The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020562	Halomonas sp. GT chromosome, complete genome	4158464	1036831	1081690	4158464	tRNA,tail,portal,capsid,terminase,integrase,plate,head	uncultured_Caudovirales_phage(17.65%)	61	1039327:1039346	1078018:1078037
WP_083001905.1|1036831_1038286_+	catalase	NA	A0A2K9L572	Tupanvirus	43.3	8.5e-91
WP_083007848.1|1038362_1039394_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1039327:1039346	attL	GTCCAATCCATCATAGGTGC	NA	NA	NA	NA
WP_083001907.1|1039525_1040581_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	41.8	1.5e-68
WP_083001910.1|1040573_1041404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001912.1|1041390_1041780_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	G8DF69	Emiliania_huxleyi_virus	32.3	2.2e-06
WP_083001914.1|1041838_1042096_-	hypothetical protein	NA	A0A1D9C9N7	Salinivibrio_phage	45.2	2.8e-13
WP_083001916.1|1042092_1042401_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	48.8	9.4e-16
WP_083001919.1|1042638_1042854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001922.1|1042868_1045136_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	36.3	5.1e-66
WP_083001924.1|1045132_1045342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001927.1|1045338_1045749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001929.1|1045759_1046137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156886194.1|1046133_1046469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001934.1|1046461_1046650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001936.1|1046687_1046891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001939.1|1046926_1047133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001941.1|1047293_1047488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886195.1|1047441_1047675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001943.1|1047767_1048433_+	LexA family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	33.1	2.6e-15
WP_083001945.1|1048498_1049089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886196.1|1049153_1049393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886197.1|1049382_1050261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083001949.1|1050504_1050855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886198.1|1051133_1051289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886199.1|1051465_1052326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083001953.1|1052388_1052820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001955.1|1052838_1053336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083001957.1|1053332_1054139_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_083001959.1|1054803_1055223_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	53.3	1.0e-33
WP_083001961.1|1055265_1055448_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	69.5	1.1e-16
WP_083001964.1|1055534_1056515_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	48.9	1.2e-83
WP_083001966.1|1056511_1056955_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	61.4	1.2e-40
WP_083001968.1|1056965_1059611_-	hypothetical protein	NA	Q9ZXK0	Pseudomonas_virus	23.4	7.0e-27
WP_083001970.1|1059657_1059783_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	61.8	5.1e-05
WP_083001972.1|1059815_1060166_-|tail	phage tail assembly protein	tail	E5E3Q0	Burkholderia_phage	58.1	1.9e-20
WP_083001974.1|1060226_1060736_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	46.7	6.9e-40
WP_083001976.1|1060751_1061921_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	66.0	5.5e-149
WP_083001978.1|1062081_1062948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083001980.1|1062974_1063637_-	DUF4376 domain-containing protein	NA	A0A291LAV4	Bordetella_phage	39.8	2.2e-06
WP_083001982.1|1063647_1065288_-	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	53.3	1.9e-38
WP_083001984.1|1065250_1065871_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	52.8	8.1e-43
WP_083001986.1|1065863_1066781_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	62.2	6.1e-95
WP_083001988.1|1066777_1067113_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	53.2	1.2e-24
WP_083001990.1|1067112_1067682_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	39.0	1.3e-31
WP_083001992.1|1067757_1068228_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	47.3	2.1e-30
WP_083001994.1|1068224_1068710_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	37.7	1.3e-19
WP_083001996.1|1068706_1069141_-	DUF1353 domain-containing protein	NA	K4F6K2	Cronobacter_phage	44.4	1.7e-10
WP_083001999.1|1069143_1069494_-	DUF882 domain-containing protein	NA	I7FWL0	Pectobacterium_phage	54.4	5.8e-30
WP_156886200.1|1069490_1069769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083002004.1|1069813_1070029_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	47.8	4.5e-09
WP_083002006.1|1070025_1070487_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	41.0	6.1e-19
WP_083002009.1|1070601_1071282_-	hypothetical protein	NA	A4JWP8	Burkholderia_virus	48.0	7.3e-45
WP_083002011.1|1071281_1072295_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	60.1	6.5e-114
WP_083002014.1|1072347_1073172_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	47.9	1.7e-56
WP_083007849.1|1073316_1075107_+|terminase	terminase	terminase	A0A077K8Q7	Ralstonia_phage	58.3	9.8e-206
WP_083002016.1|1075103_1076159_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	58.6	1.0e-109
WP_156886201.1|1076281_1077043_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	60.7	4.4e-91
WP_083002019.1|1077118_1077730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083002021.1|1078797_1079379_+	hypothetical protein	NA	NA	NA	NA	NA
1078018:1078037	attR	GTCCAATCCATCATAGGTGC	NA	NA	NA	NA
WP_083002023.1|1079401_1079926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083002025.1|1080211_1081690_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP020562	Halomonas sp. GT chromosome, complete genome	4158464	1716918	1724344	4158464		Planktothrix_phage(16.67%)	8	NA	NA
WP_083003613.1|1716918_1717962_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	2.3e-34
WP_039869192.1|1718421_1719048_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	33.9	3.4e-20
WP_083003617.1|1719246_1720545_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	40.4	4.2e-73
WP_083003621.1|1720580_1721126_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	4.1e-30
WP_009723428.1|1721134_1721614_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_083003625.1|1721615_1722299_+	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	46.6	6.0e-47
WP_009723426.1|1722396_1723026_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_083003628.1|1723114_1724344_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	37.8	6.8e-57
>prophage 3
NZ_CP020562	Halomonas sp. GT chromosome, complete genome	4158464	2077437	2125672	4158464	tRNA,tail,holin,portal,capsid,terminase,head	Pseudomonas_phage(24.0%)	56	NA	NA
WP_083004684.1|2077437_2078478_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_038484762.1|2078474_2078798_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_083004687.1|2078858_2080439_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.0	3.4e-69
WP_083004691.1|2080611_2082069_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_083004695.1|2082188_2082740_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	60.2	1.3e-55
WP_083004698.1|2083038_2083632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004702.1|2083685_2084660_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_083004705.1|2084693_2085413_-	ComF family protein	NA	NA	NA	NA	NA
WP_083004708.1|2085828_2086563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886215.1|2086705_2087461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004714.1|2087420_2088470_-	GSCFA domain-containing protein	NA	NA	NA	NA	NA
WP_083004718.1|2088740_2088998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004721.1|2089032_2089992_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	44.8	3.7e-26
WP_083004725.1|2090004_2096532_-	hypothetical protein	NA	A0A2I6PHT2	Pseudomonas_phage	49.9	2.1e-245
WP_156886216.1|2096528_2097110_-|tail	tail assembly protein	tail	A0A2I6PHT6	Pseudomonas_phage	52.1	2.4e-20
WP_083004731.1|2097121_2097844_-	hypothetical protein	NA	W6E9P7	Rhizobium_phage	45.3	5.9e-53
WP_083004735.1|2097927_2098194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004738.1|2098269_2098968_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	41.4	7.8e-42
WP_083004742.1|2098964_2099315_-	hypothetical protein	NA	A0A0P0ZCS8	Stx2-converting_phage	30.0	8.5e-05
WP_083004745.1|2099317_2102788_-	tape measure protein	NA	A0A2D1GNQ1	Pseudomonas_phage	35.4	7.8e-34
WP_083004749.1|2102961_2103453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004753.1|2103505_2103874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004757.1|2103843_2104188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156886217.1|2104202_2105138_-	hypothetical protein	NA	G8CLB2	Synechococcus_phage	33.5	9.7e-40
WP_083004764.1|2105097_2105307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004767.1|2105323_2105731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004771.1|2105727_2106330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004774.1|2106339_2106645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004777.1|2106644_2106938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004780.1|2107005_2108046_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	38.4	1.5e-65
WP_083004783.1|2108091_2108442_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	40.2	6.5e-13
WP_083004787.1|2108481_2109705_-	S49 family peptidase	NA	A0A219YB02	Aeromonas_phage	47.3	7.9e-58
WP_156886251.1|2109744_2111397_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	35.2	2.5e-75
WP_083004794.1|2111406_2111628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004797.1|2111624_2113595_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.9	1.4e-181
WP_083004800.1|2113572_2114127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156886218.1|2114245_2114392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004805.1|2114384_2114816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004808.1|2114812_2115136_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	47.5	1.6e-18
WP_083004810.1|2115161_2115785_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0GUZ6	Halomonas_phage	58.4	6.0e-54
WP_083004813.1|2115998_2116376_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	35.3	3.3e-07
WP_083004816.1|2116621_2118085_-	hypothetical protein	NA	A0A2H4JF22	uncultured_Caudovirales_phage	37.1	4.1e-61
WP_083004819.1|2118084_2119119_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	34.5	1.8e-26
WP_083004821.1|2119183_2119696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004824.1|2119744_2120263_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.7	5.8e-18
WP_083004828.1|2120275_2120566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886219.1|2120568_2120775_-	hypothetical protein	NA	Q9MC51	Pseudomonas_phage	43.3	4.5e-06
WP_083004835.1|2120767_2121277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004840.1|2121466_2121718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083004844.1|2121764_2122439_+	hypothetical protein	NA	A0A2H4J868	uncultured_Caudovirales_phage	30.3	7.1e-08
WP_083004848.1|2122448_2123453_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_083004852.1|2123532_2123724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156886220.1|2123720_2124050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004855.1|2123956_2124367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083004860.1|2124457_2124811_+	hypothetical protein	NA	A0A2D1GMS3	Marinobacter_phage	48.6	3.4e-22
WP_083004863.1|2124862_2125672_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	38.2	1.4e-42
