The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	321097	367153	2919834	transposase,protease,tRNA,integrase	Bacillus_phage(16.67%)	38	342260:342275	368875:368890
WP_037468657.1|321097_322624_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	34.3	4.3e-77
WP_037468659.1|322706_324008_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.2	2.2e-42
WP_037468662.1|324085_324652_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_037468743.1|324825_325014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037468744.1|325040_325166_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_037468665.1|325491_327720_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_037468666.1|327823_328849_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_037468669.1|328858_329548_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_037468672.1|329550_330312_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_037468674.1|330316_331771_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_037468675.1|331849_332332_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.4	1.9e-23
WP_037468676.1|332467_333028_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_037468677.1|333209_334619_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.8	8.9e-45
WP_037468678.1|334763_337112_+	histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	2.0e-17
WP_037468679.1|337104_337563_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_037468745.1|337559_338546_+	phosphotransferase	NA	NA	NA	NA	NA
WP_037468681.1|338542_339253_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_037468683.1|339245_342218_+	double-strand break repair protein AddB	NA	NA	NA	NA	NA
WP_037468685.1|342198_345642_+	double-strand break repair helicase AddA	NA	G3MA40	Bacillus_virus	20.5	8.1e-07
342260:342275	attL	TTGCCGCCGCGCCCGA	NA	NA	NA	NA
WP_037468686.1|345671_345992_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	54.1	7.4e-24
WP_037468687.1|346074_346872_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_037468688.1|346871_348098_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_037468690.1|348259_350992_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_037468692.1|351204_351630_-	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_037468694.1|351914_352154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037468696.1|352487_353534_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_037468698.1|353648_354812_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.8	2.3e-46
WP_037468699.1|354808_355435_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.5	3.4e-20
WP_037468701.1|355431_356403_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_037468702.1|356447_358010_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.9	3.3e-93
WP_037468704.1|358014_358803_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_037468706.1|358799_359585_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_037468707.1|359589_360219_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_037468708.1|360215_361517_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	7.9e-48
WP_037468710.1|361718_362198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037468711.1|362194_364321_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_051908565.1|364311_365526_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	29.3	5.7e-08
WP_037463831.1|365734_367153_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
368875:368890	attR	TTGCCGCCGCGCCCGA	NA	NA	NA	NA
>prophage 2
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	1316785	1325702	2919834	tRNA	Bacillus_virus(14.29%)	9	NA	NA
WP_037464633.1|1316785_1317598_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.3	2.3e-29
WP_037464632.1|1317749_1318481_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_037464630.1|1318547_1320089_+	2-polyprenylphenol 6-hydroxylase	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	28.3	3.6e-31
WP_037464629.1|1320085_1321333_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	5.8e-40
WP_037464628.1|1321307_1321772_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	53.0	2.1e-35
WP_037465196.1|1321783_1322551_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	25.7	8.3e-05
WP_037464627.1|1322538_1322904_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_037464626.1|1323059_1325042_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.7	6.1e-116
WP_037464624.1|1325168_1325702_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.6	4.3e-16
>prophage 3
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	1529550	1575166	2919834	transposase,protease,integrase	Caulobacter_phage(20.0%)	37	1568646:1568661	1575049:1575064
WP_062793187.1|1529550_1530432_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_037467526.1|1530535_1531786_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_037467528.1|1531782_1533225_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_037467546.1|1533221_1533959_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	7.5e-19
WP_037467529.1|1534110_1536303_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_037467530.1|1536320_1538132_+	carboxypeptidase	NA	NA	NA	NA	NA
WP_037467531.1|1538265_1538898_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	7.8e-09
WP_157704812.1|1539549_1540134_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081570333.1|1540154_1542716_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_037467537.1|1542802_1543618_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_051908394.1|1543657_1544536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157704824.1|1544348_1547606_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_081570334.1|1547602_1547896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037467955.1|1547932_1548556_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_037467957.1|1548563_1549193_-	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_037467959.1|1549194_1549497_-	YciI family protein	NA	NA	NA	NA	NA
WP_006473457.1|1549766_1551122_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_037467868.1|1551758_1552361_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081570335.1|1552512_1554303_+	arylsulfatase	NA	NA	NA	NA	NA
WP_156103390.1|1554745_1555816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157704813.1|1556023_1557232_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_037467864.1|1557231_1557771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467863.1|1557936_1560504_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_051908430.1|1560654_1561239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467862.1|1562015_1562936_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_037467871.1|1563195_1563645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570337.1|1563641_1564049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570338.1|1564395_1565148_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	47.4	4.7e-53
WP_015449377.1|1565304_1566654_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015449375.1|1568436_1570650_+|integrase	phage integrase	integrase	NA	NA	NA	NA
1568646:1568661	attL	GACGATGCGCGCCTAT	NA	NA	NA	NA
WP_015449374.1|1570699_1571602_+	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	34.7	6.1e-31
WP_037467876.1|1571598_1571865_+	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	59.6	1.9e-09
WP_037467877.1|1571966_1572308_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_081570448.1|1572300_1572657_-	hypothetical protein	NA	O64357	Escherichia_phage	40.0	8.6e-05
WP_081570339.1|1572701_1574084_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	31.3	8.5e-24
WP_037467880.1|1574351_1574894_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	51.4	4.0e-46
WP_037467881.1|1574893_1575166_+	hypothetical protein	NA	R4JN18	Pseudoalteromonas_phage	47.1	1.0e-10
1575049:1575064	attR	GACGATGCGCGCCTAT	NA	NA	NA	NA
>prophage 4
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	1663943	1723246	2919834	transposase,integrase	Gordonia_phage(28.57%)	52	1678361:1678378	1723738:1723755
WP_006473457.1|1663943_1665299_+|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_037467959.1|1665568_1665871_+	YciI family protein	NA	NA	NA	NA	NA
WP_037467957.1|1665872_1666502_+	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_037467955.1|1666509_1667133_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_081570344.1|1667169_1667517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037466191.1|1667652_1667862_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_037466189.1|1667893_1669399_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	36.5	1.0e-38
WP_037466218.1|1669406_1670684_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_037466216.1|1670746_1671262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037466214.1|1671314_1672271_-	acyltransferase	NA	NA	NA	NA	NA
WP_037466187.1|1672386_1673184_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_037466184.1|1673170_1674517_-	modulator protein	NA	NA	NA	NA	NA
WP_037466182.1|1674557_1675478_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_037466179.1|1675464_1676535_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_037466177.1|1676561_1677104_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_037466212.1|1677184_1677856_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_037466175.1|1677903_1678638_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
1678361:1678378	attL	AGCAGCTGATGAGCGCGC	NA	NA	NA	NA
WP_037466173.1|1678733_1682174_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_037466171.1|1682210_1683659_-	phospholipase D	NA	NA	NA	NA	NA
WP_037466170.1|1683655_1684558_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_037466210.1|1684654_1685401_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_037466169.1|1685498_1686872_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_037466167.1|1686875_1688174_-	protein-S-isoprenylcysteine methyltransferase	NA	NA	NA	NA	NA
WP_037466166.1|1688317_1688926_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_037466160.1|1691858_1692260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037466158.1|1692310_1693033_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_037466208.1|1693037_1693472_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_037466157.1|1693574_1694279_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_037466156.1|1694286_1695174_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_037466154.1|1695173_1695929_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_037466152.1|1696335_1697565_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	46.3	3.7e-95
WP_156103369.1|1697782_1697944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570346.1|1697974_1699114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037466150.1|1699110_1700673_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	33.1	6.6e-25
WP_037466148.1|1703503_1704343_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_051908267.1|1704386_1704965_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_037466147.1|1704961_1705411_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	43.2	2.7e-24
WP_037466146.1|1705677_1706010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051908266.1|1706367_1708170_+	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	31.2	2.1e-06
WP_051908265.1|1708639_1709398_+	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
WP_021224415.1|1709555_1710905_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_021224414.1|1710901_1712689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037466144.1|1712685_1714848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030538909.1|1715017_1715881_+	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	34.8	6.0e-36
WP_016744720.1|1715884_1716301_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021224336.1|1716375_1716735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021224337.1|1716727_1716952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021224338.1|1716964_1717744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016744716.1|1717725_1719075_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_037466134.1|1719654_1720656_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466136.1|1720652_1722017_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466138.1|1722013_1723246_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1723738:1723755	attR	AGCAGCTGATGAGCGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	2331894	2375538	2919834	head,tRNA,protease,capsid,tail,transposase	Pseudomonas_phage(30.0%)	53	NA	NA
WP_037467805.1|2331894_2332353_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_037467561.1|2332563_2333130_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_037467556.1|2333141_2334461_+	cytochrome b/b6	NA	NA	NA	NA	NA
WP_037467554.1|2334479_2335328_+	cytochrome c1	NA	NA	NA	NA	NA
WP_037467552.1|2335413_2335950_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.0	3.3e-24
WP_037467803.1|2335975_2336605_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_081570376.1|2337279_2337516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570377.1|2337689_2339129_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051908399.1|2339182_2340682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157704816.1|2340620_2341310_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_081570380.1|2341755_2342169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570381.1|2342217_2342526_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_094182604.1|2343074_2344228_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.6	1.6e-47
WP_157704817.1|2344300_2344450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037462655.1|2344449_2345604_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_156103314.1|2345710_2346547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570382.1|2346552_2347377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462654.1|2347407_2348604_-	DUF115 domain-containing protein	NA	NA	NA	NA	NA
WP_051908004.1|2348603_2349302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462651.1|2349375_2350533_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_037462650.1|2350517_2352176_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_037462648.1|2352201_2353320_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	45.0	6.5e-83
WP_037462646.1|2353339_2353993_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.4e-08
WP_037462644.1|2353992_2354802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037462642.1|2354801_2355899_-	capsule polysaccharide export protein	NA	NA	NA	NA	NA
WP_037462639.1|2356458_2357313_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	56.9	6.3e-86
WP_037462638.1|2357478_2357673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570384.1|2357659_2357983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156103313.1|2358008_2358179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570385.1|2358132_2358618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156103312.1|2358614_2358785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462633.1|2358781_2359297_-	TIGR02594 family protein	NA	A0A0S0NA80	Pseudomonas_phage	43.4	2.5e-21
WP_037462631.1|2359358_2359799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462630.1|2359808_2360096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908000.1|2360092_2361397_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	46.0	2.1e-16
WP_037462627.1|2361494_2362235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462625.1|2362234_2362564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051907997.1|2362563_2365335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462623.1|2365334_2365754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462621.1|2365750_2366398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462620.1|2366470_2367067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462617.1|2367066_2369712_-	hypothetical protein	NA	A0A060RJ18	Pseudomonas_phage	49.2	2.5e-08
WP_037462616.1|2369779_2370229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156103310.1|2370236_2370362_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_037462615.1|2370361_2370778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462614.1|2370774_2371206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462610.1|2371244_2371634_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_037462609.1|2371633_2372095_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_051907996.1|2372094_2372466_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_037462607.1|2372465_2373035_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_037462604.1|2373050_2373365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037462603.1|2373426_2374656_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	46.0	1.5e-88
WP_081570387.1|2374722_2375538_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	45.8	5.5e-39
>prophage 6
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	2518760	2558748	2919834	head,protease,capsid,portal,tail,terminase,transposase	Rhizobium_phage(14.29%)	48	NA	NA
WP_006473457.1|2518760_2520116_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_007683600.1|2520274_2520544_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_037464028.1|2520574_2520871_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_037464032.1|2521690_2523325_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_037464207.1|2523394_2525143_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	28.4	4.6e-35
WP_037464035.1|2525392_2526091_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_037464038.1|2526095_2526527_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_037464040.1|2526808_2527345_-	transcription termination/antitermination factor NusG	NA	A0A068C9G5	Rhizobium_phage	27.3	3.0e-09
WP_037464043.1|2527366_2527573_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_037464047.1|2527874_2529098_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_037464050.1|2529094_2530090_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	37.9	5.9e-27
WP_037464053.1|2530171_2530603_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_094182616.1|2530609_2531371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464056.1|2531367_2532282_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_037464058.1|2532342_2533392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570399.1|2533400_2534096_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_156103334.1|2534204_2535251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464214.1|2535272_2535623_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_037464064.1|2535753_2536320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156103335.1|2536576_2536762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037464069.1|2536758_2537415_-	DUF159 family protein	NA	NA	NA	NA	NA
WP_037464073.1|2537490_2537685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062793070.1|2537668_2538205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464078.1|2538201_2538891_-	DUF3380 domain-containing protein	NA	A0A0K1LN56	Caulobacter_phage	47.8	3.6e-47
WP_037464216.1|2538953_2539367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464080.1|2539404_2539689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908166.1|2539685_2540987_-	hypothetical protein	NA	A0A0A0YWB2	Escherichia_phage	33.3	7.0e-20
WP_037464083.1|2541083_2541824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464086.1|2541823_2542153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908168.1|2542152_2544810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464088.1|2544809_2545229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908169.1|2545225_2545873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570400.1|2545943_2546438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464092.1|2546434_2547037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464095.1|2547036_2549565_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	30.5	7.4e-26
WP_037464101.1|2549892_2550180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464102.1|2550176_2550536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464105.1|2550532_2550973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464107.1|2550986_2551379_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_037464110.1|2551379_2551808_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	33.6	1.3e-07
WP_037464113.1|2551807_2552140_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_037464115.1|2552139_2552709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037464119.1|2552708_2553023_-	hypothetical protein	NA	L7TKD2	Rhizobium_phage	42.1	1.2e-05
WP_051908172.1|2553026_2553431_-	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	58.5	6.8e-06
WP_037464231.1|2553514_2554750_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	42.3	1.4e-81
WP_037464123.1|2554895_2555609_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	56.1	1.2e-61
WP_037464125.1|2555611_2556976_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	42.6	8.5e-77
WP_037464127.1|2556975_2558748_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	49.9	5.2e-159
>prophage 7
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	2592815	2647474	2919834	transposase,integrase	Leptospira_phage(10.0%)	39	2613376:2613392	2648997:2649013
WP_094182604.1|2592815_2593968_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.6	1.6e-47
WP_051908327.1|2594109_2595909_-	EAL domain-containing protein	NA	A9J564	Pseudomonas_phage	36.8	1.1e-07
WP_157704821.1|2595895_2596240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570405.1|2596573_2597233_+	response regulator	NA	NA	NA	NA	NA
WP_037467010.1|2598266_2598962_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037467012.1|2598970_2599900_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_037467062.1|2599980_2601777_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_037467015.1|2602682_2604308_+	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	37.4	6.1e-82
WP_037467018.1|2604311_2605169_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_037467021.1|2605165_2605795_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_081570406.1|2605942_2606473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570407.1|2606560_2608906_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_081570408.1|2609237_2610611_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_051908331.1|2611779_2612832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037467031.1|2612925_2613705_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	35.3	3.4e-30
2613376:2613392	attL	GCCGCCGATCAGCACGA	NA	NA	NA	NA
WP_157704822.1|2615777_2616359_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081570411.1|2616577_2616790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094182620.1|2617442_2620025_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_037467044.1|2620305_2622645_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_094182646.1|2622689_2624186_+	hypothetical protein	NA	A0A067XRB1	Caulobacter_phage	26.3	6.6e-06
WP_037467068.1|2624509_2624794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037467050.1|2624924_2627792_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.3	4.1e-20
WP_051908333.1|2627813_2628743_+	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_037467053.1|2628774_2631036_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_094182605.1|2632545_2633722_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081570412.1|2633719_2635030_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_037467900.1|2635081_2636140_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_081570413.1|2636284_2637187_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_037467899.1|2637150_2638470_-	xylose isomerase	NA	NA	NA	NA	NA
WP_037467898.1|2638482_2639925_-	xylulokinase	NA	NA	NA	NA	NA
WP_156103392.1|2640122_2640242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051908442.1|2640467_2641556_-	hypothetical protein	NA	A0A2I2L3D3	Orpheovirus	30.5	4.2e-26
WP_156103391.1|2641622_2641859_-	hypothetical protein	NA	A0A1V0S9J5	Catovirus	46.8	2.1e-07
WP_156103393.1|2642183_2642363_+	ferredoxin	NA	NA	NA	NA	NA
WP_037467896.1|2642538_2643117_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	33.9	4.8e-05
WP_037467895.1|2643210_2643627_-	DUF2958 domain-containing protein	NA	A0A1B1INN6	uncultured_Mediterranean_phage	45.2	1.2e-05
WP_037466134.1|2643882_2644884_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466136.1|2644880_2646245_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466138.1|2646241_2647474_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2648997:2649013	attR	GCCGCCGATCAGCACGA	NA	NA	NA	NA
>prophage 8
NZ_CP020538	Sphingobium herbicidovorans strain MH chromosome, complete genome	2919834	2656332	2695424	2919834	tail,head,protease,tRNA,integrase,portal,capsid	Dinoroseobacter_phage(14.29%)	43	2660623:2660637	2674928:2674942
WP_021224415.1|2656332_2657682_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081570467.1|2657839_2658655_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	34.7	2.2e-35
WP_037467285.1|2659591_2659888_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_081570415.1|2660272_2662081_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
2660623:2660637	attL	CCCGCTCGGGCACAT	NA	NA	NA	NA
WP_094182647.1|2661998_2662655_-	protein ImuA	NA	NA	NA	NA	NA
WP_037467232.1|2663297_2663918_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_037467235.1|2663997_2664393_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_037467297.1|2664392_2664638_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_051908368.1|2664856_2665282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467244.1|2665753_2666995_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	26.9	1.6e-18
WP_037467247.1|2667126_2667822_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_037467251.1|2667917_2669123_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	47.6	2.8e-95
WP_037467301.1|2669182_2670739_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_037467253.1|2670750_2671386_-	DedA family protein	NA	NA	NA	NA	NA
WP_037467303.1|2671502_2671745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467256.1|2672634_2673288_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_037467258.1|2673440_2674013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570416.1|2674023_2675466_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.2	1.9e-74
2674928:2674942	attR	ATGTGCCCGAGCGGG	NA	NA	NA	NA
WP_037467309.1|2675527_2675866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467260.1|2675979_2677107_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.5	4.8e-49
WP_037467262.1|2677273_2677594_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	44.7	2.0e-08
WP_037467264.1|2677590_2678004_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	36.4	5.8e-13
WP_037467267.1|2678086_2679220_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	42.1	4.6e-76
WP_051908362.1|2679300_2679852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467270.1|2679818_2680043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467273.1|2680039_2680438_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_037467276.1|2680573_2680888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037467277.1|2680944_2681352_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_037467279.1|2681348_2681660_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_037467282.1|2681656_2681851_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_062792992.1|2681887_2682439_+	hypothetical protein	NA	D6PEW0	uncultured_phage	37.4	4.0e-09
WP_037467924.1|2682435_2684766_+	DUF2460 domain-containing protein	NA	W6ASE7	Acinetobacter_phage	32.7	7.3e-52
WP_037467925.1|2684762_2685578_+	DUF2163 domain-containing protein	NA	Q5DN21	Alphaproteobacteria_virus	41.4	2.2e-11
WP_037467935.1|2685586_2685997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467927.1|2685984_2688180_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	29.6	1.9e-54
WP_037467929.1|2688210_2688714_+	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	39.1	2.4e-16
WP_062792994.1|2688891_2689980_+	OmpA family protein	NA	NA	NA	NA	NA
WP_156103321.1|2690106_2690307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037463413.1|2690314_2690866_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_037463380.1|2690888_2691434_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_037463378.1|2691552_2692287_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_037463376.1|2692346_2692976_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_037463375.1|2693105_2695424_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.9	2.1e-176
>prophage 1
NZ_CP020539	Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence	959196	57914	111458	959196	transposase	Escherichia_phage(66.67%)	41	NA	NA
WP_006949122.1|57914_58679_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
WP_157704841.1|58724_59153_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_062793193.1|59486_60908_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_062793194.1|60920_63365_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_094182652.1|63361_64366_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062793196.1|64365_67236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062793206.1|67239_69459_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_062793198.1|69614_70265_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062793200.1|70323_70632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081570478.1|70969_73858_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_094182660.1|74797_75034_-	protein kleA	NA	NA	NA	NA	NA
WP_015061623.1|75183_75438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942778.1|75434_76466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942779.1|76506_76941_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	39.3	2.3e-12
WP_015061620.1|77118_77376_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_081570479.1|77386_77698_+	pemk protein	NA	NA	NA	NA	NA
WP_031942784.1|82963_83977_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_031942785.1|83982_85098_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_062793238.1|85094_86021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031942787.1|86110_86896_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_031942788.1|86892_87468_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805635.1|87481_88483_-|transposase	IS1595-like element ISCsp2 family transposase	transposase	NA	NA	NA	NA
WP_012248458.1|88541_90089_+|transposase	IS91-like element ISPps1 family transposase	transposase	NA	NA	NA	NA
WP_037468461.1|91452_92316_+	(S)-phenoxypropionate/alpha-ketoglutarate- dioxygenase	NA	NA	NA	NA	NA
WP_081570482.1|92961_93867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031942784.1|93967_94981_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_031942785.1|94986_96102_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_062793238.1|96098_97025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031942787.1|97114_97900_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_031942788.1|97896_98472_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805635.1|98485_99487_-|transposase	IS1595-like element ISCsp2 family transposase	transposase	NA	NA	NA	NA
WP_012248458.1|99545_101093_+|transposase	IS91-like element ISPps1 family transposase	transposase	NA	NA	NA	NA
WP_081570483.1|101153_102155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037468461.1|102457_103321_+	(S)-phenoxypropionate/alpha-ketoglutarate- dioxygenase	NA	NA	NA	NA	NA
WP_081570482.1|103966_104872_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031942784.1|104972_105986_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_081570484.1|107099_108050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031942787.1|108110_108896_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_031942788.1|108892_109468_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037468454.1|110293_110641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006949122.1|110693_111458_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
>prophage 2
NZ_CP020539	Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence	959196	518080	545770	959196	integrase,transposase	Mycobacterium_phage(33.33%)	28	520274:520316	523662:523704
WP_037463583.1|518080_518437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_037463591.1|518433_518784_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_051908078.1|518983_519982_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
520274:520316	attL	AATTATGCGAAGCGCCGGATTATGCGCAGGTGCCAACGGCGGG	NA	NA	NA	NA
WP_037467461.1|520421_521666_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037467518.1|521665_522619_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037467462.1|522611_523619_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A222ZQF7	Mycobacterium_phage	29.1	2.9e-05
WP_156103383.1|523987_524098_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
523662:523704	attR	CCCGCCGTTGGCACCTGCGCATAATCCGGCGCTTCGCATAATT	NA	NA	NA	NA
WP_081570530.1|525052_525739_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_037467471.1|525714_527010_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_037467474.1|527006_528299_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_081570531.1|528292_528580_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_156103384.1|528432_528654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570532.1|528877_529237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051908384.1|529603_530089_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_037467520.1|530092_530989_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037467480.1|531157_532270_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.8e-37
WP_037467484.1|532300_532702_+	glyoxalase	NA	NA	NA	NA	NA
WP_037467521.1|532710_533559_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_037467522.1|533657_534062_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_037467487.1|534061_534658_+	acetyltransferase	NA	NA	NA	NA	NA
WP_037467490.1|534753_535656_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037467493.1|535753_536206_+	ATP synthase subunit E	NA	NA	NA	NA	NA
WP_037467500.1|536202_537780_+	formate dehydrogenase	NA	NA	NA	NA	NA
WP_037467502.1|537776_540623_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.1	6.9e-28
WP_081570533.1|540633_540939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037467505.1|541085_541436_-	RidA family protein	NA	NA	NA	NA	NA
WP_156103386.1|543799_544198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037468469.1|544729_545770_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP020539	Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence	959196	550726	567787	959196	integrase,transposase	Caulobacter_phage(66.67%)	10	559641:559655	568903:568917
WP_157704835.1|550726_551272_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q9ZXG3	Shigella_phage	53.2	2.1e-42
WP_037463831.1|552082_553501_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_037468470.1|556621_557368_+	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	42.0	5.0e-39
WP_015449377.1|557524_558874_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037465845.1|558870_560661_+	hypothetical protein	NA	NA	NA	NA	NA
559641:559655	attL	CCGCCATCATCTTCA	NA	NA	NA	NA
WP_015449375.1|560657_562871_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_015449374.1|562920_563823_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	36.8	1.9e-40
WP_037466138.1|564195_565428_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466136.1|565424_566789_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466134.1|566785_567787_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
568903:568917	attR	CCGCCATCATCTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP020540	Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence	312167	179944	207062	312167	transposase,integrase,holin	Catovirus(16.67%)	19	199308:199354	202700:202746
WP_156103324.1|179944_181747_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	28.3	2.4e-58
WP_081570610.1|182002_183256_+	MFS transporter	NA	NA	NA	NA	NA
WP_037463658.1|184389_187836_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_051908092.1|187879_188836_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_037463655.1|189155_189959_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156103323.1|190174_191434_-	CoA transferase	NA	NA	NA	NA	NA
WP_037463654.1|193241_193976_+	ATPase	NA	U5N3V8	Enterobacteria_phage	33.5	6.9e-33
WP_157704846.1|194093_194954_-	MFS transporter	NA	NA	NA	NA	NA
WP_094182673.1|194963_195311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037463766.1|195839_197489_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.7	8.0e-21
WP_081570612.1|197916_198702_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
199308:199354	attL	CCGAAATTATGCGAAGCGCCGGATTATGCGCAGGTGCCAACGGCGGG	NA	NA	NA	NA
WP_037467462.1|199396_200404_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A222ZQF7	Mycobacterium_phage	29.1	2.9e-05
WP_037467518.1|200396_201350_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037467461.1|201349_202594_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037468448.1|204140_204488_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	58.2	1.9e-33
202700:202746	attR	CCCGCCGTTGGCACCTGCGCATAATCCGGCGCTTCGCATAATTTCGG	NA	NA	NA	NA
WP_037468446.1|204484_204868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157704847.1|204989_205136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570614.1|205166_206276_-	MFS transporter	NA	NA	NA	NA	NA
WP_006949122.1|206297_207062_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.8	3.8e-90
>prophage 2
NZ_CP020540	Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence	312167	210746	277876	312167	transposase,integrase	Aeromonas_phage(11.11%)	54	273836:273851	278579:278594
WP_037465793.1|210746_211979_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	23.3	1.9e-06
WP_037465795.1|211975_213331_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037465799.1|213327_214332_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	27.2	7.3e-09
WP_037465804.1|214376_216572_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	29.7	1.2e-24
WP_022684358.1|216638_217505_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	31.6	4.8e-09
WP_017183648.1|217567_217894_-	single-stranded DNA-binding protein	NA	K7ZMK1	Xanthomonas_citri_phage	31.1	1.4e-06
WP_128830639.1|217877_218174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017183650.1|218560_219649_+	replication initiation protein	NA	NA	NA	NA	NA
WP_017183651.1|219845_221048_+	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	31.3	6.6e-41
WP_037465813.1|221092_222109_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_037465816.1|222152_222524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017183654.1|222568_223252_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_017183655.1|223251_223650_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_017183656.1|223746_224913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037465819.1|225054_225618_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.6	5.3e-49
WP_014072603.1|225787_226210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014072602.1|226286_226682_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_004213249.1|226694_227024_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_037465822.1|227103_228480_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	9.0e-42
WP_014072601.1|228571_231541_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	4.1e-209
WP_004212890.1|232421_233171_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004212886.1|233167_235669_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	7.7e-124
WP_004212885.1|235665_236274_-	cation transporter	NA	NA	NA	NA	NA
WP_004212882.1|236270_236957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017183574.1|236960_237374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021238674.1|237421_237799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212879.1|237795_238284_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_004212878.1|238337_241583_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004212877.1|241586_242765_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013039111.1|242764_244042_-	TolC family protein	NA	NA	NA	NA	NA
WP_007406840.1|244102_244399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017183571.1|244472_246440_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004212870.1|246439_247066_-	cation transporter	NA	NA	NA	NA	NA
WP_007406847.1|247141_247561_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013039112.1|247554_248757_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_009824027.1|249046_249619_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	9.5e-38
WP_004212864.1|249810_251211_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	29.4	9.9e-12
WP_009824028.1|251137_252016_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	25.4	1.0e-06
WP_013039113.1|252330_253569_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_037465832.1|253891_255541_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A219VHD4	Ochrobactrum_phage	27.7	8.1e-05
WP_051908245.1|255567_256461_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_081570615.1|256457_257615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037465839.1|257663_258551_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	54.1	5.1e-30
WP_081570616.1|258993_259995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037465843.1|263800_264811_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_094182675.1|264807_265956_-	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	27.7	7.5e-34
WP_051908244.1|266679_267456_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.9	3.9e-42
WP_015449377.1|267613_268963_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037465845.1|268959_270750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015449375.1|270746_272960_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_015449374.1|273009_273912_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	36.8	1.9e-40
273836:273851	attL	CCGCCGCCAGCAAGGC	NA	NA	NA	NA
WP_037466138.1|274284_275517_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466136.1|275513_276878_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037466134.1|276874_277876_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
278579:278594	attR	CCGCCGCCAGCAAGGC	NA	NA	NA	NA
