The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	0	8006	4077713	protease	Mycobacterium_phage(50.0%)	5	NA	NA
WP_002016116.1|1823_2456_-|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_001009665.1|2478_4260_-	metalloendopeptidase CpaA	NA	NA	NA	NA	NA
WP_001170312.1|4517_5996_-	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	25.7	5.7e-26
WP_000323808.1|6120_6699_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000588784.1|6746_8006_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.8	1.8e-12
>prophage 2
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	17472	25401	4077713		Bacillus_virus(33.33%)	8	NA	NA
WP_000775740.1|17472_18192_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
WP_000674108.1|18207_20964_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.8	8.4e-39
WP_001983688.1|21064_21226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221476.1|21527_21971_-	RDD family protein	NA	NA	NA	NA	NA
WP_001139330.1|22243_22417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774578.1|22595_22823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109442.1|23111_23555_+	universal stress protein	NA	NA	NA	NA	NA
WP_000193891.1|23814_25401_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.4	5.7e-32
>prophage 3
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	31967	32438	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001123841.1|31967_32438_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
>prophage 4
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	37501	38720	4077713	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085944009.1|37501_38720_+|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
>prophage 5
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	41820	42279	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001127329.1|41820_42279_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	1.5e-30
>prophage 6
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	52898	60291	4077713		Puniceispirillum_phage(25.0%)	6	NA	NA
WP_001013451.1|52898_54302_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	S4S2K9	Puniceispirillum_phage	33.3	1.1e-05
WP_000423285.1|54568_55468_+	DNA-binding transcriptional regulator HcaR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	1.5e-05
WP_000537604.1|55583_56444_-	alpha/beta fold hydrolase	NA	A0A2K9KZN8	Tupanvirus	24.1	1.0e-06
WP_001254302.1|56629_57940_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_000034795.1|58354_59374_-	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_000721213.1|59385_60291_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.4	1.8e-38
>prophage 7
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	69340	71470	4077713		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000066244.1|69340_71470_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	34.0	5.1e-20
>prophage 8
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	80895	82115	4077713	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085944009.1|80895_82115_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
>prophage 9
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	103300	105013	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000808299.1|103300_105013_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	2.2e-77
>prophage 10
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	115622	118028	4077713	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_000803948.1|115622_117350_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.5e-187
WP_000009660.1|117518_118028_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
>prophage 11
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	122361	124314	4077713		Wolbachia_phage(100.0%)	1	NA	NA
WP_000129005.1|122361_124314_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.5e-84
>prophage 12
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	156012	165391	4077713		Streptococcus_phage(33.33%)	8	NA	NA
WP_085944091.1|156012_158052_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.7	2.0e-37
WP_000891219.1|158060_159770_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000993397.1|160031_160469_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000338779.1|160425_160806_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000742543.1|160821_162120_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.1	9.8e-107
WP_000137898.1|162178_162955_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_000083683.1|163124_163703_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000853296.1|163747_165391_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	37.7	2.1e-77
>prophage 13
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	183292	185680	4077713		Hokovirus(100.0%)	1	NA	NA
WP_000853480.1|183292_185680_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 14
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	193169	194615	4077713		Escherichia_phage(100.0%)	1	NA	NA
WP_000075891.1|193169_194615_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
>prophage 15
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	206090	211293	4077713		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000153210.1|206090_207665_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
WP_001024112.1|207790_209077_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000733776.1|209325_210192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614025.1|210267_211293_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
>prophage 16
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	239488	240976	4077713		Burkholderia_virus(100.0%)	1	NA	NA
WP_001260521.1|239488_240976_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.6	3.0e-59
>prophage 17
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	269835	357839	4077713	protease,integrase,capsid,transposase,tRNA,tail,terminase	Acinetobacter_phage(65.57%)	97	269278:269292	357860:357874
269278:269292	attL	AATAAAAAGTAATCT	NA	NA	NA	NA
WP_085940413.1|269835_270926_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000154821.1|271839_272121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262214.1|272448_272724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573640.1|273248_273458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000873035.1|273454_273604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896070.1|273760_274231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002016208.1|274232_288875_-	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	38.4	6.4e-53
WP_000935949.1|288938_290696_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.0	4.1e-39
WP_000912081.1|291478_292282_-	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.8e-05
WP_000461855.1|292268_293777_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_000190821.1|293955_294837_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000744460.1|294940_296044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636263.1|296046_297057_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
WP_001136722.1|297202_297418_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000209410.1|297444_297891_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_085944101.1|297982_299410_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000758325.1|299556_300522_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_000580191.1|300533_301184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665946.1|301284_303174_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000334674.1|303252_304794_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	8.7e-86
WP_001091967.1|304819_305407_-	CvpA family protein	NA	NA	NA	NA	NA
WP_000966983.1|305413_306418_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000783000.1|306507_306987_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_004736718.1|306986_308126_-	type II secretion system protein L	NA	NA	NA	NA	NA
WP_000084540.1|308263_308458_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.8	1.3e-28
WP_023060495.1|308552_309131_-	glycoside hydrolase	NA	A0A2H4JDB4	uncultured_Caudovirales_phage	78.3	9.5e-78
WP_023060494.1|309173_309563_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_083042103.1|309853_310504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083042104.1|310505_310847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083042106.1|314838_315504_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	49.1	1.0e-43
WP_083042107.1|315487_316243_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	57.8	7.3e-86
WP_004736727.1|316249_317056_-|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	64.6	2.7e-94
WP_083042108.1|317042_318218_-	hypothetical protein	NA	E5KJQ6	Acinetobacter_phage	58.9	1.4e-43
WP_004736731.1|318271_318613_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	42.2	2.2e-13
WP_004736733.1|318609_318753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736735.1|318847_319384_+	hypothetical protein	NA	A0A2H4J720	uncultured_Caudovirales_phage	31.5	4.8e-15
WP_004736738.1|319418_323477_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	47.4	2.0e-206
WP_004736741.1|323535_324477_-	hypothetical protein	NA	A0A0N7IRE6	Acinetobacter_phage	85.6	5.0e-153
WP_004736743.1|324547_324997_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004736745.1|324993_325710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736746.1|326071_326596_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	60.5	3.9e-46
WP_004736748.1|326641_327583_-	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	97.1	5.5e-168
WP_004700304.1|327689_327902_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	84.1	8.4e-24
WP_114226277.1|327903_328347_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	78.2	2.1e-64
WP_025465131.1|328303_328672_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.0	3.9e-53
WP_171265750.1|328637_329051_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.8	7.8e-66
WP_002004038.1|329059_329428_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	86.1	3.8e-56
WP_000008491.1|329431_329821_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	99.2	4.3e-66
WP_083042110.1|329825_330491_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	79.2	1.9e-90
WP_064479964.1|330555_331509_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	2.8e-167
WP_000770056.1|331536_332304_-	hypothetical protein	NA	A0A0D4DCP5	Acinetobacter_phage	92.5	5.2e-116
WP_083042111.1|332421_332733_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	47.6	1.5e-13
WP_000004360.1|332953_333196_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	90.0	7.1e-35
WP_083042112.1|333192_334296_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	96.2	8.4e-200
WP_001286350.1|334297_335749_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	91.5	1.0e-261
WP_083042113.1|335745_337173_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	4.7e-251
WP_004736766.1|337162_337633_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	98.7	6.7e-82
WP_000372126.1|337691_338333_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	89.2	2.4e-114
WP_002004043.1|338464_338770_-	hypothetical protein	NA	A0A2I7QMV1	Vibrio_phage	38.9	7.9e-07
WP_000433688.1|338795_339281_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	57.9	8.9e-45
WP_004736768.1|339727_339898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587870.1|339900_340209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080484.1|340211_340457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004736769.1|340505_340826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990560.1|341236_341770_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	36.4	9.2e-19
WP_004736770.1|341860_342313_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	94.7	1.0e-74
WP_025464961.1|342309_342621_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.8e-59
WP_083042114.1|342611_343151_-	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	90.5	2.6e-29
WP_083042115.1|343143_343515_-	hypothetical protein	NA	A0A0P0IKT4	Acinetobacter_phage	82.0	1.0e-16
WP_002009796.1|343507_343768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856152.1|343764_344136_-	hypothetical protein	NA	I2GUC9	Acinetobacter_phage	62.2	4.0e-37
WP_083042116.1|344132_344666_-	hypothetical protein	NA	M4SN77	Psychrobacter_phage	42.7	2.6e-29
WP_164545311.1|344662_344839_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	89.7	1.1e-18
WP_001068420.1|344835_345087_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	90.4	1.1e-35
WP_000755975.1|345095_345962_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2I7RGS4	Vibrio_phage	46.2	4.9e-70
WP_004736774.1|345958_347284_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	98.9	1.5e-248
WP_000050653.1|347283_348042_-	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	92.2	4.0e-108
WP_023060457.1|348038_348212_-	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	94.7	1.5e-23
WP_005136293.1|348408_348675_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	80.7	9.5e-33
WP_001068245.1|348685_348916_-	hypothetical protein	NA	A0A1B1P9I7	Acinetobacter_phage	100.0	1.6e-36
WP_023060455.1|349040_349787_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	99.6	1.5e-139
WP_025469409.1|349802_350018_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	94.4	3.0e-29
WP_004736777.1|350082_350562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060453.1|350561_351281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042117.1|351492_352191_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000615653.1|352177_352363_+	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	58.1	3.9e-09
WP_083042118.1|352362_352554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042119.1|352546_352783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042120.1|352779_353157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042121.1|353156_353753_+	hypothetical protein	NA	A0A2C9CXX4	Yersinia_phage	34.3	1.6e-24
WP_083042122.1|353762_354701_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	81.7	3.2e-139
WP_083042123.1|354697_355357_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	59.8	9.8e-79
WP_083042124.1|355353_355635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042125.1|355631_356123_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	64.8	2.8e-46
WP_025464967.1|356119_356497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856313.1|356532_356823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033856312.1|356819_357839_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	42.8	7.1e-68
357860:357874	attR	AGATTACTTTTTATT	NA	NA	NA	NA
>prophage 18
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	360882	363970	4077713		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	4	NA	NA
WP_002000703.1|360882_362052_-	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
WP_000126912.1|362137_362350_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_000108398.1|362724_362970_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001285359.1|363103_363970_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
>prophage 19
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	370726	371995	4077713		Erwinia_phage(100.0%)	1	NA	NA
WP_000110900.1|370726_371995_+	RtcB family protein	NA	W6AR47	Erwinia_phage	60.5	4.7e-138
>prophage 20
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	384263	385277	4077713		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001093412.1|384263_385277_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.8e-77
>prophage 21
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	391103	393588	4077713		Bacillus_phage(66.67%)	3	NA	NA
WP_001257353.1|391103_392462_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	25.2	2.0e-17
WP_001221454.1|392458_393121_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	6.5e-22
WP_000783084.1|393228_393588_-	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	4.3e-12
>prophage 22
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	401281	404332	4077713	tRNA	Phage_TP(33.33%)	4	NA	NA
WP_000845872.1|401281_402652_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	62.6	1.0e-125
WP_001196301.1|402654_402918_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	6.5e-18
WP_000121131.1|403154_403484_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000438618.1|403555_404332_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.6	9.3e-12
>prophage 23
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	409245	430901	4077713	terminase,holin	Acinetobacter_phage(40.0%)	18	NA	NA
WP_001027060.1|409245_412425_+	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
WP_000633117.1|412437_413886_+	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_000457893.1|413925_415179_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_002010476.1|415239_415395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000782588.1|415424_416654_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001147934.1|416903_417590_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
WP_161795015.1|417734_418370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084539.1|418620_418818_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.9	5.6e-30
WP_033856064.1|418942_419392_-	lysozyme	NA	A0A1B1P9G1	Acinetobacter_phage	96.6	8.1e-77
WP_000397631.1|419384_419672_-|holin	phage holin family protein	holin	A0A1B1P9F5	Acinetobacter_phage	100.0	6.0e-49
WP_083042126.1|419747_422567_-	hypothetical protein	NA	A0A0A0RLM4	Acinetobacter_phage	57.9	7.3e-232
WP_083042127.1|422576_424250_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	45.7	4.5e-136
WP_001204064.1|424249_424558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853947.1|424703_424847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083042128.1|424882_427408_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	32.2	1.4e-109
WP_002004817.1|427474_427720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002004819.1|427716_427944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220336.1|428039_430901_-	lytic transglycosylase domain-containing protein	NA	A0A222YY44	Escherichia_phage	34.4	1.5e-51
>prophage 24
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	434003	456962	4077713	tail,head,integrase	Acinetobacter_phage(45.0%)	39	425972:425985	457179:457192
425972:425985	attL	AGCTAGTTTTTCGG	NA	NA	NA	NA
WP_001250303.1|434003_436082_-	hypothetical protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.0	8.8e-33
WP_083042129.1|436081_436642_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	35.6	7.2e-22
WP_000072947.1|436707_436878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262754.1|436952_437852_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	34.6	5.5e-32
WP_000931279.1|437863_438487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611267.1|438479_438965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856157.1|438961_440605_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	44.6	4.7e-122
WP_000333834.1|440606_440837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033856156.1|440836_441160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002009684.1|441226_441406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025464961.1|441500_441812_-	hypothetical protein	NA	A0A0D4DCM1	Acinetobacter_phage	95.1	1.8e-59
WP_083042114.1|441802_442342_-	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	90.5	2.6e-29
WP_083042115.1|442334_442706_-	hypothetical protein	NA	A0A0P0IKT4	Acinetobacter_phage	82.0	1.0e-16
WP_002009796.1|442698_442959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002010151.1|442955_443339_-	hypothetical protein	NA	A0A0A0RTI7	Acinetobacter_phage	45.0	3.2e-13
WP_001261846.1|443335_443740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009499908.1|443757_444177_-	hypothetical protein	NA	H2DE79	Erwinia_phage	50.8	1.2e-26
WP_083042130.1|444163_444529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083042131.1|444525_445260_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	52.0	1.5e-64
WP_083042132.1|445256_446135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046534.1|446131_446599_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_083042133.1|446615_446939_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001197739.1|446947_447130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096816.1|447242_447926_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.6	6.9e-27
WP_083042134.1|447922_448564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508120.1|448795_449143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025464833.1|449162_449429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537259.1|449428_450025_+	hypothetical protein	NA	A0A2C9CXX4	Yersinia_phage	31.5	1.1e-20
WP_033856359.1|450034_450892_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	56.7	1.5e-58
WP_083042135.1|450872_451481_+	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	76.3	1.1e-84
WP_025464966.1|451477_451735_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	78.8	1.2e-29
WP_002010280.1|451731_451995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002010053.1|452006_452486_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	66.7	1.5e-49
WP_025464967.1|452482_452860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123991.1|452896_453166_+	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	100.0	4.7e-48
WP_002010468.1|453162_454149_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	98.8	1.5e-184
WP_000128669.1|454447_455383_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|455379_456153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110170.1|456149_456962_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	36.0	8.5e-40
457179:457192	attR	CCGAAAAACTAGCT	NA	NA	NA	NA
>prophage 25
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	460266	460836	4077713		Synechococcus_phage(100.0%)	1	NA	NA
WP_002000723.1|460266_460836_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
>prophage 26
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	478663	480046	4077713		Pandoravirus(100.0%)	1	NA	NA
WP_000994845.1|478663_480046_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	1.2e-41
>prophage 27
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	487277	489742	4077713		Sinorhizobium_phage(50.0%)	2	NA	NA
WP_001198543.1|487277_488516_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	3.6e-90
WP_001254956.1|488566_489742_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
>prophage 28
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	497942	516402	4077713		Acinetobacter_phage(100.0%)	12	NA	NA
WP_085944095.1|497942_499502_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	88.1	4.6e-260
WP_000115130.1|499498_501301_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	91.0	0.0e+00
WP_002118425.1|501603_502179_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	98.4	6.1e-109
WP_085944096.1|502275_505047_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.6	0.0e+00
WP_000281145.1|505054_507787_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.4	0.0e+00
WP_079261102.1|508143_509193_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.4	1.1e-188
WP_000608316.1|509202_510009_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.4	1.4e-143
WP_000066135.1|510018_510714_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	97.4	4.6e-119
WP_001164223.1|510724_511708_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	92.0	4.9e-175
WP_001076804.1|511714_514090_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.2	0.0e+00
WP_000893699.1|514091_515591_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	95.4	2.2e-275
WP_001187844.1|515853_516402_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 29
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	526760	529936	4077713		Bacillus_phage(50.0%)	2	NA	NA
WP_001095756.1|526760_528356_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarB	NA	W8CYL7	Bacillus_phage	44.8	4.4e-24
WP_085944102.1|528352_529936_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarA	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.9	3.2e-11
>prophage 30
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	541881	549112	4077713		Brazilian_cedratvirus(33.33%)	5	NA	NA
WP_000582117.1|541881_542652_-	ferric acinetobactin ABC transporter ATP-binding protein BauE	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	8.6e-18
WP_001223269.1|542648_543596_-	ferric acinetobactin ABC transporter permease subunit BauC	NA	NA	NA	NA	NA
WP_080759601.1|543595_544579_-	ferric acinetobactin ABC transporter permease subunit BauD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.2	1.1e-62
WP_000939837.1|545166_547194_+	acinetobactin non-ribosomal peptide synthetase subunit BasB	NA	NA	NA	NA	NA
WP_000910265.1|547264_549112_-	acinetobactin non-ribosomal peptide synthetase subunit BasA	NA	A0A2K9KZV5	Tupanvirus	24.5	4.0e-37
>prophage 31
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	577043	581075	4077713		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000550750.1|577043_577874_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
WP_001023216.1|577988_578756_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_000846423.1|578858_579230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480885.1|579377_579800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197255.1|579926_581075_+	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
>prophage 32
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	584268	585657	4077713		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000993080.1|584268_585657_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 33
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	588886	598517	4077713	protease	Bodo_saltans_virus(50.0%)	7	NA	NA
WP_000897185.1|588886_589849_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
WP_002000060.1|589998_590856_-	phosphate ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	22.1	9.3e-05
WP_000372632.1|590914_592285_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_001050723.1|592308_593688_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_001238909.1|593788_594820_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
WP_000339846.1|595275_596655_-	amino acid permease	NA	NA	NA	NA	NA
WP_000469456.1|596795_598517_-	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	2.7e-27
>prophage 34
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	602449	603823	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_000117544.1|602449_603823_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.9e-24
>prophage 35
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	610549	613387	4077713		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000413591.1|610549_613387_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	4.3e-22
>prophage 36
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	620959	628827	4077713		Vibrio_phage(100.0%)	5	NA	NA
WP_001097004.1|620959_621973_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	38.7	5.0e-50
WP_001215683.1|621998_622883_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_000841018.1|622882_624133_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_000498208.1|624148_627523_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2D0YEC8	Vibrio_phage	30.7	4.4e-106
WP_000436800.1|627879_628827_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	39.3	2.4e-54
>prophage 37
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	632174	634937	4077713		Tupanvirus(100.0%)	1	NA	NA
WP_000480988.1|632174_634937_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 38
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	641122	642379	4077713		Phage_21(100.0%)	1	NA	NA
WP_000542120.1|641122_642379_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	79.6	9.1e-17
>prophage 39
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	648002	652871	4077713		Stx2-converting_phage(50.0%)	4	NA	NA
WP_000667907.1|648002_649322_+	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	39.1	1.7e-37
WP_000193164.1|649420_650707_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000123995.1|650842_651325_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000063721.1|651428_652871_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.1	1.2e-57
>prophage 40
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	658674	659811	4077713		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000718050.1|658674_659811_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.1	2.8e-25
>prophage 41
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	666155	667289	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_000573844.1|666155_667289_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 42
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	672989	676663	4077713		Tupanvirus(50.0%)	3	NA	NA
WP_000885644.1|672989_673577_-	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
WP_001004983.1|673670_675692_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_000222197.1|675871_676663_+	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
>prophage 43
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	686366	695348	4077713		Streptococcus_phage(50.0%)	9	NA	NA
WP_000160699.1|686366_687059_-	ribonuclease III	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
WP_001224039.1|687030_687405_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_000344900.1|687428_688256_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000035781.1|688326_690144_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
WP_000094833.1|690321_690771_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002000087.1|690891_692283_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
WP_000367542.1|692498_694142_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000842540.1|694196_694613_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000470768.1|694748_695348_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	5.1e-34
>prophage 44
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	700957	702019	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_000027499.1|700957_702019_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 45
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	705048	716249	4077713		Bacillus_phage(16.67%)	11	NA	NA
WP_000157724.1|705048_705759_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
WP_079261103.1|705787_706471_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.8	2.3e-30
WP_000771345.1|706484_706901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001153968.1|706991_707678_+	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_001293529.1|707695_708157_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_001050708.1|708279_708849_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_001991184.1|708919_709510_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	1.3e-21
WP_000175547.1|709619_710420_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000916029.1|710416_710734_-	NIF3 1	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	29.4	6.5e-12
WP_160945277.1|711127_712294_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	6.9e-27
WP_000471071.1|712415_716249_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.0	6.3e-109
>prophage 46
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	726731	727703	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_000067971.1|726731_727703_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	9.4e-46
>prophage 47
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	736748	744629	4077713		Prochlorococcus_phage(20.0%)	7	NA	NA
WP_000071984.1|736748_737819_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
WP_000975532.1|737815_738445_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.1e-26
WP_000114071.1|738508_739318_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001286615.1|739336_740353_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	7.1e-12
WP_001984639.1|740489_741473_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_000472707.1|741425_743858_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	1.7e-27
WP_000049406.1|743942_744629_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.2	3.4e-34
>prophage 48
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	748944	750024	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_001203183.1|748944_750024_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.0	1.8e-90
>prophage 49
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	756302	757283	4077713		Salmonella_phage(100.0%)	1	NA	NA
WP_001022413.1|756302_757283_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	45.5	1.5e-67
>prophage 50
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	760654	766759	4077713		Bacillus_phage(50.0%)	4	NA	NA
WP_000116444.1|760654_763369_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	8.7e-97
WP_000025985.1|763735_764668_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_000646179.1|764685_765435_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_070148719.1|765871_766759_-	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.7e-15
>prophage 51
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	774522	776561	4077713		Tupanvirus(50.0%)	2	NA	NA
WP_000059551.1|774522_775497_-	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.0	5.8e-27
WP_000706070.1|775493_776561_-	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.2	2.0e-17
>prophage 52
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	780850	782008	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869484.1|780850_782008_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.7	1.0e-38
>prophage 53
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	790372	794371	4077713		Tupanvirus(100.0%)	1	NA	NA
WP_001071452.1|790372_794371_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.1	6.2e-67
>prophage 54
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	798428	800701	4077713	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_000271249.1|798428_799334_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
WP_002010827.1|799924_800701_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.6	2.4e-36
>prophage 55
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	808726	810710	4077713		uncultured_virus(100.0%)	2	NA	NA
WP_001274623.1|808726_810361_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
WP_000065579.1|810419_810710_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
>prophage 56
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	818393	822044	4077713		Burkholderia_virus(50.0%)	4	NA	NA
WP_001984607.1|818393_819725_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
WP_001043189.1|819841_820264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278006.1|820286_820955_-	methyltransferase	NA	NA	NA	NA	NA
WP_001229854.1|821195_822044_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.0	9.5e-26
>prophage 57
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	826367	829048	4077713		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001286662.1|826367_828263_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
WP_000235573.1|828397_829048_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
>prophage 58
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	836107	836740	4077713		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000380747.1|836107_836740_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 59
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	855816	857319	4077713		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000526259.1|855816_857319_-	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 60
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	861046	864699	4077713		Tupanvirus(50.0%)	3	NA	NA
WP_000114637.1|861046_861937_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
WP_001048573.1|861951_863118_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000082610.1|863265_864699_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
>prophage 61
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	877824	879711	4077713		Vibrio_phage(100.0%)	1	NA	NA
WP_001281941.1|877824_879711_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 62
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	887521	888793	4077713	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000566834.1|887521_888793_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	2.0e-96
>prophage 63
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	904669	907549	4077713	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_046882695.1|904669_907549_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	2.8e-146
>prophage 64
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	911653	912841	4077713		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002010839.1|911653_912841_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	4.9e-44
>prophage 65
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	923002	923857	4077713		Pandoravirus(100.0%)	1	NA	NA
WP_001143937.1|923002_923857_+	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 66
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	953597	955646	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_000836155.1|953597_955646_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	29.5	4.4e-93
>prophage 67
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	958777	959713	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_002027092.1|958777_959713_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.5e-08
>prophage 68
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	963260	964475	4077713		Salmonella_phage(100.0%)	1	NA	NA
WP_000003698.1|963260_964475_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	1.0e-28
>prophage 69
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	976189	989561	4077713		Bacillus_phage(20.0%)	8	NA	NA
WP_083042138.1|976189_980710_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	39.3	5.6e-16
WP_000505932.1|980856_982935_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
WP_000729762.1|982981_983518_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000101096.1|983578_983941_-	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
WP_000389061.1|983964_984348_-	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
WP_001981151.1|984669_985269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260821.1|985328_986447_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_083042139.1|986462_989561_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.4	1.4e-95
>prophage 70
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	993057	994277	4077713	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085944009.1|993057_994277_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
>prophage 71
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1003748	1013488	4077713		Bacillus_virus(25.0%)	9	NA	NA
WP_001114565.1|1003748_1004573_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	1.9e-26
WP_001192454.1|1004592_1004883_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001072494.1|1004893_1005247_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000022555.1|1005389_1005821_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_001280092.1|1006075_1007911_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
WP_000070856.1|1008089_1009448_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
WP_000371528.1|1009510_1010524_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000004971.1|1010545_1012006_+	amino acid permease	NA	NA	NA	NA	NA
WP_000512708.1|1012282_1013488_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	6.1e-127
>prophage 72
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1017625	1017979	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000457785.1|1017625_1017979_-	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	58.9	1.8e-26
>prophage 73
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1055731	1059210	4077713		Diadromus_pulchellus_ascovirus(33.33%)	3	NA	NA
WP_000199593.1|1055731_1056904_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
WP_001160210.1|1057017_1058460_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
WP_000680577.1|1058523_1059210_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
>prophage 74
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1073226	1075005	4077713	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_000986451.1|1073226_1075005_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 75
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1088355	1089624	4077713		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_083042151.1|1088355_1089624_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	25.2	4.6e-08
>prophage 76
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1093476	1099282	4077713	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_083042154.1|1093476_1094610_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.2	8.3e-94
WP_000051669.1|1094708_1095038_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001270222.1|1095089_1096991_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001984787.1|1096999_1097965_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_083042155.1|1098028_1099282_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
>prophage 77
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1107248	1108583	4077713		Indivirus(50.0%)	2	NA	NA
WP_000587649.1|1107248_1107686_-	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	9.9e-11
WP_000543478.1|1107686_1108583_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
>prophage 78
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1119119	1120220	4077713		Bacillus_phage(100.0%)	1	NA	NA
WP_000451187.1|1119119_1120220_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	1.8e-13
>prophage 79
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1132011	1132440	4077713	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000003709.1|1132011_1132440_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 80
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1138848	1139775	4077713		Mollivirus(100.0%)	1	NA	NA
WP_000344602.1|1138848_1139775_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.3	3.1e-06
>prophage 81
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1157114	1161924	4077713	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_000792525.1|1157114_1159058_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
WP_000218140.1|1159346_1160798_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_001986628.1|1160880_1161924_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
>prophage 82
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1176326	1180947	4077713		Lactococcus_phage(50.0%)	2	NA	NA
WP_004735401.1|1176326_1178759_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	4.3e-71
WP_000266469.1|1178892_1180947_+	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.8	4.3e-32
>prophage 83
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1206345	1207893	4077713		Klebsiella_phage(100.0%)	1	NA	NA
WP_000537110.1|1206345_1207893_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	5.3e-75
>prophage 84
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1221455	1222037	4077713		Orpheovirus(100.0%)	1	NA	NA
WP_001084310.1|1221455_1222037_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 85
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1225697	1228755	4077713		Planktothrix_phage(50.0%)	3	NA	NA
WP_004735419.1|1225697_1226516_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
WP_001232173.1|1226642_1226813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083042159.1|1226919_1228755_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.9e-45
>prophage 86
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1232325	1232928	4077713		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001121174.1|1232325_1232928_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 87
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1261410	1262625	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_000437498.1|1261410_1262625_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.8e-25
>prophage 88
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1273051	1277237	4077713		Salmonella_phage(100.0%)	3	NA	NA
WP_001143890.1|1273051_1273627_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.4	9.2e-41
WP_001061807.1|1273820_1275971_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000790122.1|1276007_1277237_-	MFS transporter	NA	S4TR35	Salmonella_phage	22.3	1.0e-12
>prophage 89
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1281409	1282642	4077713		Catovirus(100.0%)	1	NA	NA
WP_000077814.1|1281409_1282642_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 90
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1300429	1303724	4077713		Liberibacter_phage(50.0%)	3	NA	NA
WP_000015937.1|1300429_1301059_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
WP_000135049.1|1301131_1301410_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001117590.1|1301618_1303724_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
>prophage 91
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1309672	1310263	4077713		Lactococcus_phage(100.0%)	1	NA	NA
WP_000846931.1|1309672_1310263_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 92
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1346163	1349322	4077713		Leptospira_phage(100.0%)	1	NA	NA
WP_000353979.1|1346163_1349322_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	21.0	9.3e-26
>prophage 93
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1355758	1357420	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_000090021.1|1355758_1357420_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
>prophage 94
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1365724	1367964	4077713		Bacillus_phage(100.0%)	2	NA	NA
WP_000060753.1|1365724_1366489_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
WP_000051217.1|1366506_1367964_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
>prophage 95
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1374797	1376489	4077713		Planktothrix_phage(100.0%)	1	NA	NA
WP_000670484.1|1374797_1376489_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.4	1.0e-10
>prophage 96
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1385254	1388966	4077713		Enterobacteria_phage(50.0%)	3	NA	NA
WP_004735488.1|1385254_1386358_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
WP_000581865.1|1386589_1387033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001181667.1|1387088_1388966_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
>prophage 97
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1395863	1396226	4077713		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000897078.1|1395863_1396226_-	hypothetical protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	52.8	9.3e-07
>prophage 98
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1414421	1417370	4077713		Klosneuvirus(50.0%)	2	NA	NA
WP_000380899.1|1414421_1415714_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
WP_000179710.1|1415825_1417370_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
>prophage 99
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1420850	1424077	4077713		Salmonella_phage(50.0%)	3	NA	NA
WP_001215080.1|1420850_1421432_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
WP_000980460.1|1421483_1422848_-	MFS transporter	NA	NA	NA	NA	NA
WP_000680214.1|1422994_1424077_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.3	1.8e-90
>prophage 100
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1427757	1436250	4077713	holin	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_000083354.1|1427757_1430592_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_000016120.1|1430625_1432332_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	3.7e-13
WP_000733005.1|1433324_1434224_+	porin Omp33-36	NA	NA	NA	NA	NA
WP_001139474.1|1434282_1436250_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-26
>prophage 101
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1439510	1443008	4077713		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001089744.1|1439510_1443008_+	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 102
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1448333	1450283	4077713		Staphylococcus_phage(100.0%)	1	NA	NA
WP_083042162.1|1448333_1450283_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	1.9e-93
>prophage 103
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1455979	1464607	4077713		Pseudomonas_phage(33.33%)	7	NA	NA
WP_096640204.1|1455979_1457075_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
WP_000748568.1|1457284_1458142_+	putative porin	NA	NA	NA	NA	NA
WP_000731727.1|1458475_1459243_+	putative porin	NA	NA	NA	NA	NA
WP_000161621.1|1459285_1460986_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.8	1.1e-65
WP_002000775.1|1460986_1461652_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000119867.1|1461653_1462991_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000956023.1|1463140_1464607_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
>prophage 104
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1474637	1475330	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_000557457.1|1474637_1475330_-	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 105
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1492805	1495086	4077713		Tupanvirus(50.0%)	2	NA	NA
WP_001025109.1|1492805_1493717_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.2	1.9e-08
WP_119947380.1|1494003_1495086_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.8	1.1e-21
>prophage 106
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1507412	1509296	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_000195974.1|1507412_1509296_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.7e-99
>prophage 107
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1517399	1522970	4077713		Acidovorax_phage(50.0%)	2	NA	NA
WP_001036456.1|1517399_1519640_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218M2Y4	Acidovorax_phage	38.8	1.9e-17
WP_000898329.1|1519643_1522970_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	73.3	0.0e+00
>prophage 108
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1532566	1534645	4077713		Bacillus_phage(100.0%)	2	NA	NA
WP_000650777.1|1532566_1533277_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.9e-33
WP_000273188.1|1533286_1534645_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.7e-30
>prophage 109
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1537976	1539191	4077713		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000074562.1|1537976_1539191_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.6	2.2e-47
>prophage 110
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1544150	1550875	4077713		Staphylococcus_phage(50.0%)	7	NA	NA
WP_001131392.1|1544150_1545272_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.9	1.9e-53
WP_001007829.1|1545283_1545754_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_000084188.1|1545757_1546207_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_000807404.1|1546222_1547140_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000380677.1|1547117_1547651_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000108581.1|1547659_1549024_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	5.8e-33
WP_000334189.1|1549036_1550875_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.5	8.4e-128
>prophage 111
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1558267	1559806	4077713		Catovirus(100.0%)	1	NA	NA
WP_000421600.1|1558267_1559806_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 112
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1563497	1564610	4077713		Gordonia_phage(100.0%)	1	NA	NA
WP_001246970.1|1563497_1564610_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.6	3.6e-09
>prophage 113
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1576864	1585108	4077713		Tupanvirus(20.0%)	10	NA	NA
WP_000783437.1|1576864_1577509_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	1.4e-26
WP_000193600.1|1577838_1578732_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001177091.1|1578747_1579350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917863.1|1579387_1580107_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
WP_000418559.1|1580299_1580503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349494.1|1580788_1581628_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	4.6e-41
WP_001285406.1|1581643_1582909_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.7e-79
WP_161795017.1|1583014_1584136_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000102817.1|1584296_1584755_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000490267.1|1584949_1585108_+	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
>prophage 114
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1589208	1593939	4077713		Tupanvirus(50.0%)	6	NA	NA
WP_000069845.1|1589208_1590237_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
WP_000143933.1|1590239_1591664_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001985074.1|1591624_1591747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770095.1|1591754_1592129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843073.1|1592112_1593015_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001025220.1|1593135_1593939_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	1.3e-37
>prophage 115
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1597347	1598460	4077713		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001119029.1|1597347_1598460_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 116
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1607237	1608533	4077713		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000073451.1|1607237_1608533_+	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	64.8	1.9e-150
>prophage 117
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1614101	1615064	4077713	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000691199.1|1614101_1615064_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 118
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1629893	1630229	4077713		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000993572.1|1629893_1630229_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 119
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1634220	1645295	4077713		Tupanvirus(20.0%)	10	NA	NA
WP_000613985.1|1634220_1636152_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
WP_001009202.1|1636402_1636960_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_000987631.1|1637045_1637438_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000093726.1|1637475_1639944_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_023060355.1|1639996_1641079_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_170318963.1|1641093_1641843_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.9	1.1e-30
WP_000964768.1|1642339_1643737_-	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_000831329.1|1644407_1644542_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_001240377.1|1644571_1644964_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000251652.1|1644974_1645295_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
>prophage 120
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1651112	1657275	4077713		uncultured_virus(33.33%)	6	NA	NA
WP_000214980.1|1651112_1651640_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
WP_000052265.1|1651854_1653180_-	guanine deaminase	NA	NA	NA	NA	NA
WP_000991561.1|1653236_1654292_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000823186.1|1654582_1655743_-	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	45.0	6.3e-97
WP_001256727.1|1655764_1656130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447695.1|1656318_1657275_-	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.5	2.2e-31
>prophage 121
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1661806	1662319	4077713		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000994663.1|1661806_1662319_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 122
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1668305	1670246	4077713		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001062605.1|1668305_1670246_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
>prophage 123
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1674317	1676089	4077713		Tupanvirus(50.0%)	2	NA	NA
WP_000123586.1|1674317_1675388_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	1.3e-11
WP_001194327.1|1675603_1676089_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
>prophage 124
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1684013	1686851	4077713	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001281047.1|1684013_1686851_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.0	7.2e-78
>prophage 125
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1690818	1691619	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_000183291.1|1690818_1691619_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 126
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1714363	1727572	4077713		Catovirus(40.0%)	12	NA	NA
WP_001075315.1|1714363_1716559_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	34.2	6.9e-20
WP_001176904.1|1716580_1717009_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_001190673.1|1717010_1718153_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_000487067.1|1718315_1719593_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1I178	Paramecium_bursaria_Chlorella_virus	28.5	5.4e-25
WP_000242923.1|1719595_1720885_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000584983.1|1720884_1721832_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.5	1.2e-08
WP_000367709.1|1721838_1723221_+	O-antigen polysaccharide polymerase Wzy	NA	NA	NA	NA	NA
WP_000142497.1|1723225_1724167_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.5	8.9e-17
WP_000697341.1|1724170_1725205_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000493217.1|1725211_1726039_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025464653.1|1726051_1726672_+	sugar transferase	NA	NA	NA	NA	NA
WP_000591447.1|1726696_1727572_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	44.5	1.6e-60
>prophage 127
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1730609	1731629	4077713		Tupanvirus(100.0%)	1	NA	NA
WP_001062909.1|1730609_1731629_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.5	1.2e-80
>prophage 128
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1748319	1749039	4077713		Vibrio_phage(100.0%)	1	NA	NA
WP_000570302.1|1748319_1749039_+	hypothetical protein	NA	R9TNR7	Vibrio_phage	53.4	1.8e-70
>prophage 129
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1756569	1759332	4077713		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002008008.1|1756569_1759332_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	51.2	2.7e-287
>prophage 130
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1780087	1781737	4077713		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000969573.1|1780087_1781737_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	1.2e-80
>prophage 131
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1784828	1791291	4077713		Burkholderia_virus(33.33%)	5	NA	NA
WP_001193285.1|1784828_1786181_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	3.8e-53
WP_085943996.1|1786274_1786841_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000253661.1|1786904_1787321_-	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_000446790.1|1788079_1788796_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.2	7.3e-19
WP_000290082.1|1789401_1791291_+	fatty acyl-AMP ligase	NA	A0A1V0SBX8	Catovirus	22.7	1.3e-11
>prophage 132
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1806259	1807102	4077713		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000957990.1|1806259_1807102_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.5	1.0e-11
>prophage 133
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1811249	1812818	4077713		Hokovirus(100.0%)	1	NA	NA
WP_000210748.1|1811249_1812818_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	3.3e-24
>prophage 134
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1817900	1819691	4077713	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001090288.1|1817900_1819691_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.3e-16
>prophage 135
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1824447	1825236	4077713		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001112013.1|1824447_1825236_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 136
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1839688	1843267	4077713		Pandoravirus(33.33%)	4	NA	NA
WP_000633612.1|1839688_1840258_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
WP_002009557.1|1840308_1841439_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	4.8e-25
WP_000755280.1|1841459_1842614_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001196539.1|1842736_1843267_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
>prophage 137
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1860011	1862390	4077713		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000102052.1|1860011_1862390_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 138
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1866979	1867702	4077713		Bacillus_phage(100.0%)	1	NA	NA
WP_002009395.1|1866979_1867702_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	33.3	1.0e-28
>prophage 139
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1871493	1882599	4077713		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_001986939.1|1871493_1872099_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
WP_000575778.1|1872443_1874036_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_000194004.1|1874107_1874575_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000927792.1|1874620_1875265_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000366687.1|1875347_1876667_+	MFS transporter	NA	NA	NA	NA	NA
WP_000202253.1|1876820_1879040_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000411991.1|1879337_1881017_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_001187001.1|1881055_1881439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985514.1|1881533_1881944_+	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_000122443.1|1882071_1882599_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
>prophage 140
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1889840	1890551	4077713	transposase	Vibriophage(100.0%)	1	NA	NA
WP_000736399.1|1889840_1890551_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 141
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1897140	1899471	4077713		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000034564.1|1897140_1897992_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001277980.1|1898004_1899471_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
>prophage 142
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1908305	1916345	4077713		Staphylococcus_phage(40.0%)	9	NA	NA
WP_000738520.1|1908305_1909703_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000543541.1|1909861_1910320_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_001292499.1|1910335_1911421_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	1.9e-47
WP_001083669.1|1911417_1912710_+	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_000493866.1|1912752_1913412_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_000354154.1|1913470_1913689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988710.1|1913819_1914458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151591.1|1914496_1914904_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000673449.1|1914896_1916345_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
>prophage 143
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1920347	1924505	4077713		Moraxella_phage(50.0%)	3	NA	NA
WP_000939107.1|1920347_1921532_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000840547.1|1921535_1922957_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_002009561.1|1922981_1924505_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	1.8e-06
>prophage 144
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1930265	1931186	4077713		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000608735.1|1930265_1931186_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
>prophage 145
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1957508	1964659	4077713		Vibrio_phage(33.33%)	5	NA	NA
WP_001196426.1|1957508_1959785_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	35.2	2.0e-30
WP_000219964.1|1959825_1960455_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_000109465.1|1960520_1961189_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000209085.1|1961297_1962791_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	1.0e-35
WP_001029610.1|1963468_1964659_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 146
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1968633	1979628	4077713		Tetraselmis_virus(33.33%)	6	NA	NA
WP_000331899.1|1968633_1972722_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
WP_000653927.1|1972808_1977002_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
WP_000738605.1|1977168_1977534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034851.1|1977749_1978106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996189.1|1978134_1978632_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_161795022.1|1978749_1979628_+	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	32.0	7.8e-07
>prophage 147
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1982703	1984623	4077713		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001294942.1|1982703_1984623_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.0e-119
>prophage 148
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	1995477	1996392	4077713		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000598896.1|1995477_1996392_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	3.1e-38
>prophage 149
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2003274	2004737	4077713		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001178154.1|2003274_2004129_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	3.6e-17
WP_000171255.1|2004125_2004737_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	40.3	1.8e-18
>prophage 150
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2024561	2027261	4077713		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000130326.1|2024561_2027261_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 151
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2035683	2037186	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000065138.1|2035683_2037186_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
>prophage 152
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2040295	2041915	4077713		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_000612218.1|2040295_2041915_-	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.7	1.6e-29
>prophage 153
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2050394	2055935	4077713		Bacillus_phage(50.0%)	2	NA	NA
WP_085944017.1|2050394_2054075_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	22.1	1.3e-10
WP_000369442.1|2054183_2055935_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	22.8	3.0e-18
>prophage 154
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2062660	2063617	4077713		Megavirus(100.0%)	1	NA	NA
WP_001107923.1|2062660_2063617_-	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	50.6	5.2e-12
>prophage 155
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2081871	2088402	4077713		Streptococcus_phage(33.33%)	9	NA	NA
WP_000942271.1|2081871_2082516_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	1.8e-21
WP_001138289.1|2082512_2082707_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_164545309.1|2082794_2083433_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001284662.1|2083422_2084628_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_000075981.1|2084705_2085116_+	GFA family protein	NA	NA	NA	NA	NA
WP_000291739.1|2085351_2085732_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	1.0e-24
WP_000046495.1|2086160_2086493_-	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_001224256.1|2086747_2087002_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001096912.1|2087103_2088402_-	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
>prophage 156
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2112166	2114461	4077713		Hokovirus(100.0%)	1	NA	NA
WP_000069121.1|2112166_2114461_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 157
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2134308	2147808	4077713		Morganella_phage(25.0%)	12	NA	NA
WP_000078868.1|2134308_2135244_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.0	6.7e-41
WP_000886290.1|2135363_2135996_-	LysE family translocator	NA	NA	NA	NA	NA
WP_001245077.1|2136136_2137144_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000323469.1|2137163_2139074_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.3e-46
WP_000165735.1|2139106_2139352_+	SlyX family protein	NA	NA	NA	NA	NA
WP_000648637.1|2139400_2140411_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001029768.1|2140510_2140888_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000368721.1|2141035_2141485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024268.1|2141520_2144157_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
WP_000265773.1|2144243_2145002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859452.1|2145139_2145712_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000050370.1|2145828_2147808_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.4	1.2e-63
>prophage 158
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2158935	2160332	4077713		Erwinia_phage(50.0%)	2	NA	NA
WP_000312548.1|2158935_2159445_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.0	2.4e-24
WP_001203170.1|2159489_2160332_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	7.1e-98
>prophage 159
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2170524	2171151	4077713		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000106727.1|2170524_2171151_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	6.8e-13
>prophage 160
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2176475	2177168	4077713		Synechococcus_phage(100.0%)	1	NA	NA
WP_085944011.1|2176475_2177168_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	34.2	1.7e-20
>prophage 161
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2181495	2183516	4077713	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_000289452.1|2181495_2182101_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001289250.1|2182202_2183516_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
>prophage 162
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2197490	2198756	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_001154159.1|2197490_2198756_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 163
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2202803	2207845	4077713		Moraxella_phage(50.0%)	5	NA	NA
WP_000776302.1|2202803_2204987_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	48.7	2.0e-184
WP_000348499.1|2205125_2206424_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000669565.1|2206448_2207000_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000524329.1|2207099_2207300_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000963851.1|2207413_2207845_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
>prophage 164
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2218020	2220554	4077713		Salicola_phage(50.0%)	4	NA	NA
WP_000729828.1|2218020_2218278_-	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
WP_000443006.1|2218289_2218706_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001173998.1|2218803_2219862_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000099436.1|2219987_2220554_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
>prophage 165
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2223867	2238159	4077713	tRNA	Planktothrix_phage(20.0%)	10	NA	NA
WP_000165905.1|2223867_2225862_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.3e-36
WP_001124216.1|2225864_2227205_-	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
WP_000762831.1|2227312_2228302_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000549819.1|2228321_2228831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155770.1|2228858_2231483_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	2.0e-175
WP_001054458.1|2231669_2232005_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_000422094.1|2232509_2234234_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
WP_001215920.1|2234233_2234725_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_001165443.1|2234757_2235774_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000510217.1|2236104_2238159_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
>prophage 166
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2241692	2249847	4077713	transposase	uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004735888.1|2241692_2244755_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	65.7	3.1e-260
WP_002001451.1|2245723_2246908_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|2246956_2247142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|2247361_2247643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|2247623_2248397_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_001206290.1|2248638_2249847_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
>prophage 167
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2253889	2255482	4077713		Tupanvirus(100.0%)	1	NA	NA
WP_000008538.1|2253889_2255482_+	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 168
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2261834	2262599	4077713	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_001281713.1|2261834_2262599_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	1.5e-14
>prophage 169
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2265782	2266931	4077713	integrase	uncultured_Caudovirales_phage(100.0%)	1	2262238:2262251	2274412:2274425
2262238:2262251	attL	CAAAACTGGCTTTA	NA	NA	NA	NA
WP_000534870.1|2265782_2266931_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.4	2.9e-94
WP_000534870.1|2265782_2266931_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.4	2.9e-94
2274412:2274425	attR	TAAAGCCAGTTTTG	NA	NA	NA	NA
>prophage 170
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2271293	2272513	4077713	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085944009.1|2271293_2272513_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
>prophage 171
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2277183	2284625	4077713		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_000951115.1|2277183_2278233_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.4	2.8e-59
WP_000248861.1|2278553_2279435_-	CopD family protein	NA	NA	NA	NA	NA
WP_000689218.1|2279502_2279883_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_001015465.1|2280161_2282528_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	1.5e-89
WP_000149044.1|2282575_2283952_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001221577.1|2283941_2284625_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	1.3e-30
>prophage 172
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2299231	2303493	4077713		uncultured_Caudovirales_phage(80.0%)	6	NA	NA
WP_000156165.1|2299231_2299666_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.0	5.3e-41
WP_000373082.1|2299723_2300044_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	56.7	2.8e-23
WP_000670217.1|2300050_2300524_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.6	1.7e-37
WP_000068657.1|2300531_2301572_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001052986.1|2301576_2302281_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.2	3.7e-92
WP_000482798.1|2302344_2303493_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.1	4.4e-26
>prophage 173
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2314663	2320800	4077713		Hokovirus(33.33%)	4	NA	NA
WP_000064534.1|2314663_2317471_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
WP_002000561.1|2317634_2318558_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
WP_001212166.1|2318580_2319399_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000813068.1|2319408_2320800_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.0	4.4e-28
>prophage 174
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2325406	2326840	4077713		unidentified_phage(100.0%)	1	NA	NA
WP_169518021.1|2325406_2326840_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	3.5e-20
>prophage 175
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2330766	2335286	4077713	tRNA	Staphylococcus_phage(33.33%)	3	NA	NA
WP_000253052.1|2330766_2332395_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.9e-28
WP_001121792.1|2332806_2334729_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	9.1e-125
WP_012297364.1|2334734_2335286_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
>prophage 176
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2338790	2347527	4077713	tRNA	Serratia_phage(25.0%)	9	NA	NA
WP_000650941.1|2338790_2339348_+	NADAR family protein	NA	A0A1S6UAJ7	Serratia_phage	45.9	2.1e-34
WP_000803547.1|2339406_2339910_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001207250.1|2339916_2340918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050953.1|2341075_2342056_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.5e-35
WP_000703087.1|2342089_2344471_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000126166.1|2344467_2344764_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_000897675.1|2344934_2345195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054522.1|2345610_2346879_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_001276875.1|2347200_2347527_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
>prophage 177
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2352966	2355738	4077713		uncultured_virus(100.0%)	1	NA	NA
WP_001134663.1|2352966_2355738_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.7	1.4e-65
>prophage 178
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2380051	2381407	4077713		Pandoravirus(100.0%)	1	NA	NA
WP_031946127.1|2380051_2381407_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.6	1.2e-25
>prophage 179
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2395748	2396021	4077713		uncultured_virus(100.0%)	1	NA	NA
WP_000843451.1|2395748_2396021_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	1.1e-07
>prophage 180
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2402788	2403268	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_000927491.1|2402788_2403268_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	44.5	4.5e-25
>prophage 181
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2420501	2421812	4077713		Burkholderia_virus(100.0%)	1	NA	NA
WP_000383636.1|2420501_2421812_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 182
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2439475	2448743	4077713		Bacillus_phage(40.0%)	8	NA	NA
WP_000025827.1|2439475_2440759_-	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
WP_000465010.1|2440896_2441031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111540.1|2441087_2443922_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000143214.1|2444251_2444458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000076440.1|2444454_2445171_+	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000226708.1|2445260_2446853_+	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	9.2e-06
WP_085944030.1|2446875_2447175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147032.1|2447321_2448743_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
>prophage 183
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2479888	2481097	4077713	transposase	Bluetongue_virus(100.0%)	1	NA	NA
WP_001206290.1|2479888_2481097_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
>prophage 184
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2485470	2486040	4077713		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000985728.1|2485470_2486040_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 185
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2505691	2507728	4077713		Ralstonia_phage(100.0%)	1	NA	NA
WP_001018838.1|2505691_2507728_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.2	4.6e-119
>prophage 186
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2513451	2518908	4077713		Klosneuvirus(33.33%)	6	NA	NA
WP_000131424.1|2513451_2514732_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	5.8e-19
WP_000054319.1|2514733_2515891_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	6.0e-31
WP_000055881.1|2515887_2516637_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000016597.1|2516637_2517282_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001291249.1|2517346_2518270_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000093856.1|2518311_2518908_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
>prophage 187
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2523346	2527376	4077713		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_000191300.1|2523346_2524081_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
WP_001279871.1|2524165_2524402_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
WP_000522216.1|2524592_2525066_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_001247943.1|2525111_2525879_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000985178.1|2525976_2526651_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000096537.1|2526716_2527376_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	1.6e-41
>prophage 188
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2531699	2532650	4077713		Tupanvirus(100.0%)	1	NA	NA
WP_001133287.1|2531699_2532650_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 189
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2537636	2539502	4077713		Caulobacter_phage(100.0%)	1	NA	NA
WP_001007235.1|2537636_2539502_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.1	9.3e-58
>prophage 190
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2543503	2544872	4077713		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001029798.1|2543503_2543980_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
WP_000047853.1|2544115_2544607_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001979799.1|2544608_2544872_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
>prophage 191
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2548999	2551638	4077713		Vibrio_phage(50.0%)	2	NA	NA
WP_001984224.1|2548999_2550652_+	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
WP_000214726.1|2550663_2551638_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.7	7.3e-30
>prophage 192
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2556614	2558240	4077713		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000834616.1|2556614_2558240_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
>prophage 193
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2565012	2568436	4077713		Streptococcus_phage(50.0%)	2	NA	NA
WP_000113824.1|2565012_2567151_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
WP_001029610.1|2567245_2568436_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 194
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2572927	2577177	4077713		Orpheovirus(50.0%)	2	NA	NA
WP_001276144.1|2572927_2573875_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
WP_000127839.1|2574144_2577177_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
>prophage 195
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2584142	2588276	4077713		Bacillus_phage(66.67%)	3	NA	NA
WP_000093035.1|2584142_2586182_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
WP_000868152.1|2586205_2586658_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
WP_001102836.1|2586857_2588276_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	4.6e-41
>prophage 196
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2597583	2601180	4077713		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000698789.1|2597583_2601180_-	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	5.8e-08
>prophage 197
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2622165	2628278	4077713		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000627736.1|2622165_2623647_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.2	4.2e-37
WP_000121371.1|2623643_2624804_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000064546.1|2624834_2628278_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	24.1	1.3e-09
>prophage 198
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2651487	2659401	4077713	holin	Vibrio_phage(66.67%)	5	NA	NA
WP_001021934.1|2651487_2653146_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_001286303.1|2653241_2654714_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001985959.1|2654706_2655342_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000243373.1|2655594_2657217_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.3	3.9e-20
WP_000179783.1|2657334_2659401_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
>prophage 199
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2670206	2670788	4077713		Raoultella_phage(100.0%)	1	NA	NA
WP_000074686.1|2670206_2670788_+	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	29.1	8.0e-08
>prophage 200
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2678735	2687765	4077713		Mycobacterium_phage(25.0%)	8	NA	NA
WP_000988607.1|2678735_2679560_+	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	30.8	6.8e-13
WP_000009973.1|2679575_2680370_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000735778.1|2680385_2681177_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_001040544.1|2681190_2682657_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000140239.1|2682694_2684335_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.5	2.7e-24
WP_002000879.1|2684511_2685687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371871.1|2685749_2687048_-	MFS transporter	NA	NA	NA	NA	NA
WP_000117824.1|2687282_2687765_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.9e-19
>prophage 201
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2698359	2702046	4077713		Dickeya_phage(100.0%)	1	NA	NA
WP_000105326.1|2698359_2702046_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 202
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2718417	2719110	4077713		Bacillus_phage(100.0%)	1	NA	NA
WP_001136100.1|2718417_2719110_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.6e-10
>prophage 203
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2730482	2737322	4077713	tRNA	Vibrio_phage(33.33%)	6	NA	NA
WP_000697205.1|2730482_2730971_-	esterase	NA	A0A2I7QX93	Vibrio_phage	24.0	9.0e-05
WP_001128173.1|2731194_2732757_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	5.5e-88
WP_000479765.1|2732946_2734389_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_002011285.1|2734645_2734777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140408.1|2734769_2735678_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_000019502.1|2735708_2737322_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
>prophage 204
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2765326	2767756	4077713		Moraxella_phage(100.0%)	1	NA	NA
WP_001292274.1|2765326_2767756_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 205
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2779595	2780432	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_001275994.1|2779595_2780432_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	6.9e-45
>prophage 206
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2785223	2790051	4077713		Bradyrhizobium_phage(50.0%)	2	NA	NA
WP_002011229.1|2785223_2786603_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_000277830.1|2786835_2790051_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	38.1	7.3e-26
>prophage 207
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2793971	2805266	4077713	transposase	Planktothrix_phage(20.0%)	8	NA	NA
WP_000550792.1|2793971_2795561_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	2.5e-19
WP_000077957.1|2795746_2796991_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_085944009.1|2797094_2798313_+|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
WP_000364478.1|2798361_2800476_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001982681.1|2800754_2801417_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|2801401_2802436_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013374.1|2802585_2803848_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001986427.1|2803907_2805266_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
>prophage 208
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2813147	2814128	4077713		Microcystis_virus(100.0%)	1	NA	NA
WP_001259241.1|2813147_2814128_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	27.0	2.4e-12
>prophage 209
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2841545	2842781	4077713		Klosneuvirus(100.0%)	1	NA	NA
WP_001058605.1|2841545_2842781_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.3	3.4e-24
>prophage 210
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2898133	2911100	4077713	tRNA	Moraxella_phage(20.0%)	11	NA	NA
WP_000729975.1|2898133_2899453_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	5.4e-60
WP_001077407.1|2899564_2900563_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111768.1|2900608_2901166_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|2901404_2901794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495834.1|2901859_2902426_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
WP_000906487.1|2902495_2902750_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|2902996_2904277_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000199465.1|2904342_2906979_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.1e-75
WP_001188823.1|2907248_2908274_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000155680.1|2908549_2909716_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|2909780_2911100_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
>prophage 211
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2915786	2920019	4077713		Planktothrix_phage(33.33%)	3	NA	NA
WP_001237344.1|2915786_2916593_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001210050.1|2916893_2919473_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_000941316.1|2919530_2920019_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
>prophage 212
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2933910	2941826	4077713		Lactococcus_phage(50.0%)	6	NA	NA
WP_000558744.1|2933910_2935497_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
WP_000058246.1|2935737_2935956_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_001133995.1|2935992_2936580_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_000024050.1|2936644_2936860_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001987180.1|2937052_2937628_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_000931783.1|2937968_2941826_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
>prophage 213
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2960776	2978040	4077713	capsid,transposase	Acinetobacter_phage(66.67%)	22	NA	NA
WP_000377575.1|2960776_2963248_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	2.3e-96
WP_001020654.1|2963323_2963725_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000331886.1|2963752_2964160_+	GFA family protein	NA	NA	NA	NA	NA
WP_001088961.1|2964752_2965109_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000980495.1|2965588_2965918_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
WP_000253376.1|2966357_2966951_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|2967001_2967226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998195.1|2967450_2967645_-	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
WP_001283237.1|2967637_2968900_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.2	4.3e-14
WP_000636785.1|2969405_2969639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185369.1|2969793_2970465_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_000016212.1|2970700_2970898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427176.1|2971065_2971455_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	75.2	9.6e-50
WP_046882650.1|2971492_2972038_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	71.3	1.1e-72
WP_000015971.1|2972104_2972722_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|2973241_2973457_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350299.1|2973660_2973885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932369.1|2974163_2974979_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001982898.1|2975135_2975255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|2975741_2976200_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_001004679.1|2976491_2976836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790406.1|2976933_2978040_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	65.7	2.5e-143
>prophage 214
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	2986013	3006611	4077713	capsid,terminase	Acinetobacter_phage(63.16%)	32	NA	NA
WP_001207483.1|2986013_2987132_-	ATP-binding protein	NA	A0A0P0HSM9	Acinetobacter_phage	92.9	2.6e-196
WP_000993665.1|2987143_2987473_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	66.0	7.1e-30
WP_000812654.1|2987475_2987664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023060505.1|2987827_2988712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000204265.1|2988713_2989763_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000863485.1|2989765_2990623_-	site-specific DNA-methyltransferase	NA	C5IHN3	Burkholderia_virus	48.5	1.5e-74
WP_025464659.1|2990706_2991372_-	peptidase S24	NA	A0A0R6PJ00	Moraxella_phage	39.7	1.5e-26
WP_000104069.1|2991528_2991786_+	hypothetical protein	NA	A0A0P0IY81	Acinetobacter_phage	40.6	2.7e-08
WP_001258348.1|2991816_2992101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081411.1|2992154_2992430_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	86.8	6.1e-35
WP_000102848.1|2992426_2992720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050658.1|2992716_2993679_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	54.4	4.4e-19
WP_001031747.1|2993675_2993804_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	92.9	9.5e-15
WP_000030900.1|2993796_2994003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378364.1|2993992_2994316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000100188.1|2994315_2994717_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	95.5	2.0e-66
WP_000959660.1|2994727_2995480_+	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	95.6	4.6e-133
WP_001017703.1|2995623_2995842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046882649.1|2996108_2996453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152665.1|2996661_2996898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195754.1|2997559_2998015_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.0	2.1e-80
WP_000378505.1|2998075_2998510_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	96.5	3.5e-77
WP_000435242.1|2998478_2999120_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	91.5	2.0e-116
WP_000729394.1|2999179_2999656_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_001088669.1|2999633_3001160_+|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.0	1.0e-91
WP_000852312.1|3001168_3002503_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	2.9e-85
WP_000207479.1|3002447_3003260_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.8	1.3e-51
WP_004736136.1|3003248_3003551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823405.1|3003594_3003894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849768.1|3003947_3005147_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	35.5	7.4e-24
WP_000240727.1|3005160_3005631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039808.1|3005636_3006611_+	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
>prophage 215
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3010690	3013462	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000002829.1|3010690_3013462_+	hypothetical protein	NA	A0A1B1P9E6	Acinetobacter_phage	31.5	1.1e-59
>prophage 216
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3018578	3044002	4077713	tRNA,integrase	Acinetobacter_phage(31.25%)	26	3009644:3009658	3034984:3034998
3009644:3009658	attL	ACCGGTACAGGTAAA	NA	NA	NA	NA
WP_001171474.1|3018578_3019007_+	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	34.6	4.5e-08
WP_000508789.1|3019006_3021496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023060509.1|3021559_3021949_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	94.6	6.8e-64
WP_001021568.1|3022060_3022603_+	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_001100986.1|3022628_3022808_+	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001017972.1|3022869_3023412_+	N-acetylmuramidase	NA	A0A0B5L5G0	Acinetobacter_phage	93.9	1.2e-95
WP_000566933.1|3023692_3024283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200052.1|3024345_3024540_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	85.5	1.7e-23
WP_001171605.1|3024568_3025582_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	3.8e-66
WP_001182278.1|3025935_3027357_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.5e-55
WP_001133560.1|3027570_3028548_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	1.1e-38
WP_000179337.1|3028551_3029091_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|3029128_3029677_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|3029660_3030209_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|3030208_3030955_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_015451474.1|3031472_3032696_+	TolC family protein	NA	NA	NA	NA	NA
WP_000988402.1|3032692_3034834_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_000003555.1|3034830_3036021_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
3034984:3034998	attR	ACCGGTACAGGTAAA	NA	NA	NA	NA
WP_000885988.1|3036114_3036714_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000132360.1|3036706_3037318_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	2.1e-11
WP_001082435.1|3037473_3038316_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	7.7e-36
WP_001186837.1|3038432_3039101_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
WP_000232555.1|3039240_3039912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|3040092_3040416_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_031946146.1|3040761_3041292_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001083260.1|3041356_3044002_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.1e-32
>prophage 217
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3047711	3048644	4077713		Morganella_phage(100.0%)	1	NA	NA
WP_000165403.1|3047711_3048644_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 218
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3066294	3075693	4077713		Moraxella_phage(66.67%)	3	NA	NA
WP_000698630.1|3066294_3067515_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.3	1.2e-32
WP_001179931.1|3067862_3069602_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	34.5	8.9e-79
WP_002015586.1|3069648_3075693_+	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.3	2.8e-111
>prophage 219
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3079320	3080484	4077713		Synechococcus_phage(100.0%)	1	NA	NA
WP_001202393.1|3079320_3080484_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.8e-11
>prophage 220
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3091675	3096774	4077713		Bacillus_virus(50.0%)	4	NA	NA
WP_001000093.1|3091675_3092557_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	6.6e-38
WP_000542522.1|3092556_3093501_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070712.1|3093596_3093998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002011259.1|3094143_3096774_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	54.8	1.8e-280
>prophage 221
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3118995	3121677	4077713		Salicola_phage(100.0%)	1	NA	NA
WP_002009235.1|3118995_3121677_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.0	1.3e-81
>prophage 222
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3125622	3128748	4077713		Bacillus_phage(50.0%)	4	NA	NA
WP_000972583.1|3125622_3126576_+	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000460188.1|3126578_3127430_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085920601.1|3127602_3128250_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000646722.1|3128265_3128748_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	39.1	7.0e-18
>prophage 223
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3195183	3196386	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_001166816.1|3195183_3196386_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.1	4.9e-28
>prophage 224
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3213768	3214530	4077713		Bacillus_phage(100.0%)	1	NA	NA
WP_000251871.1|3213768_3214530_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 225
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3230636	3239717	4077713		Klosneuvirus(33.33%)	7	NA	NA
WP_001288906.1|3230636_3231539_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	40.0	1.6e-47
WP_000461816.1|3231535_3233527_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_000121724.1|3233538_3234342_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_001072772.1|3234351_3235953_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
WP_001053642.1|3235977_3237150_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001985858.1|3237318_3237912_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001183739.1|3238022_3239717_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.2e-26
>prophage 226
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3245961	3256513	4077713		Acinetobacter_phage(20.0%)	12	NA	NA
WP_001136759.1|3245961_3246390_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
WP_000498474.1|3246477_3246699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132045.1|3246783_3247101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108365.1|3247206_3247428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482091.1|3247712_3248192_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	50.3	1.8e-34
WP_001145692.1|3248507_3249917_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_002009133.1|3249971_3252116_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
WP_000432325.1|3252171_3253050_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.8	2.9e-54
WP_000983537.1|3253191_3253605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162216659.1|3254155_3255322_+	stress-induced protein	NA	NA	NA	NA	NA
WP_000795915.1|3255382_3255619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001124835.1|3255901_3256513_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.4	4.9e-48
>prophage 227
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3259675	3263140	4077713		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000115395.1|3259675_3263140_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.7	1.3e-33
>prophage 228
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3270244	3270976	4077713		Planktothrix_phage(100.0%)	1	NA	NA
WP_001130360.1|3270244_3270976_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	3.3e-35
>prophage 229
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3275368	3278237	4077713		environmental_halophage(50.0%)	2	NA	NA
WP_000211585.1|3275368_3277330_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	1.9e-93
WP_001107594.1|3277304_3278237_-	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
>prophage 230
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3285802	3287293	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_083042173.1|3285802_3287293_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.0	7.2e-21
>prophage 231
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3312219	3313014	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_000114470.1|3312219_3313014_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-33
>prophage 232
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3322266	3323109	4077713		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000138010.1|3322266_3322695_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.3	2.4e-41
WP_000610147.1|3322779_3323109_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
>prophage 233
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3326597	3328163	4077713		Lactococcus_phage(100.0%)	1	NA	NA
WP_000886815.1|3326597_3328163_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.3e-25
>prophage 234
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3333046	3336610	4077713		Streptomyces_phage(100.0%)	1	NA	NA
WP_001160984.1|3333046_3336610_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	4.0e-174
>prophage 235
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3342435	3342921	4077713		Fowlpox_virus(100.0%)	1	NA	NA
WP_000066032.1|3342435_3342921_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 236
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3355679	3356756	4077713		Planktothrix_phage(100.0%)	1	NA	NA
WP_114226314.1|3355679_3356756_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
>prophage 237
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3366506	3367250	4077713		Planktothrix_phage(100.0%)	1	NA	NA
WP_001132006.1|3366506_3367250_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 238
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3373239	3377891	4077713	integrase,transposase	Moraxella_phage(50.0%)	4	3372794:3372808	3382522:3382536
3372794:3372808	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_000108035.1|3373239_3374472_+|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	42.4	1.8e-81
WP_001010556.1|3375056_3375956_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161753.1|3376045_3376483_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_085944009.1|3376671_3377891_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
3382522:3382536	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 239
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3397161	3398328	4077713		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001209544.1|3397161_3398328_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 240
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3410356	3416889	4077713		Aeromonas_phage(33.33%)	6	NA	NA
WP_000119796.1|3410356_3411847_-	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
WP_085944076.1|3412253_3412961_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.0	1.0e-33
WP_001016343.1|3413054_3413429_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000705518.1|3413467_3414493_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000966086.1|3414601_3415042_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000922234.1|3415041_3416889_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
>prophage 241
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3433256	3437776	4077713		Brevibacillus_phage(33.33%)	5	NA	NA
WP_000057212.1|3433256_3434039_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	5.7e-17
WP_000023429.1|3434035_3434923_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
WP_000264042.1|3434972_3435608_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000669680.1|3435623_3436052_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_001070738.1|3436048_3437776_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.0	3.3e-57
>prophage 242
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3445812	3448157	4077713	tRNA	Equid_gammaherpesvirus(50.0%)	3	NA	NA
WP_001177528.1|3445812_3446526_+	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
WP_001983908.1|3446522_3447647_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000033177.1|3447653_3448157_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
>prophage 243
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3451298	3451601	4077713		Burkholderia_phage(100.0%)	1	NA	NA
WP_000205997.1|3451298_3451601_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 244
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3463498	3466198	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000731482.1|3463498_3466198_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	1.2e-42
>prophage 245
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3470603	3477248	4077713		Klosneuvirus(33.33%)	5	NA	NA
WP_000719394.1|3470603_3472637_+	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.7	9.1e-75
WP_000881924.1|3472649_3473588_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000953840.1|3473595_3474738_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001295038.1|3474750_3476481_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
WP_002009179.1|3476513_3477248_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	41.7	8.1e-50
>prophage 246
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3487953	3493068	4077713		Lake_Baikal_phage(50.0%)	6	NA	NA
WP_001175660.1|3487953_3489423_+	guanylate cyclase	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
WP_001137382.1|3489471_3489810_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196579.1|3489828_3491688_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.4	1.4e-101
WP_001015254.1|3491726_3492245_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_000581597.1|3492330_3492651_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
WP_000331712.1|3492681_3493068_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
>prophage 247
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3496420	3496693	4077713		Burkholderia_phage(100.0%)	1	NA	NA
WP_001043034.1|3496420_3496693_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 248
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3499866	3505323	4077713		Catovirus(50.0%)	4	NA	NA
WP_000993553.1|3499866_3501090_+	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.6	1.9e-51
WP_001053243.1|3501209_3502415_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_171057415.1|3502436_3503720_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000070798.1|3503949_3505323_-	AarF/ABC1/UbiB kinase family protein	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
>prophage 249
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3527480	3533736	4077713	transposase	Bluetongue_virus(33.33%)	5	NA	NA
WP_001206290.1|3527480_3528689_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
WP_001051572.1|3529408_3530008_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_001023038.1|3530132_3531701_+	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.5	6.9e-115
WP_000187510.1|3531807_3532551_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000572397.1|3532626_3533736_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	7.2e-82
>prophage 250
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3543525	3545283	4077713		Pithovirus(100.0%)	1	NA	NA
WP_000567293.1|3543525_3545283_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.1	7.2e-20
>prophage 251
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3567775	3568867	4077713		Pandoravirus(100.0%)	1	NA	NA
WP_000918444.1|3567775_3568867_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 252
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3590839	3592189	4077713		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_001186392.1|3590839_3592189_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 253
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3597540	3600966	4077713		Bacillus_virus(50.0%)	4	NA	NA
WP_000028991.1|3597540_3598380_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
WP_000011851.1|3598376_3599375_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001167102.1|3599358_3599640_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_000222733.1|3599679_3600966_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	4.8e-37
>prophage 254
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3617184	3617586	4077713		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000720506.1|3617184_3617586_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	33.1	5.0e-09
>prophage 255
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3624829	3625615	4077713		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001017889.1|3624829_3625615_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	2.3e-10
>prophage 256
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3635213	3635834	4077713		Planktothrix_phage(100.0%)	1	NA	NA
WP_000903969.1|3635213_3635834_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.8	5.9e-17
>prophage 257
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3651392	3653491	4077713	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_001136787.1|3651392_3651860_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	6.6e-37
WP_085944009.1|3652271_3653491_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
>prophage 258
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3656537	3657647	4077713		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842124.1|3656537_3657647_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	5.2e-32
>prophage 259
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3671616	3682702	4077713		Bacillus_phage(50.0%)	7	NA	NA
WP_000024065.1|3671616_3673434_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.2e-23
WP_000997919.1|3673461_3674730_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000209743.1|3675066_3676119_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000475979.1|3676402_3678214_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	6.1e-38
WP_001098214.1|3678210_3680043_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.1e-46
WP_002126609.1|3680119_3680242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557770.1|3680209_3682702_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.9e-14
>prophage 260
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3688090	3688861	4077713		Bacillus_virus(100.0%)	1	NA	NA
WP_085944063.1|3688090_3688861_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.2e-30
>prophage 261
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3705677	3713273	4077713		Leptospira_phage(50.0%)	4	NA	NA
WP_000166990.1|3705677_3707939_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.5	9.0e-132
WP_000987606.1|3708086_3711197_-	multidrug efflux RND transporter permease subunit AdeB	NA	S5VTK5	Leptospira_phage	24.4	2.7e-62
WP_001169080.1|3711193_3712384_-	multidrug efflux RND transporter periplasmic adaptor subunit AdeA	NA	S5VL44	Leptospira_phage	21.4	8.1e-07
WP_000459551.1|3712529_3713273_+	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	30.7	7.5e-27
>prophage 262
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3727041	3727482	4077713		Vibrio_phage(100.0%)	1	NA	NA
WP_000193132.1|3727041_3727482_+	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	4.8e-13
>prophage 263
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3739460	3749310	4077713		Bacillus_virus(40.0%)	10	NA	NA
WP_000155295.1|3739460_3740228_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	33.0	1.5e-25
WP_000152985.1|3740288_3741782_-	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	50.9	5.4e-141
WP_001007506.1|3741793_3742678_-	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	37.5	3.7e-33
WP_000965108.1|3742859_3743663_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001244571.1|3743761_3744550_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000177608.1|3744544_3745033_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000614437.1|3745035_3745800_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	1.6e-16
WP_002009758.1|3745796_3746807_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000770280.1|3746809_3747829_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000206303.1|3748257_3749310_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
>prophage 264
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3765894	3767238	4077713		Salmonella_phage(100.0%)	1	NA	NA
WP_000081455.1|3765894_3767238_-	aromatic acid/H+ symport family MFS transporter	NA	S4TR35	Salmonella_phage	23.2	5.0e-05
>prophage 265
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3805929	3806940	4077713		Moumouvirus(100.0%)	1	NA	NA
WP_000685012.1|3805929_3806940_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	37.5	3.1e-60
>prophage 266
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3810845	3813273	4077713		Tupanvirus(50.0%)	2	NA	NA
WP_000997200.1|3810845_3812366_-	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	5.4e-96
WP_000542599.1|3812442_3813273_-	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	30.2	2.8e-14
>prophage 267
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3819284	3820916	4077713		Catovirus(100.0%)	1	NA	NA
WP_000181291.1|3819284_3820916_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.9	3.3e-19
>prophage 268
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3874314	3875142	4077713		Streptococcus_phage(100.0%)	1	NA	NA
WP_001986093.1|3874314_3875142_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.2	1.7e-19
>prophage 269
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3885948	3889810	4077713		Streptococcus_phage(33.33%)	3	NA	NA
WP_000078452.1|3885948_3887238_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
WP_000080538.1|3887283_3888141_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
WP_000148658.1|3888172_3889810_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	1.4e-150
>prophage 270
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3897693	3902242	4077713	protease	Serratia_phage(25.0%)	4	NA	NA
WP_000993012.1|3897693_3898749_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	46.1	2.1e-83
WP_000904308.1|3899176_3899539_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
WP_000952702.1|3899542_3901819_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
WP_001260033.1|3901828_3902242_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
>prophage 271
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3937677	3940536	4077713		Hokovirus(100.0%)	1	NA	NA
WP_000880354.1|3937677_3940536_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.8	1.0e-15
>prophage 272
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3945344	3954727	4077713	transposase	Bacillus_virus(20.0%)	7	NA	NA
WP_000203163.1|3945344_3947438_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	28.7	4.4e-16
WP_000120225.1|3947563_3948007_+	universal stress protein	NA	NA	NA	NA	NA
WP_001032857.1|3948061_3949504_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_085944009.1|3949947_3951167_-|transposase	IS3-like element ISAba34 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.1e-75
WP_050542647.1|3951278_3951809_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	61.7	9.4e-48
WP_000957170.1|3952046_3953501_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.1	1.2e-180
WP_001026396.1|3953548_3954727_-	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	40.6	3.2e-32
>prophage 273
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3963149	3964199	4077713		Bacillus_phage(100.0%)	1	NA	NA
WP_000344169.1|3963149_3964199_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 274
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3974939	3975692	4077713		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000132219.1|3974939_3975692_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	4.3e-22
>prophage 275
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	3990384	3992854	4077713		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_000604790.1|3990384_3991392_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
WP_000105718.1|3991457_3991826_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	6.8e-13
WP_000859773.1|3991870_3992221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194628.1|3992238_3992523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047540.1|3992542_3992854_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	1.6e-18
>prophage 276
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	4012838	4014167	4077713		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000652008.1|4012838_4014167_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.1	1.6e-99
>prophage 277
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	4020672	4046659	4077713	plate,capsid	Acinetobacter_phage(93.1%)	34	NA	NA
WP_001019702.1|4020672_4021218_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	93.4	1.3e-97
WP_001076397.1|4021316_4021499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433923.1|4021860_4022250_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
WP_000873384.1|4022316_4022703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257533.1|4022699_4024949_-	hypothetical protein	NA	I3WVZ0	Acinetobacter_phage	25.7	6.7e-10
WP_000342174.1|4024951_4025545_-	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	45.4	4.4e-38
WP_001229526.1|4025537_4026719_-|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	52.7	2.6e-114
WP_001270578.1|4026718_4027075_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	53.9	6.3e-32
WP_001218511.1|4027117_4027828_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	50.8	2.2e-60
WP_000175157.1|4027817_4028813_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	53.1	7.3e-94
WP_001240307.1|4028809_4029109_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.2	6.7e-11
WP_001018458.1|4029110_4029740_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	59.3	4.8e-51
WP_000733629.1|4029918_4030257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046201.1|4030253_4032866_-	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	35.7	1.2e-111
WP_001247957.1|4032958_4033111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002533.1|4033146_4033632_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	59.6	2.0e-41
WP_000109245.1|4033653_4034097_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	75.5	8.4e-58
WP_000174800.1|4034107_4035229_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	52.3	6.0e-129
WP_000502799.1|4035237_4035774_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	89.3	2.4e-83
WP_000057777.1|4035777_4036146_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	95.1	1.5e-60
WP_000094497.1|4036132_4036693_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	96.2	1.0e-92
WP_000622626.1|4036689_4037076_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	96.9	1.2e-65
WP_000041172.1|4037079_4037511_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	89.5	1.2e-48
WP_001228778.1|4037520_4038546_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	99.4	1.4e-193
WP_000525988.1|4038610_4039087_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	98.7	4.3e-84
WP_000473610.1|4039090_4040404_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	97.7	1.0e-207
WP_001178762.1|4040465_4040723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562064.1|4040769_4041351_-|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	96.4	2.1e-101
WP_000522916.1|4041421_4042834_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	97.9	9.9e-254
WP_000220357.1|4042844_4044503_-	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	98.6	0.0e+00
WP_001096341.1|4044499_4045006_-	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	66.7	8.4e-54
WP_025464671.1|4045065_4045707_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	88.7	1.0e-112
WP_000378514.1|4045675_4046143_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	79.4	2.0e-65
WP_001136768.1|4046203_4046659_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.0	1.5e-78
>prophage 278
NZ_CP020597	Acinetobacter baumannii strain HWBA8 chromosome, complete genome	4077713	4049826	4061467	4077713	integrase	Acinetobacter_phage(94.12%)	21	4056460:4056476	4070265:4070281
WP_001277128.1|4049826_4050303_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000097329.1|4050299_4050701_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	90.1	5.1e-62
WP_000994670.1|4050700_4051165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544512.1|4051161_4051911_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.0	2.6e-136
WP_000280082.1|4051903_4052833_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	97.1	9.3e-168
WP_046882998.1|4052832_4053186_-	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	96.6	4.5e-54
WP_001084132.1|4053182_4053479_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	100.0	1.6e-49
WP_001072908.1|4053475_4053760_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
WP_000041061.1|4053809_4054166_-	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.5	2.5e-57
WP_001077691.1|4054174_4054375_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
WP_000212394.1|4054487_4055144_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
WP_000862384.1|4055190_4055472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101459.1|4055691_4056132_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	97.3	7.5e-75
WP_000181042.1|4056134_4056458_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	83.2	1.2e-45
4056460:4056476	attL	GATAAGAAAAATGACAA	NA	NA	NA	NA
WP_002010120.1|4056469_4057237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183243.1|4057251_4058199_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	87.8	7.3e-152
WP_000043827.1|4058198_4058495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048741.1|4059383_4059668_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	93.6	3.1e-42
WP_000015932.1|4059671_4059929_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.1	4.7e-45
WP_000910238.1|4059929_4060199_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773618.1|4060204_4061467_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	98.8	1.0e-246
4070265:4070281	attR	GATAAGAAAAATGACAA	NA	NA	NA	NA
>prophage 1
NZ_CP020596	Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence	195838	0	53867	195838	transposase,integrase	Escherichia_phage(20.0%)	57	18660:18719	53880:55061
WP_001206290.1|1957_3166_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	3.1e-171
WP_000359986.1|3407_4181_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|4161_4443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|4662_4848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|4896_6081_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|6479_7955_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|8010_8895_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|9253_9796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|10680_11385_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|11418_11910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|12016_12754_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|12750_12975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|13185_14679_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000512977.1|14916_15321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088605.1|15298_15922_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|16003_17209_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_071543477.1|17247_17541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|17434_17737_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|17823_18639_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
18660:18719	attL	TCTCTGTACACGATAAAAATAGATAACTCATTGAAATAATGTCATAATAATTGTTTTCTA	NA	NA	NA	NA
WP_085940413.1|18731_19821_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|20243_22154_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|22154_22865_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000168733.1|23176_23446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798673.1|23499_23856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001006517.1|23901_24219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886984.1|24425_25358_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	36.2	7.5e-16
WP_001085038.1|25458_25686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192314.1|25686_27189_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_000157684.1|27273_28437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370460.1|28457_29039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144964.1|29325_31122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953322.1|31416_32904_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_000034565.1|32916_33768_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	46.3	3.7e-70
WP_001095005.1|33835_34135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|34207_34579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002020149.1|34953_35592_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|35596_37507_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077670487.1|37852_38881_+|transposase	IS701-like element ISAba11 family transposase	transposase	NA	NA	NA	NA
WP_000736400.1|38871_39324_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000745050.1|39513_39852_-	hypothetical protein	NA	A0A1W6DXA8	Sphingobium_phage	44.8	3.2e-17
WP_000204892.1|39855_41970_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000608397.1|42131_42926_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001257461.1|43082_43367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009516736.1|43369_43942_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001061020.1|43965_44292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000567442.1|44440_45337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235140.1|45338_45824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627641.1|45941_46283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000182208.1|46335_46905_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000742271.1|46901_47399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064102.1|47634_48426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075211.1|48490_49873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700024.1|49945_50359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000712916.1|51273_51465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743271.1|51461_52394_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.9	1.2e-61
WP_000993275.1|52447_52747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|52776_53867_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
53880:55061	attR	TAGAAAACAATTATTATGACATTATTTCAATGAGTTATCTATTTTTATCGTGTACAGAGAAAAATCATAATGAATATCATCTTTAATATGAATCCATTATTTTAGATAGAAAAAAGCCTAGTATATGAACTAGGCTTTTTTTATACATCATTATTTAATCAGGAATTCACTCAGCTTTAACTTGCTTTCTTCCATTTCACTTTTCAACCATCTTGGCATCTGTCCTCGTCCTGTCCAAGTGTTCTCCGGATCAGCCTTACTTCTATAACGTGGCTCAACAGTCTTTGTTTTTTTCTTTTTATTATGGGTTTTCCCAAATTCAATGAGCTGGTCTAAAGTCAGTCCAACACTTTTGGCAATTTCCTCTAATTGGCCAAAGGCTGCCACTTTCTCTTCAATTTCCCTTTTTCCTTTTTCAAGACTTGCAGCCTTGATCAAATTCTCTAGTTCTATTGATGAATAACCATCTAAATTAAATTCTTTCATCATTAATACTCTATATGTTTTAAAGTAAATATTTTAATGGAATGTTAAATTGATAATTGAGATTTAAAATATTTAATTAAATCTCCAACTACAATATTAACCGCAAGTTCGTTATTTGCTAAGTTTGTACTATAGGCTCCAGATCGGATAGGGTCACTAATAATCTGAGTATAGTTTTGCATCGCGAAATTTACACTAAATAAATAAGGATAGAGTACTTTACTCTGATTACTTTGATTCAGTAAAGAATTTAATGCATTTTCATTTCCAACAAAGAATATTCGCTTGACCATGTCAATAACATAATCATTTTTGAATGAATCAATATTTTCGGAAAAATAATTAAAGTACTTCAAATTATTATTGGTCAATTCGTCAAAATTCTCTTTAGATATATTTTCAAAGAACGTTGTTTTAGATCCTTTGATAGCTAAAGTAGAAATCAAAGTCGCAACAGATTTAGCAATTTTATTCACTGGATTATTGTAATCAGACTCTTGTGAAGTTTTGGGAATATCGCCTTTACCCACGGCACTTTCGTAGTTTGTTCTACTAGCCTTCACAACAACATCATCGACTTCTTCGCCTAAAATTAATGATGATTGCCCTTTACCATTTTTAGAATCAATCCAGCTCTTATCTTTAAATGCTGAACGGCATGCCCCGACAAAGTTAATTGTCTGGCCCTTTTTCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP020596	Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence	195838	109738	141196	195838	transposase,protease	Escherichia_phage(40.0%)	22	NA	NA
WP_000093022.1|109738_111268_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000960976.1|111924_112497_-	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	8.0e-37
WP_001067788.1|113379_114084_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.1	1.1e-117
WP_000557452.1|114265_115126_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_000587836.1|115138_115432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093022.1|116346_117876_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067790.1|118251_118956_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_000609033.1|119418_120276_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001123161.1|120601_120814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000604996.1|121321_122122_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000369784.1|122154_122427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897311.1|122419_122740_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000743272.1|123418_124351_-|transposase	IS5-like element IS17 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	3.4e-61
WP_001255535.1|125099_126332_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000506885.1|126603_126933_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000205587.1|127141_128008_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000892996.1|128018_128630_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002010699.1|128647_129223_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001021842.1|129264_132945_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_001097757.1|132991_136459_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	22.3	5.3e-06
WP_001052669.1|136502_139127_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_000443162.1|139156_141196_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
