165316.1|1347248_1348097_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_116368862.1|1348466_1349578_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.7	1.4e-48
WP_021165399.1|1349598_1350099_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021165400.1|1350197_1351310_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_064305170.1|1351404_1352295_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011835073.1|1352661_1353423_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_021165403.1|1353415_1354801_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_064305169.1|1354869_1356597_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_021165404.1|1358826_1359453_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011676233.1|1359468_1360602_-	endoglucanase	NA	NA	NA	NA	NA
WP_011676308.1|1360603_1361458_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081146255.1|1364589_1365480_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165412.1|1365681_1366629_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021165413.1|1366628_1367468_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_011676313.1|1367474_1368188_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.5e-16
WP_011676314.1|1368477_1368891_+	glyoxalase	NA	NA	NA	NA	NA
WP_021165414.1|1368969_1369200_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_021165415.1|1369451_1372592_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_021165416.1|1372594_1373767_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_021165417.1|1373912_1374851_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011676319.1|1375048_1375423_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_116368864.1|1376259_1377370_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.8e-49
WP_011676322.1|1380794_1381238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165422.1|1381542_1383165_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	32.1	7.2e-06
WP_021165423.1|1383206_1384022_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014572714.1|1384203_1385724_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	4.8e-20
WP_014572715.1|1385716_1386811_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165425.1|1386807_1387761_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_162494587.1|1387876_1388857_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_021165427.1|1388971_1390480_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_021165428.1|1390567_1391590_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_021165429.1|1391977_1393126_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011676330.1|1393296_1394475_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.8	1.5e-37
WP_021165430.1|1394616_1395243_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_011835022.1|1395432_1396461_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_064305168.1|1396502_1397444_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	1.1e-78
WP_011676334.1|1397514_1397922_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_011676335.1|1397918_1398449_+	heptaprenyl diphosphate synthase subunit I	NA	NA	NA	NA	NA
WP_021165432.1|1398439_1399399_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_014572720.1|1399395_1400112_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_021165433.1|1400120_1400579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676339.1|1400580_1401294_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_064305167.1|1401423_1402359_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014572723.1|1402589_1403378_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_064305166.1|1403627_1404992_-	MFS transporter	NA	NA	NA	NA	NA
WP_021165435.1|1405188_1405905_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116368866.1|1406656_1407767_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.8	4.2e-50
WP_021165438.1|1408638_1409379_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011676346.1|1409379_1409925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165439.1|1409921_1410758_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_021165440.1|1410757_1411711_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_021165442.1|1413180_1414110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064305165.1|1415313_1416525_+	virion core protein	NA	NA	NA	NA	NA
WP_021165446.1|1416738_1417890_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_011676353.1|1417886_1418672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676354.1|1418706_1419240_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_014572735.1|1419539_1421057_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_116368868.1|1422489_1423601_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.7e-49
>prophage 8
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	1545844	1627456	2379714	integrase,tRNA,bacteriocin,transposase	Lactococcus_phage(61.29%)	73	1588512:1588530	1636425:1636443
WP_021165518.1|1545844_1546882_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015082639.1|1546953_1547556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011834866.1|1547802_1549116_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_021165519.1|1549265_1550432_-	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_011676626.1|1550432_1551506_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_021165520.1|1551748_1553098_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011676628.1|1553266_1553608_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_015082643.1|1553692_1554934_-	ammonium transporter	NA	NA	NA	NA	NA
WP_063283897.1|1555119_1556592_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.2	5.1e-27
WP_011676631.1|1556604_1557297_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	5.3e-35
WP_011834860.1|1557453_1557984_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_011676633.1|1558116_1558362_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021165524.1|1560288_1561125_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_021165525.1|1561236_1561641_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	47.4	9.7e-29
WP_021165526.1|1562386_1562689_-	MazG-like protein	NA	NA	NA	NA	NA
WP_116368862.1|1563244_1564356_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.7	1.4e-48
WP_021165529.1|1564542_1565193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165530.1|1565300_1566071_+	hypothetical protein	NA	Q38326	Lactococcus_phage	74.4	4.2e-65
WP_095559415.1|1566257_1567404_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
WP_011676639.1|1568969_1570043_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.5e-60
WP_011676640.1|1570130_1571063_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.5	1.3e-23
WP_153927095.1|1571121_1571265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165532.1|1571311_1572604_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	37.0	5.8e-59
WP_011676642.1|1572703_1573225_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_021165533.1|1573500_1574199_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_011676644.1|1574303_1574603_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021165534.1|1574592_1575510_+	cation transporter	NA	NA	NA	NA	NA
WP_021165535.1|1575747_1576989_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	3.4e-109
WP_031286486.1|1577099_1577906_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	1.1e-39
WP_116368877.1|1578077_1579523_-	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_015082654.1|1579519_1579762_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_015082655.1|1579877_1580204_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_021165538.1|1580190_1580895_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_021165539.1|1581746_1582289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011676655.1|1582322_1583879_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_021165540.1|1583957_1586684_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011834838.1|1586732_1588445_-	ribonuclease J	NA	NA	NA	NA	NA
1588512:1588530	attL	AAATTCTGTCAGTAAATTT	NA	NA	NA	NA
WP_021165542.1|1588794_1589466_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.0	4.3e-21
WP_011676659.1|1589505_1590399_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011676660.1|1590727_1591183_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	38.9	1.0e-26
WP_021165543.1|1591192_1592269_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015082666.1|1593575_1593827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165544.1|1593994_1595971_-	transketolase	NA	NA	NA	NA	NA
WP_021165545.1|1596138_1597539_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_021165546.1|1597591_1597891_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_032950333.1|1597892_1599833_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_011676669.1|1600007_1600649_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_081146266.1|1603969_1605496_-	MFS transporter	NA	NA	NA	NA	NA
WP_021165547.1|1605681_1606758_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_011676494.1|1608932_1609613_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021165548.1|1609677_1611108_-	MFS transporter	NA	NA	NA	NA	NA
WP_011834820.1|1611466_1611772_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_021165549.1|1611776_1612001_-|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_081146268.1|1612225_1613116_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676499.1|1613097_1613298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064305201.1|1614525_1615815_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1P8BLG2	Lactococcus_phage	97.7	5.1e-241
WP_064305106.1|1616073_1617297_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
WP_003331414.1|1617308_1618067_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_021165554.1|1618370_1618790_-	hypothetical protein	NA	A0A1P8BKW0	Lactococcus_phage	100.0	6.0e-74
WP_021165556.1|1618952_1619843_-	ATP-binding protein	NA	R9QM21	Lactococcus_phage	99.3	3.0e-163
WP_021165557.1|1619852_1620659_-	replication protein	NA	A0A1P8BL25	Lactococcus_phage	97.2	1.7e-56
WP_021214223.1|1620786_1621212_-	single-stranded DNA-binding protein	NA	Q9AZV6	Lactococcus_phage	97.2	1.5e-72
WP_064305202.1|1621204_1621963_-	hypothetical protein	NA	Q0ILF6	Lactococcus_phage	96.8	1.7e-143
WP_064305203.1|1621971_1622370_-	hypothetical protein	NA	A0A1X9IGE4	Lactococcus_phage	64.9	9.8e-42
WP_021165561.1|1622467_1622704_-	DUF1408 domain-containing protein	NA	A5GYQ9	Lactococcus_phage	97.4	1.8e-38
WP_011834777.1|1622806_1623085_+	hypothetical protein	NA	A0A059NT68	Lactococcus_phage	100.0	1.1e-47
WP_011834776.1|1623039_1623273_-	hypothetical protein	NA	A0A059NT46	Lactococcus_phage	100.0	1.8e-35
WP_011834775.1|1623426_1623663_-	helix-turn-helix domain-containing protein	NA	A0A059NT59	Lactococcus_phage	100.0	4.3e-37
WP_021165562.1|1623675_1624401_-	antirepressor	NA	A0A1P8BKW5	Lactococcus_phage	100.0	1.5e-133
WP_021165563.1|1624414_1624654_-	helix-turn-helix transcriptional regulator	NA	A0A1P8BKU7	Lactococcus_phage	94.9	9.1e-35
WP_021165564.1|1624994_1625198_-	putative transcriptional regulator	NA	A0A1B1IMU6	Lactococcus_phage	93.1	4.0e-23
WP_021165565.1|1625460_1626273_+	helix-turn-helix domain-containing protein	NA	A0A1B1IMP5	Lactococcus_phage	72.2	3.0e-106
WP_021165566.1|1626322_1627456_+|integrase	site-specific integrase	integrase	A0A059NT56	Lactococcus_phage	98.4	1.6e-201
1636425:1636443	attR	AAATTCTGTCAGTAAATTT	NA	NA	NA	NA
>prophage 9
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	1856075	1969714	2379714	transposase,protease,integrase,bacteriocin,terminase,head,tRNA,capsid,portal	Lactococcus_phage(44.68%)	113	1911095:1911121	1936343:1936369
WP_011676874.1|1856075_1858874_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.1	1.9e-83
WP_021165703.1|1859323_1860259_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_011676876.1|1860315_1861107_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_011676877.1|1861103_1861379_-	YggT family protein	NA	NA	NA	NA	NA
WP_021165704.1|1861378_1861969_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_021165705.1|1862002_1862680_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_021213780.1|1862683_1863937_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_011835775.1|1863966_1865337_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_021165708.1|1865499_1866369_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	8.5e-14
WP_021165709.1|1866485_1867214_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	A0A2D1A6G0	Rhodococcus_phage	27.7	4.6e-05
WP_081146280.1|1867406_1868297_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572095.1|1868373_1869486_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_021165712.1|1869623_1870469_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	33.3	6.8e-32
WP_021165713.1|1870480_1871806_-	MFS transporter	NA	NA	NA	NA	NA
WP_031286544.1|1873297_1874608_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	31.3	6.3e-61
WP_011676890.1|1874736_1875411_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014572089.1|1875428_1875932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676892.1|1876068_1876749_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_021165715.1|1876776_1877055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835788.1|1877047_1877632_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021165716.1|1877733_1879110_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	35.7	5.5e-31
WP_021165717.1|1879327_1880119_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.2	2.4e-31
WP_010906184.1|1880202_1880472_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_064305221.1|1880642_1882520_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	32.4	5.7e-23
WP_011676898.1|1882519_1883296_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_021165718.1|1883418_1884693_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_031286545.1|1885208_1886147_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	50.6	7.9e-82
WP_064305170.1|1887131_1888022_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015081734.1|1890254_1891085_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	39.8	6.2e-46
WP_064305222.1|1891257_1891485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064305223.1|1891583_1892264_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	85.0	6.5e-110
WP_021166223.1|1892260_1893298_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_021166069.1|1893969_1894914_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_010890681.1|1894939_1895320_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_003331414.1|1895718_1896477_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_064305106.1|1896488_1897712_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
WP_010890679.1|1897961_1898228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081778.1|1898241_1899039_-	AAA family ATPase	NA	E2ELL2	Clostridium_phage	38.3	1.8e-18
WP_015081779.1|1899182_1899740_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.1	2.9e-31
WP_031286701.1|1899946_1900297_-	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	73.2	3.0e-10
WP_015081780.1|1900286_1901753_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	51.3	6.5e-123
WP_015081781.1|1902001_1902637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021166190.1|1902741_1904583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081783.1|1904851_1905100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931940.1|1905515_1907663_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	3.5e-40
WP_081146283.1|1907677_1909102_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015081786.1|1909175_1909403_+|bacteriocin	lactococcin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_064305224.1|1909417_1909714_+	lactococcin-A immunity protein	NA	NA	NA	NA	NA
WP_015081788.1|1909988_1910195_+|bacteriocin	lactococcin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_032488552.1|1910221_1910497_+	lactococcin-B immunity protein	NA	NA	NA	NA	NA
1911095:1911121	attL	TCATTTTGTGTCTAAATATTTGACATT	NA	NA	NA	NA
WP_021166195.1|1911277_1911442_+|bacteriocin	lactococcin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015081789.1|1911644_1912097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021166196.1|1912135_1912792_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021166197.1|1912891_1913173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166198.1|1913174_1913402_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_064305225.1|1913754_1915074_+|transposase	IS4-like element IS1675 family transposase	transposase	NA	NA	NA	NA
WP_021166199.1|1915331_1915433_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_021211273.1|1915581_1915806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166201.1|1915892_1916786_-|transposase	IS982-like element ISLgar3 family transposase	transposase	NA	NA	NA	NA
WP_021166203.1|1917286_1918462_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	1.4e-32
WP_015081792.1|1919190_1919655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081793.1|1919673_1919907_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015081794.1|1919932_1920142_-|bacteriocin	lactococcin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015081785.1|1920215_1921640_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015081795.1|1924219_1925398_-	protein kinase family protein	NA	A0A2K9L5D2	Tupanvirus	29.5	4.4e-13
WP_015081796.1|1925488_1926046_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	1.1e-33
WP_047685904.1|1926215_1926452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081749.1|1926441_1929501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081750.1|1929518_1929989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081751.1|1930152_1930743_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_161486482.1|1930955_1931912_-	Abi family protein	NA	NA	NA	NA	NA
WP_021166207.1|1932361_1933042_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	4.3e-114
WP_015081754.1|1933287_1933590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021721729.1|1934315_1934699_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6C6	Streptococcus_phage	56.1	2.7e-52
WP_015081755.1|1934980_1935679_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015081756.1|1936046_1936328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021166211.1|1936868_1937699_-	hypothetical protein	NA	NA	NA	NA	NA
1936343:1936369	attR	AATGTCAAATATTTAGACACAAAATGA	NA	NA	NA	NA
WP_021166213.1|1939821_1940709_-	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_010891372.1|1940807_1941488_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	85.4	9.1e-112
WP_021213928.1|1941608_1942676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010890684.1|1942678_1942888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081146285.1|1942890_1943778_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.2	1.3e-62
WP_064305107.1|1943870_1944629_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	99.6	2.6e-136
WP_064305106.1|1944640_1945864_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
WP_081146287.1|1945926_1947237_-	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	54.7	1.8e-52
WP_081146288.1|1947252_1948089_-	protein TrsL	NA	NA	NA	NA	NA
WP_010890665.1|1948103_1948499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166218.1|1948513_1950106_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_010890634.1|1950102_1950561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116368900.1|1950557_1950887_-	thioredoxin	NA	NA	NA	NA	NA
WP_021166220.1|1950915_1951533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010890632.1|1951545_1952703_-	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	31.2	1.7e-22
WP_021213922.1|1952704_1952998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064305223.1|1953058_1953739_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	85.0	6.5e-110
WP_081146292.1|1953984_1956183_-	tape measure protein	NA	Q9AZL5	Lactococcus_phage	91.2	1.3e-289
WP_021166226.1|1956164_1956335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166227.1|1956352_1956697_-	hypothetical protein	NA	Q9AZL6	Lactococcus_phage	98.2	1.6e-27
WP_063283916.1|1956756_1957362_-	hypothetical protein	NA	Q9AZL7	Lactococcus_phage	95.0	1.4e-103
WP_010905383.1|1957363_1957759_-	DUF806 family protein	NA	Q9AZL8	Lactococcus_phage	100.0	1.4e-67
WP_031286725.1|1957755_1958241_-	HK97 gp10 family phage protein	NA	Q9AZL9	Lactococcus_phage	97.5	1.8e-82
WP_081146293.1|1958237_1958573_-|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	93.7	1.5e-51
WP_021166230.1|1958559_1958865_-	hypothetical protein	NA	Q9AZM1	Lactococcus_phage	97.0	2.9e-49
WP_021166231.1|1958875_1960189_-|capsid	phage major capsid protein	capsid	Q9AZM2	Lactococcus_phage	92.0	6.1e-189
WP_021166232.1|1960178_1960766_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	98.5	8.4e-106
WP_021166233.1|1960765_1961845_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	98.9	6.5e-197
WP_021166234.1|1962014_1963826_-|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	98.3	0.0e+00
WP_014573149.1|1963825_1964278_-|terminase	phage terminase small subunit P27 family	terminase	Q9AZM7	Lactococcus_phage	99.3	6.5e-82
WP_021166235.1|1964393_1964897_-	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	98.8	5.9e-92
WP_014573151.1|1965130_1965553_-	DUF722 domain-containing protein	NA	Q9AYX5	Lactococcus_phage	100.0	5.5e-75
WP_088793343.1|1965632_1966744_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_021165101.1|1966823_1967159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003331414.1|1967720_1968479_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_064305106.1|1968490_1969714_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
>prophage 10
NZ_CP015909	Lactococcus lactis subsp. cremoris strain JM4 chromosome, complete genome	2379714	2070305	2136231	2379714	transposase,protease,integrase,head,tRNA	Lactococcus_phage(65.52%)	69	2107974:2107991	2136452:2136469
WP_021165062.1|2070305_2070626_-	sigma-70 family RNA polymerase sigma factor	NA	Q9AZD9	Lactococcus_phage	94.3	8.7e-49
WP_021165061.1|2070726_2071056_-	hypothetical protein	NA	Q9AZE0	Lactococcus_phage	98.2	2.3e-52
WP_021165060.1|2071269_2071860_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZE1	Lactococcus_phage	97.4	1.9e-105
WP_021165059.1|2071868_2072477_-	hypothetical protein	NA	Q9AZE2	Lactococcus_phage	79.7	1.3e-77
WP_021165058.1|2072502_2072685_-	hypothetical protein	NA	Q9AZE3	Lactococcus_phage	91.4	1.4e-22
WP_021165057.1|2072891_2074526_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	92.6	5.8e-298
WP_021165056.1|2074536_2075331_-	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	90.5	2.3e-143
WP_021165055.1|2075327_2075663_-	HTH domain-containing protein	NA	Q9AZI7	Lactococcus_phage	89.8	1.7e-50
WP_021165054.1|2075659_2075974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165053.1|2075970_2076225_-	hypothetical protein	NA	Q9AZE9	Lactococcus_phage	86.7	1.3e-34
WP_021165052.1|2076221_2076461_-	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	97.5	1.0e-38
WP_021165051.1|2076503_2076785_-	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	93.5	3.0e-45
WP_021165050.1|2076777_2077302_-	hypothetical protein	NA	Q9AZJ3	Lactococcus_phage	77.2	1.5e-69
WP_021165049.1|2077298_2077496_-	DUF1655 domain-containing protein	NA	Q9AZF2	Lactococcus_phage	95.1	1.4e-25
WP_021165048.1|2077510_2077732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165047.1|2077920_2078094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165046.1|2078356_2079046_-	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	78.7	1.3e-89
WP_021165045.1|2079151_2079367_-	hypothetical protein	NA	A5GZ66	Lactococcus_phage	47.0	4.8e-11
WP_021165044.1|2079491_2079968_+	helix-turn-helix transcriptional regulator	NA	A5GZ65	Lactococcus_phage	58.2	8.8e-13
WP_031286289.1|2080092_2080350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165042.1|2080619_2081132_+	hypothetical protein	NA	A3QSC6	Clostridium_virus	33.6	8.0e-20
WP_021165040.1|2082400_2083549_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.7	2.0e-26
WP_021165039.1|2083945_2085127_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	45.7	1.2e-90
WP_021165038.1|2085339_2085966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165037.1|2085998_2087018_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011677068.1|2087010_2087781_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	4.9e-29
WP_011677070.1|2089871_2090270_+	HIT family protein	NA	NA	NA	NA	NA
WP_011677071.1|2090284_2090506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165036.1|2090517_2090862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677073.1|2090939_2091629_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011677074.1|2092015_2092441_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_021165035.1|2092576_2093341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165034.1|2093340_2094219_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.4	2.5e-05
WP_021165033.1|2094529_2095051_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_064305150.1|2095225_2096083_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011677080.1|2096127_2096586_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011677081.1|2096670_2097228_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004254608.1|2097383_2098100_-	UMP kinase	NA	NA	NA	NA	NA
WP_064305149.1|2098184_2098637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573258.1|2098766_2099954_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677084.1|2100112_2101300_-	acetate kinase	NA	NA	NA	NA	NA
WP_021165031.1|2101491_2102430_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677086.1|2102517_2102769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031286284.1|2102869_2104702_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	9.2e-18
WP_081146303.1|2105218_2106331_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.7	2.3e-48
WP_064305146.1|2107080_2107971_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
2107974:2107991	attL	AACTAGCAATTCGGGTAT	NA	NA	NA	NA
WP_021165027.1|2108031_2108490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573264.1|2108504_2109119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031286281.1|2109458_2110187_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011677095.1|2110379_2110601_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_021165026.1|2110634_2111606_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_011677097.1|2111608_2111995_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011677098.1|2112110_2112557_-	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	33.6	2.5e-17
WP_014573269.1|2112722_2113388_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_021165025.1|2113338_2114433_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011677102.1|2114508_2115000_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_011677103.1|2115075_2116569_-	amino acid permease	NA	NA	NA	NA	NA
WP_021165024.1|2116758_2117889_-	aminotransferase	NA	NA	NA	NA	NA
WP_021037905.1|2118152_2119097_-	carbamate kinase	NA	NA	NA	NA	NA
WP_021165021.1|2121798_2122863_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011677109.1|2124562_2126257_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
WP_004254487.1|2126324_2126783_+	arginine repressor	NA	NA	NA	NA	NA
WP_021165020.1|2126942_2128274_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_021165019.1|2128474_2129074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677113.1|2129290_2132395_-	DEAD/DEAH box helicase family protein	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_021165018.1|2132591_2133212_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081146305.1|2133294_2133975_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_003331414.1|2134237_2134996_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|2135007_2136231_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
2136452:2136469	attR	ATACCCGAATTGCTAGTT	NA	NA	NA	NA
>prophage 1
NZ_CP016729	Lactococcus lactis subsp. cremoris strain JM4 plasmid pJM4A, complete sequence	60219	3149	14295	60219	transposase	Lactococcus_phage(60.0%)	10	NA	NA
WP_014573540.1|3149_3908_+	AAA family ATPase	NA	H7BUL8	unidentified_phage	28.4	1.6e-16
WP_014573539.1|3911_4640_+	ParB N-terminal domain-containing protein	NA	Q4ZC37	Staphylococcus_virus	27.7	7.2e-06
WP_014011586.1|4669_5020_-	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	75.6	2.3e-10
WP_021214063.1|5009_6476_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	51.3	7.7e-124
WP_064305107.1|8545_9304_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	99.6	2.6e-136
WP_064305106.1|9315_10539_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	5.4e-232
WP_011669085.1|11674_11875_+	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	53.8	2.2e-05
WP_003132324.1|12005_12206_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	1.6e-13
WP_011669084.1|12482_12683_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	97.0	9.6e-30
WP_095559415.1|13148_14295_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
