The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020554	Parasaccharibacter apium strain G7_7_3c, complete genome	2011634	66960	73015	2011634		Enterobacteria_phage(33.33%)	6	NA	NA
WP_081563323.1|66960_67758_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	35.8	2.0e-17
WP_081562404.1|67837_68728_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	32.2	2.9e-25
WP_081562405.1|68773_69334_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.2	2.3e-36
WP_043559436.1|69411_70326_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	54.5	1.3e-81
WP_043559038.1|70331_71387_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	4.1e-95
WP_081562406.1|71602_73015_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.6	1.1e-47
>prophage 2
NZ_CP020554	Parasaccharibacter apium strain G7_7_3c, complete genome	2011634	688747	728093	2011634	tRNA,integrase,tail,plate,terminase	Enterobacter_phage(27.27%)	50	698209:698268	729904:729977
WP_081562715.1|688747_689812_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_156878870.1|689853_691002_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	50.6	3.9e-91
WP_081563401.1|691011_692103_-	purine nucleoside permease	NA	NA	NA	NA	NA
WP_156878871.1|692141_693344_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_043558252.1|693794_694049_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043558249.1|694136_694970_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_081563402.1|694985_696578_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	4.7e-26
WP_081562718.1|696721_697840_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_081562719.1|697882_698089_+	hypothetical protein	NA	NA	NA	NA	NA
698209:698268	attL	CGGTTTTGTAAACCGAAGGCCGGGAGTTCGAATCTCTCATCCGGCACCACGATTTTCCCT	NA	NA	NA	NA
WP_081562720.1|698373_699363_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081562721.1|699212_699533_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081563403.1|699529_700471_-	DNA cytosine methyltransferase	NA	A0A2D2W4U1	Escherichia_phage	56.5	6.9e-86
WP_156878813.1|700539_700746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562723.1|701004_701262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878814.1|701434_702340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878815.1|702428_702848_-	hypothetical protein	NA	A0A291AUK0	Sinorhizobium_phage	32.6	1.4e-09
WP_081562726.1|703213_703417_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156878816.1|703472_703703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562728.1|703723_703972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878817.1|704334_705111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562731.1|705245_705479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562732.1|705475_705817_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_081562733.1|705813_706503_+	hypothetical protein	NA	A0A0U4J8Z7	Pseudomonas_phage	39.1	1.5e-29
WP_081562734.1|706499_707522_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	49.6	2.9e-29
WP_081562735.1|707679_707937_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	52.0	1.7e-15
WP_156878818.1|707912_709097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562736.1|709166_709514_+	hypothetical protein	NA	A0A193GYY8	Enterobacter_phage	53.6	2.5e-25
WP_081562738.1|709510_710413_+	hypothetical protein	NA	D5LGZ3	Escherichia_phage	50.9	2.8e-76
WP_156878819.1|710405_711740_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.8	1.2e-27
WP_081562740.1|711741_712143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562742.1|712256_712604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562744.1|712600_712912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156878820.1|713268_713799_+|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	48.0	7.2e-32
WP_156878872.1|713773_715786_+|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	58.8	2.5e-210
WP_156878821.1|715983_716421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562751.1|716407_716599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156878822.1|716852_717953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562754.1|718029_719478_+	hypothetical protein	NA	A0A193GYC3	Enterobacter_phage	42.9	5.5e-82
WP_081562755.1|719477_719984_+|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	47.6	1.8e-35
WP_081562756.1|719995_720301_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_156878823.1|720444_723000_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	29.9	2.1e-68
WP_081562758.1|722999_723761_+	hypothetical protein	NA	A0A0M3LQ18	Mannheimia_phage	33.6	5.9e-11
WP_081562759.1|723757_723979_+|tail	phage tail protein	tail	A0A0F7LCK1	Escherichia_phage	50.0	5.7e-07
WP_081562760.1|723969_725043_+	hypothetical protein	NA	V5YTN9	Pseudomonas_phage	44.5	3.3e-68
WP_081562762.1|725116_725599_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	42.4	3.4e-20
WP_081562764.1|725598_725925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562765.1|725926_726496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081562766.1|726492_727023_+	hypothetical protein	NA	A0A193GYB4	Enterobacter_phage	33.9	9.5e-16
WP_081562767.1|726994_727552_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	39.6	9.6e-19
WP_081562768.1|727616_728093_+	lysozyme	NA	A0A1B1P9G1	Acinetobacter_phage	42.0	8.2e-19
729904:729977	attR	CGGTTTTGTAAACCGAAGGCCGGGAGTTCGAATCTCTCATCCGGCACCACGATTTTCCCTGAAAATAGGCCGTT	NA	NA	NA	NA
>prophage 3
NZ_CP020554	Parasaccharibacter apium strain G7_7_3c, complete genome	2011634	1356279	1363177	2011634	tRNA	Prochlorococcus_phage(50.0%)	9	NA	NA
WP_081563020.1|1356279_1357770_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	39.7	6.6e-22
WP_081563021.1|1358025_1358844_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.4	7.2e-23
WP_043560635.1|1358857_1359649_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_081563022.1|1359641_1360574_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	33.0	2.6e-08
WP_052349200.1|1360577_1361129_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.0e-24
WP_043560630.1|1361311_1361827_+	Hsp20 family protein	NA	E3SM62	Prochlorococcus_phage	32.8	4.3e-13
WP_081563455.1|1361867_1362077_+	DUF1150 family protein	NA	NA	NA	NA	NA
WP_156878840.1|1362123_1362360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043560625.1|1362430_1363177_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	3.6e-21
