The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	79885	90045	2939512	tRNA	Tupanvirus(28.57%)	7	NA	NA
WP_085376447.1|79885_81835_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.0	3.3e-114
WP_085376448.1|82147_82354_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	44.3	5.1e-10
WP_085376449.1|82516_84004_+	acyl--CoA ligase	NA	A0A2K9KZV5	Tupanvirus	23.3	3.3e-13
WP_085376450.1|84088_86347_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	62.9	6.2e-274
WP_085378650.1|86849_88106_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	4.3e-51
WP_085378651.1|88190_88763_+	thymidine kinase	NA	G3MUR2	Enterobacteria_phage	55.9	3.0e-52
WP_085376451.1|88875_90045_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	2.6e-42
>prophage 2
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	203246	209942	2939512		Acidithiobacillus_phage(33.33%)	6	NA	NA
WP_085376540.1|203246_204131_-	site-specific DNA-methyltransferase	NA	S4VZJ3	Pandoravirus	56.2	1.0e-86
WP_085376541.1|204765_206439_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	48.9	1.5e-83
WP_085376542.1|206435_207044_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	33.8	3.4e-09
WP_157115206.1|207194_208049_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	36.3	5.4e-05
WP_085376544.1|208081_208423_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	48.3	7.4e-06
WP_085378667.1|208586_209942_+	ParB N-terminal domain-containing protein	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	41.1	1.1e-73
>prophage 3
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	547988	568569	2939512	terminase,portal	uncultured_Caudovirales_phage(17.65%)	25	NA	NA
WP_081962489.1|547988_549296_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	54.7	2.6e-131
WP_081962487.1|549300_550209_+	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	41.5	7.7e-42
WP_157115218.1|550230_550401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085376809.1|550400_551759_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	53.0	9.6e-129
WP_085376810.1|552042_552408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085376811.1|552411_552978_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	35.0	7.2e-14
WP_143796722.1|552974_553226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085376813.1|553373_553979_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	48.0	3.3e-33
WP_169712112.1|553965_554154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378705.1|554080_556126_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	56.1	3.7e-201
WP_036707016.1|556125_556329_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	48.1	1.7e-05
WP_085376814.1|556331_557861_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	37.5	4.7e-76
WP_085376815.1|557872_559864_+	hypothetical protein	NA	A0A2I7S8L6	Vibrio_phage	34.8	5.6e-85
WP_036707011.1|559948_560287_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_085376816.1|560286_560601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085376817.1|560597_561218_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	53.7	2.0e-49
WP_036707003.1|561214_561643_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	50.4	3.3e-35
WP_036707096.1|561785_562508_+	phage antirepressor KilAC domain-containing protein	NA	K4IBS6	Acinetobacter_phage	40.1	8.9e-33
WP_036707001.1|562551_563496_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	55.2	1.7e-95
WP_085376818.1|563499_563937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378706.1|563933_564170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085376819.1|564162_566562_+	tape measure protein	NA	A0A2D0W9N5	Bordetella_phage	35.2	4.2e-63
WP_085376820.1|566561_567188_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	55.1	2.8e-59
WP_085376821.1|567184_568069_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	44.6	4.1e-64
WP_085376822.1|568065_568569_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.7	2.9e-30
>prophage 4
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	1090801	1160319	2939512	terminase,integrase,tail,head,portal	Acidithiobacillus_phage(25.71%)	61	1091131:1091151	1140524:1140544
WP_085377226.1|1090801_1092586_+|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	59.1	1.6e-187
1091131:1091151	attL	GCGGATCGACCCGCTGATCGA	NA	NA	NA	NA
WP_085378765.1|1092791_1094444_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_085377227.1|1094423_1095458_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_085377228.1|1095607_1097017_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	44.8	6.0e-110
WP_085377229.1|1097009_1098809_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2I7QSM3	Vibrio_phage	31.3	1.9e-71
WP_023912405.1|1098810_1099020_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	45.6	7.8e-06
WP_085377230.1|1099022_1099367_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_085377231.1|1099363_1099678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377232.1|1099692_1099908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157115252.1|1100024_1101107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377234.1|1101549_1102479_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_169712136.1|1102478_1103915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377236.1|1104133_1105288_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	36.8	7.8e-47
WP_085377237.1|1105409_1106285_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_085377238.1|1106293_1111468_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.6	2.9e-53
WP_085377239.1|1111472_1114238_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.2	1.1e-30
WP_085377240.1|1114240_1118170_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.1	7.7e-38
WP_085377241.1|1118169_1118931_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085377242.1|1119157_1121080_-	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	26.2	2.2e-25
WP_085377243.1|1121089_1125055_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	42.1	9.2e-257
WP_085377244.1|1125064_1125499_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	48.9	1.3e-31
WP_085377245.1|1125495_1126380_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	40.8	1.6e-52
WP_085377246.1|1126376_1126586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377247.1|1126582_1127251_-	lysozyme	NA	F8TV87	EBPR_siphovirus	48.3	6.7e-43
WP_157115253.1|1127255_1127393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377248.1|1127382_1127733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377249.1|1127729_1128356_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	54.9	2.4e-58
WP_085377250.1|1128355_1130797_-|tail	phage tail tape-measure protein	tail	A0A0K1LLC2	Rhodobacter_phage	53.5	5.5e-18
WP_169712137.1|1130824_1130989_-	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	58.8	3.9e-05
WP_085377251.1|1131051_1131489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377252.1|1131500_1132439_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	58.6	3.3e-96
WP_085377253.1|1132463_1132883_-	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	57.9	2.4e-38
WP_157115254.1|1132954_1133833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377255.1|1133856_1134477_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	52.0	1.8e-50
WP_085377256.1|1134482_1134794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377257.1|1134793_1135129_-	DUF2190 family protein	NA	A0A088C4T4	Shewanella_sp._phage	43.1	5.1e-07
WP_085378766.1|1135209_1137207_-	peptidase U37	NA	A0A2I7S8L6	Vibrio_phage	31.4	2.4e-75
WP_028030714.1|1138738_1138948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377258.1|1138950_1140954_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	60.8	1.2e-217
1140524:1140544	attR	TCGATCAGCGGGTCGATCCGC	NA	NA	NA	NA
WP_085377259.1|1140901_1141462_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	47.0	3.2e-30
WP_085377260.1|1141573_1141798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377261.1|1141894_1142407_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	37.1	2.8e-12
WP_085377262.1|1142482_1142758_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_085377263.1|1142754_1143066_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085377264.1|1143001_1143268_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	61.5	3.3e-17
WP_085377265.1|1144377_1145754_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	39.2	5.0e-77
WP_085377266.1|1146165_1146594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169712190.1|1146590_1146788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377268.1|1146793_1147330_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	65.3	2.8e-52
WP_169712138.1|1147797_1150176_-	AAA family ATPase	NA	A0A1B2LRS1	Wolbachia_phage	49.2	7.1e-71
WP_085377269.1|1150127_1150895_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	56.7	2.2e-74
WP_085377270.1|1150894_1151095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377271.1|1151307_1152999_-	DEAD/DEAH box helicase	NA	A0A0E3JQF5	Streptomyces_phage	34.4	6.1e-40
WP_085377272.1|1153010_1153607_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	58.7	3.4e-54
WP_085377273.1|1153626_1154496_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	60.6	2.1e-97
WP_085377274.1|1154492_1154981_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	43.2	7.9e-25
WP_157115394.1|1155008_1155335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071166986.1|1155370_1155574_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085377275.1|1155775_1156459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085377276.1|1156567_1157245_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	31.9	6.6e-22
WP_085378769.1|1157610_1160319_+	AAA family ATPase	NA	A0A1W6DX18	Sphingobium_phage	24.0	4.4e-16
>prophage 5
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	1921994	1960352	2939512	tail,head,protease,portal,capsid	Rhodobacter_phage(27.27%)	39	NA	NA
WP_085377866.1|1921994_1923413_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_085378860.1|1923603_1924464_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_085377867.1|1924484_1925432_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_085377868.1|1925431_1925728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377869.1|1925724_1926324_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_085377870.1|1926353_1927172_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_085378861.1|1927311_1927986_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_085377871.1|1927994_1929383_+	threonine synthase	NA	NA	NA	NA	NA
WP_085378862.1|1929436_1930645_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	24.2	3.3e-24
WP_085377872.1|1930644_1931229_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085377873.1|1931274_1932672_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_085377874.1|1932769_1933201_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_085377875.1|1933747_1934344_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_085377876.1|1934493_1935114_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_085377877.1|1935110_1935926_+	EcsC family protein	NA	NA	NA	NA	NA
WP_085377878.1|1935951_1936860_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_085377879.1|1938794_1939919_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_085378863.1|1939981_1940953_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_085377880.1|1941041_1942241_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_085377881.1|1942442_1943705_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_157115303.1|1943704_1944883_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_085378865.1|1945283_1945580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378864.1|1945629_1946877_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	36.5	1.8e-65
WP_157115407.1|1947094_1948261_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.7	9.9e-58
WP_085377883.1|1948262_1948499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378867.1|1948508_1949054_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.3	1.0e-36
WP_157115408.1|1949260_1950373_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	38.4	3.0e-64
WP_085377885.1|1950510_1951122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085377886.1|1951118_1951457_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_085377887.1|1951453_1951885_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_085377888.1|1951901_1952318_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_085377889.1|1952317_1952632_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_085378868.1|1952726_1953047_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_085377890.1|1953036_1953708_+|tail	phage tail tape measure protein	tail	C0LP53	Escherichia_virus	44.8	5.2e-11
WP_085377891.1|1953707_1954340_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.5	7.2e-55
WP_085377892.1|1954336_1955224_+	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	35.7	1.4e-35
WP_085377893.1|1955220_1955658_+	peptidase	NA	F4YXU4	Roseobacter_phage	47.5	8.9e-28
WP_085377894.1|1955749_1959619_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0K1LLC1	Rhodobacter_phage	38.8	3.8e-215
WP_085377895.1|1959611_1960352_+	DUF2793 domain-containing protein	NA	A0A0K1Y6G9	Rhodobacter_phage	41.5	3.5e-16
>prophage 6
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2257316	2278770	2939512	terminase	Acidithiobacillus_phage(46.15%)	21	NA	NA
WP_085378150.1|2257316_2257994_-	helix-turn-helix domain-containing protein	NA	A0A291AUK0	Sinorhizobium_phage	38.0	3.3e-13
WP_085378151.1|2258103_2258787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157115320.1|2258993_2259206_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157115418.1|2259223_2259568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378153.1|2259594_2260083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378154.1|2260079_2260970_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	63.5	1.3e-94
WP_085378155.1|2260983_2261589_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	57.6	2.2e-56
WP_085378156.1|2261599_2263267_+	DEAD/DEAH box helicase	NA	A0A2D1GP10	Streptomyces_phage	35.3	1.2e-40
WP_085378157.1|2263491_2263692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378158.1|2263691_2264459_+	PD-(D/E)XK nuclease family protein	NA	K4HZA0	Acidithiobacillus_phage	56.2	1.5e-75
WP_085378893.1|2264455_2266747_+	AAA family ATPase	NA	A0A1B2LRS1	Wolbachia_phage	51.6	6.2e-72
WP_085378159.1|2267213_2267750_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.0	9.2e-51
WP_085378160.1|2267940_2268369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378161.1|2268812_2270132_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	37.5	6.3e-69
WP_085378162.1|2271111_2271336_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	64.8	9.8e-15
WP_085378163.1|2271388_2271958_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	37.2	1.1e-12
WP_085378164.1|2272048_2272273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085378165.1|2272384_2272981_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	42.0	1.9e-25
WP_085377258.1|2272928_2274932_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	60.8	1.2e-217
WP_028030714.1|2274934_2275144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378166.1|2276703_2278770_+	peptidase U37	NA	A0A2I7S8L6	Vibrio_phage	32.4	1.2e-85
>prophage 7
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2285243	2295998	2939512		Paracoccus_phage(44.44%)	10	NA	NA
WP_085378173.1|2285243_2285870_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	56.3	1.9e-60
WP_085378174.1|2285866_2286751_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.3	1.8e-64
WP_085378175.1|2286747_2287197_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.8	9.8e-30
WP_085378176.1|2287207_2291173_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	43.1	1.8e-268
WP_085378177.1|2291180_2292257_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	40.7	1.7e-56
WP_085378178.1|2292276_2292564_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	52.6	7.6e-12
WP_085378179.1|2292723_2293398_+	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	47.8	4.2e-45
WP_085378180.1|2293394_2293652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378182.1|2293888_2294353_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	51.0	1.9e-36
WP_085378183.1|2294420_2295998_+	DNA cytosine methyltransferase	NA	G3CB01	Aeropyrum_pernix_spindle-shaped_virus	27.6	2.7e-18
>prophage 8
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2308090	2328118	2939512	capsid,head	Rhodobacter_phage(40.0%)	21	NA	NA
WP_085378195.1|2308090_2309410_-	hypothetical protein	NA	V9QJ77	Rhizobium_phage	54.7	1.5e-22
WP_085378196.1|2309469_2314647_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	38.2	4.9e-117
WP_085378197.1|2314646_2315057_-	hypothetical protein	NA	A0A0U2C0Z1	Paracoccus_phage	47.1	1.4e-22
WP_169712162.1|2315089_2315368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157115326.1|2315416_2315695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378199.1|2315669_2316332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085378200.1|2316331_2316691_-	DUF1320 domain-containing protein	NA	G8GWF0	Rhodobacter_phage	53.2	5.4e-23
WP_085378201.1|2316694_2316934_-	hypothetical protein	NA	G8GWE9	Rhodobacter_phage	55.4	7.3e-08
WP_085378202.1|2316997_2317468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085378894.1|2317479_2318436_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	66.2	2.5e-123
WP_085378203.1|2318446_2318785_-	DUF2190 family protein	NA	G8GWE6	Rhodobacter_phage	40.9	3.2e-09
WP_085378204.1|2318795_2319926_-	hypothetical protein	NA	R9U448	Rhizobium_phage	54.8	9.2e-101
WP_085378205.1|2320189_2320789_-	phage virion morphogenesis protein	NA	G8GWE3	Rhodobacter_phage	43.9	5.3e-31
WP_157115327.1|2320902_2322480_-|head	head morphogenesis protein	head	G8GWE2	Rhodobacter_phage	47.7	4.1e-123
WP_085378206.1|2322476_2323175_-	DUF935 family protein	NA	R9U4B4	Rhizobium_phage	54.5	1.3e-52
WP_085378896.1|2323238_2323859_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	40.6	1.4e-34
WP_085378207.1|2324084_2325047_-	site-specific DNA-methyltransferase	NA	A0A2K9V2V8	Faecalibacterium_phage	27.9	9.4e-14
WP_169712163.1|2325100_2325334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169712164.1|2325320_2325905_+	restriction endonuclease	NA	A0A1B0UXL9	Roseobacter_phage	42.4	2.8e-29
WP_085378208.1|2326071_2327496_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_157115328.1|2327539_2328118_-	hypothetical protein	NA	A0A2I7RTF0	Vibrio_phage	40.9	7.6e-19
>prophage 9
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2595378	2630084	2939512	terminase,head,protease,portal,tRNA,capsid	Acidithiobacillus_phage(37.93%)	38	NA	NA
WP_043130368.1|2595378_2595867_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	42.3	4.2e-26
WP_043130201.1|2595863_2596736_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	62.4	1.2e-97
WP_043130202.1|2596755_2597385_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	54.7	1.4e-53
WP_043130204.1|2597399_2599088_+	DEAD/DEAH box helicase	NA	A0A125RNY6	Streptomyces_phage	36.7	4.3e-46
WP_043130207.1|2599312_2599513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043130212.1|2599512_2600280_+|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	55.1	5.5e-73
WP_043130215.1|2600276_2602643_+	AAA family ATPase	NA	A0A1B2LRS1	Wolbachia_phage	50.6	6.9e-74
WP_085378396.1|2603007_2603544_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.2	2.7e-50
WP_039616164.1|2603549_2603744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043130224.1|2603736_2604183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378397.1|2604590_2605919_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	40.1	3.9e-74
WP_085378398.1|2605918_2606914_+	DNA cytosine methyltransferase	NA	D2XJU8	Escherichia_phage	48.0	3.5e-72
WP_036706590.1|2606910_2607135_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	63.4	4.4e-15
WP_036706587.1|2607189_2607774_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_036706585.1|2607864_2608125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036706582.1|2608238_2608835_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	41.5	8.7e-26
WP_052512788.1|2608782_2610795_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	61.0	9.9e-215
WP_043130233.1|2610799_2611015_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	46.4	3.6e-06
WP_081969309.1|2611020_2612550_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	58.9	8.8e-147
WP_052512789.1|2612554_2613592_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	50.7	8.5e-45
WP_043130236.1|2613595_2613961_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	38.3	4.2e-07
WP_043130239.1|2613987_2615001_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	33.1	4.4e-38
WP_043130242.1|2615000_2615312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043130244.1|2615308_2615938_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	54.9	2.6e-52
WP_081969311.1|2615959_2616178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043130246.1|2616227_2617184_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_043130248.1|2617333_2617753_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	60.0	4.8e-39
WP_043130250.1|2617777_2618722_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	59.4	5.3e-102
WP_036705417.1|2618724_2619180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036705415.1|2619218_2619440_+	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	58.8	2.3e-08
WP_085378399.1|2619484_2621908_+	tape measure protein	NA	A0A2D0W9N5	Bordetella_phage	31.6	1.3e-56
WP_036706580.1|2621957_2622584_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	57.8	9.3e-63
WP_036706579.1|2622580_2623465_+	DUF2163 domain-containing protein	NA	F4YXU3	Roseobacter_phage	40.2	4.9e-57
WP_085378400.1|2623461_2623896_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.4	1.5e-30
WP_085378401.1|2623904_2627942_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	42.9	3.9e-271
WP_085378402.1|2627952_2629029_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	39.3	2.1e-54
WP_036708073.1|2629048_2629336_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	51.9	5.8e-12
WP_036700213.1|2629409_2630084_+	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	50.6	1.2e-42
>prophage 10
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2679876	2701811	2939512	terminase,head,protease,portal,capsid	Acidithiobacillus_phage(26.09%)	28	NA	NA
WP_085378931.1|2679876_2680380_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	64.4	3.0e-51
WP_085378428.1|2680376_2680577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378429.1|2680569_2681016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378430.1|2681418_2682738_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	39.0	7.0e-76
WP_085378431.1|2682737_2683739_+	DNA cytosine methyltransferase	NA	D2XJU8	Escherichia_phage	43.1	5.9e-67
WP_085378432.1|2683735_2683951_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	62.0	1.2e-14
WP_085378433.1|2684060_2685134_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	1.9e-10
WP_085378434.1|2685297_2685870_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	38.8	2.8e-13
WP_085378435.1|2685959_2686184_-	hypothetical protein	NA	A0A0K0PVN5	Roseobacter_phage	47.9	5.9e-12
WP_085378436.1|2686295_2686892_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	43.0	2.3e-26
WP_085378437.1|2686839_2688852_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	61.2	9.2e-221
WP_085378438.1|2688855_2689071_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	44.9	2.3e-05
WP_085378439.1|2689075_2690590_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	59.0	1.7e-147
WP_169712168.1|2690594_2691635_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.6	1.9e-44
WP_085378440.1|2691638_2692004_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	46.1	2.6e-09
WP_169712169.1|2692063_2693068_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	32.2	2.8e-37
WP_085378442.1|2693067_2693379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378443.1|2693385_2694006_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	57.9	5.1e-53
WP_157115341.1|2694089_2694704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169712170.1|2694869_2695175_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085378445.1|2695286_2695706_+	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	57.9	2.0e-37
WP_085378446.1|2695729_2696674_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.5	4.6e-98
WP_085378447.1|2696676_2697132_+	hypothetical protein	NA	G8DH52	Emiliania_huxleyi_virus	30.1	1.6e-08
WP_085378448.1|2697212_2697392_+	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	60.0	6.6e-06
WP_085378449.1|2697436_2699854_+	tape measure protein	NA	A0A2D0W9N5	Bordetella_phage	32.0	8.3e-59
WP_085378450.1|2699863_2700490_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	56.3	2.3e-61
WP_085378451.1|2700486_2701371_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.6	2.4e-64
WP_085378452.1|2701367_2701811_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.7	4.0e-28
>prophage 11
NZ_CP020612	Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T chromosome, complete genome	2939512	2709087	2718820	2939512		uncultured_Caudovirales_phage(57.14%)	13	NA	NA
WP_085378457.1|2709087_2711010_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	56.1	2.4e-24
WP_085378458.1|2711044_2712064_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_157115342.1|2712117_2712288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378459.1|2712284_2712572_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	44.4	3.8e-11
WP_085378460.1|2712645_2713320_+	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	49.4	4.0e-43
WP_085378461.1|2713316_2713574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085378463.1|2713785_2714853_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.9	1.3e-85
WP_085378464.1|2714849_2715605_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.1	1.8e-76
WP_085378465.1|2715712_2716789_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_085378466.1|2716811_2717246_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.5	2.7e-45
WP_085378467.1|2717242_2717605_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085378468.1|2717709_2717889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085378469.1|2717968_2718820_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	2.2e-46
