The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	1154312	1167495	4888773		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1154312_1155074_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1155067_1155694_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1155833_1156973_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1157035_1158028_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1158121_1159486_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1159574_1160351_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1160355_1160994_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1160990_1162253_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847974.1|1162249_1163158_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_001300386.1|1163353_1164121_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141341.1|1164171_1164828_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001272924.1|1164933_1167495_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	1202577	1260340	4888773	integrase,tRNA,tail	Salmonella_phage(46.15%)	54	1246755:1246792	1263141:1263178
WP_000047170.1|1202577_1205208_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1205442_1205628_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273292.1|1207085_1207652_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_085381327.1|1207648_1208077_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611812.1|1208149_1209706_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1209855_1210371_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1210434_1211973_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1211989_1213162_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1213288_1213819_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119750.1|1213909_1214245_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1214234_1214972_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_044863723.1|1215095_1216280_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216521.1|1216471_1217464_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774988.1|1217520_1218585_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985483.1|1218577_1219780_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1220134_1221094_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246527.1|1221103_1223248_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|1223220_1223631_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1223627_1223873_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1224120_1224450_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1224601_1224946_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1224982_1225432_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1226100_1226505_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229442.1|1226551_1227076_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1227085_1227385_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1227567_1227726_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|1227809_1228259_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1228259_1228922_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1228942_1230343_-	GABA permease	NA	NA	NA	NA	NA
WP_044863724.1|1230653_1231934_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	3.2e-33
WP_044863725.1|1231947_1233396_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271962.1|1233418_1234687_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_044863726.1|1234705_1235683_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_047085397.1|1239660_1241085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072057942.1|1241462_1241681_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	72.0	5.4e-10
WP_001120794.1|1241835_1241955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085381328.1|1242019_1246588_+	adhesin-like autotransporter YpjA/EhaD	NA	NA	NA	NA	NA
1246755:1246792	attL	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001352570.1|1246877_1247924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|1247913_1248954_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_000052558.1|1248957_1249590_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.6	5.9e-65
WP_000102105.1|1249706_1249949_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460853.1|1249981_1250491_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	6.6e-83
WP_000956182.1|1250498_1250699_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|1250662_1251004_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|1251071_1251305_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752623.1|1251304_1251532_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	1.0e-35
WP_085381329.1|1251528_1252383_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	91.5	3.1e-149
WP_001086836.1|1252687_1253293_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_085381330.1|1253289_1254696_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.0	5.8e-153
WP_006673257.1|1254698_1255139_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.2e-51
WP_085381331.1|1255910_1256489_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	87.4	1.2e-88
WP_050498778.1|1256488_1257040_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	8.8e-57
WP_000905032.1|1257067_1257634_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000980413.1|1259854_1260340_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
1263141:1263178	attR	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
>prophage 3
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	1699446	1743258	4888773	tail,transposase,plate,head,protease,integrase	Burkholderia_virus(44.44%)	60	1692966:1692981	1727888:1727903
1692966:1692981	attL	AACGGTGAAGGCCAGC	NA	NA	NA	NA
WP_000849209.1|1699446_1699935_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686723.1|1700342_1700837_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|1700826_1701090_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778067.1|1701086_1703573_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_085381348.1|1703579_1704275_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_001567741.1|1704261_1705125_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_077252871.1|1705264_1705651_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_020803523.1|1705613_1706003_-	DNA-binding protein RdgB	NA	Q6QIE8	Burkholderia_phage	52.5	6.5e-30
WP_045285386.1|1706417_1706633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304080.1|1706622_1706850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803512.1|1706846_1707536_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.4	8.5e-25
WP_032438819.1|1707522_1707819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803515.1|1707815_1708004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|1708082_1708694_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_000835317.1|1708711_1708981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069335269.1|1708983_1710150_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	9.7e-122
WP_011410680.1|1710160_1711930_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_006687266.1|1711933_1712842_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_000042842.1|1712851_1713157_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_001041677.1|1713153_1713378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021544473.1|1713466_1713877_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001569386.1|1713912_1714446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059329513.1|1714493_1715264_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.7e-98
WP_059329514.1|1715507_1716074_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_016191696.1|1716449_1716800_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_045285375.1|1716802_1717525_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.4	1.8e-62
WP_032438838.1|1717514_1718168_+	lipoprotein	NA	J9SVN7	Pseudomonas_phage	31.6	1.4e-08
WP_020803495.1|1718164_1718497_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122433.1|1718489_1718801_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000124057.1|1718800_1719346_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_059329515.1|1719342_1720866_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.3e-182
WP_006687283.1|1720865_1722362_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	2.8e-174
WP_032438840.1|1722342_1723164_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.9	9.0e-98
WP_032438841.1|1723166_1723625_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	1.1e-28
WP_032438842.1|1723839_1724937_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	50.1	2.0e-97
WP_029464126.1|1724950_1725904_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.3	9.9e-64
WP_000537462.1|1725914_1726271_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271666.1|1726272_1726719_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_001101809.1|1726718_1727183_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_001446463.1|1727179_1727434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729861.1|1727423_1728851_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
1727888:1727903	attR	AACGGTGAAGGCCAGC	NA	NA	NA	NA
WP_001062395.1|1728850_1729372_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_059329506.1|1729374_1729656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084225.1|1729754_1730069_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1730034_1730172_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_059329505.1|1730264_1732730_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	1.3e-171
WP_006687304.1|1732729_1733614_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_006687305.1|1733610_1733826_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_006687307.1|1733813_1734983_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	48.9	4.6e-87
WP_021544460.1|1734982_1735495_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.9	2.1e-20
WP_000859115.1|1735549_1735897_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_020803501.1|1735887_1736991_+|plate	baseplate J-like protein	plate	A4JWL6	Burkholderia_virus	53.3	9.2e-106
WP_006687313.1|1736983_1737562_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	7.5e-67
WP_085381349.1|1737564_1738524_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.7	9.0e-65
WP_047668183.1|1738524_1739127_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.9	2.3e-95
WP_047668181.1|1739098_1739539_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_001569399.1|1739972_1740554_+	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	2.9e-66
WP_000835174.1|1740634_1741084_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1741093_1741696_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_001300563.1|1742145_1743258_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	1823379	1832820	4888773		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1823379_1824306_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1824310_1825042_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1825022_1825130_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1825189_1825921_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1826142_1827828_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1827824_1828544_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1828590_1829061_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1829100_1829562_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370558.1|1829686_1831687_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001300968.1|1831683_1832820_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	1844452	1944624	4888773	lysis,tail,plate,tRNA,head,portal,capsid,integrase,holin,terminase	Escherichia_phage(47.83%)	94	1863402:1863418	1939995:1940011
WP_001350533.1|1844452_1846486_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1846617_1847727_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1847989_1848271_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1848563_1849106_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|1849185_1849860_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_057107530.1|1852371_1853406_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153074.1|1853487_1853826_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134632.1|1854044_1854869_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1854989_1855262_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195584.1|1855484_1856273_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1856269_1857070_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000434038.1|1858004_1858751_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011954.1|1858724_1859690_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1859686_1860691_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858484.1|1860687_1861965_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|1862221_1863274_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
1863402:1863418	attL	GCCGCATCCGGCATAAA	NA	NA	NA	NA
WP_001307281.1|1863579_1864434_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_085381359.1|1864462_1865725_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182897.1|1865734_1866187_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1866217_1866502_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_085381360.1|1866505_1867861_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_057107527.1|1867908_1868949_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1869048_1869828_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1869909_1870809_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1871213_1871531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985261.1|1871795_1872809_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|1872924_1873224_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1873345_1873621_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|1873798_1874299_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|1874362_1874587_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|1874586_1874889_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_048236658.1|1875109_1875385_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_085381361.1|1875374_1877630_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.3	0.0e+00
WP_001062015.1|1877805_1879089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389235.1|1879081_1880065_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_085381362.1|1880455_1881490_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	7.9e-200
WP_085381363.1|1881489_1883262_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.3	0.0e+00
WP_085381364.1|1883435_1884290_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	97.9	3.7e-155
WP_085381365.1|1884348_1885422_+|capsid	phage major capsid protein, P2 family	capsid	A0A0F7LBR8	Escherichia_phage	99.2	8.2e-200
WP_085381366.1|1885425_1886169_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	3.3e-123
WP_000988633.1|1886268_1886778_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|1886777_1886981_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|1886984_1887266_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1887265_1887763_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021538486.1|1887777_1888203_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.2e-58
WP_021536418.1|1888190_1888616_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	9.4e-67
WP_072128605.1|1888587_1888761_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	1.5e-23
WP_000917155.1|1888723_1889191_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_085381367.1|1889183_1889636_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
WP_085381368.1|1889707_1890493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297846.1|1890576_1891212_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	6.9e-114
WP_010835475.1|1891208_1891556_+	protein 25-like lysozyme	NA	A0A0F7L9X3	Escherichia_phage	99.1	1.9e-57
WP_085381369.1|1891560_1892469_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	4.4e-162
WP_001285325.1|1892461_1892992_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_085381370.1|1893002_1895048_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	99.7	0.0e+00
WP_085381371.1|1895051_1895579_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	94.3	2.0e-90
WP_021534238.1|1895920_1898485_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_021534237.1|1899008_1899545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021545826.1|1899989_1901180_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|1901192_1901711_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|1901767_1902043_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1902075_1902195_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_085381372.1|1902187_1904635_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_001403130.1|1904649_1905129_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.9e-84
WP_000882975.1|1905128_1906292_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000468308.1|1906373_1906592_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1906910_1909193_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|1909247_1910105_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|1910510_1912271_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1912400_1913093_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|1913291_1914380_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|1914450_1915734_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1915902_1916667_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|1916839_1917523_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1917633_1919307_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1919466_1919751_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1919958_1922223_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1922259_1924008_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570539.1|1924004_1924991_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_085381373.1|1925027_1926260_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1926311_1926494_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011603.1|1926490_1927237_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1927390_1928284_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|1928260_1929040_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|1929175_1929961_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1929957_1931280_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|1931260_1931965_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_085381374.1|1931964_1936425_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_085381375.1|1936685_1938533_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1938713_1939262_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|1939288_1939936_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1940157_1941348_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
1939995:1940011	attR	TTTATGCCGGATGCGGC	NA	NA	NA	NA
WP_000977920.1|1941532_1942621_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_085381376.1|1943223_1944624_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	2.6e-81
>prophage 6
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	2498502	2533257	4888773	lysis,tail,transposase,integrase,terminase	Enterobacteria_phage(30.0%)	48	2487558:2487571	2509884:2509897
2487558:2487571	attL	CAGCTTCAATGGCT	NA	NA	NA	NA
WP_085948620.1|2498502_2499716_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001300836.1|2500701_2501007_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2501114_2501825_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2501827_2502388_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_044864500.1|2502422_2502764_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2502898_2503225_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2503430_2504645_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836064.1|2504656_2505676_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001360138.1|2505733_2505844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2505863_2507144_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|2507178_2507415_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048342.1|2507502_2509974_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
2509884:2509897	attR	CAGCTTCAATGGCT	NA	NA	NA	NA
WP_001083297.1|2510066_2510258_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2510254_2510443_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085381401.1|2510538_2510880_+	hypothetical protein	NA	U5P0A0	Shigella_phage	56.1	8.2e-37
WP_001151262.1|2510920_2511343_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2511339_2511696_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|2513779_2513962_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2514139_2515453_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2515889_2516222_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2516424_2516730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2516754_2516994_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2516993_2517281_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2517352_2517508_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2517724_2517976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2518042_2518321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028985484.1|2518322_2519372_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.2	3.7e-112
WP_001047135.1|2519385_2520138_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2520415_2520505_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000066484.1|2521074_2521290_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2522043_2522259_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2522263_2522575_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2522571_2523105_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_028985485.1|2523101_2523599_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	28.8	6.4e-06
WP_000066495.1|2523961_2524174_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2524184_2524373_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2524375_2524441_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2524520_2524676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2524847_2525021_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2525172_2525583_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_085381402.1|2525640_2525874_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_157108323.1|2526498_2527488_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	6.6e-196
WP_000885611.1|2527827_2528403_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086522.1|2528500_2529091_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2529407_2529641_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2529709_2529823_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2530424_2531708_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527753.1|2531796_2533257_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 7
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	3034783	3041101	4888773		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100779.1|3034783_3035341_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	7.3e-51
WP_057107516.1|3035345_3036224_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.5e-106
WP_057107517.1|3036281_3037181_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.2e-28
WP_085381428.1|3037180_3038266_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	2.3e-101
WP_000183060.1|3038638_3039532_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_040079809.1|3039706_3041101_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	2.8e-19
>prophage 8
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	3087884	3144300	4888773	lysis,tail,plate,tRNA,head,portal,protease,capsid,integrase,terminase,holin	Escherichia_phage(43.75%)	56	3098761:3098777	3135254:3135270
WP_016243684.1|3087884_3089288_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	7.0e-34
WP_016243685.1|3089284_3090007_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	4.9e-31
WP_000929408.1|3090197_3090530_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|3090676_3092038_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_032190111.1|3092340_3092529_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	2.2e-31
WP_001461865.1|3092610_3093774_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.6e-204
WP_001403130.1|3093773_3094253_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.9e-84
WP_085381372.1|3094267_3096715_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000785970.1|3096707_3096827_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|3096859_3097135_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|3097191_3097710_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_085381430.1|3097722_3098913_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.8e-225
3098761:3098777	attL	GGTAATCAGCACAGGTT	NA	NA	NA	NA
WP_085381431.1|3099239_3100010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085381432.1|3100200_3100728_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.9	1.2e-90
WP_085381433.1|3100731_3102741_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	97.6	0.0e+00
WP_001285325.1|3102751_3103282_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_085381434.1|3103274_3104183_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	9.8e-162
WP_000127163.1|3104187_3104535_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_085381535.1|3104531_3105161_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.7	1.3e-107
WP_024259821.1|3105247_3106321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085381435.1|3106423_3106876_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
WP_000917155.1|3106868_3107336_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_072128605.1|3107298_3107472_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	1.5e-23
WP_021536418.1|3107443_3107869_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	9.4e-67
WP_021538486.1|3107856_3108282_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.2e-58
WP_001144101.1|3108296_3108794_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3108793_3109075_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|3109078_3109282_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|3109281_3109791_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_085381366.1|3109890_3110634_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	3.3e-123
WP_085381365.1|3110637_3111711_-|capsid	phage major capsid protein, P2 family	capsid	A0A0F7LBR8	Escherichia_phage	99.2	8.2e-200
WP_085381364.1|3111769_3112624_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	97.9	3.7e-155
WP_085381363.1|3112797_3114570_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.3	0.0e+00
WP_085381436.1|3114569_3115604_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.5e-198
WP_085381437.1|3116122_3118342_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085381438.1|3118589_3120857_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.1	0.0e+00
WP_048236658.1|3120846_3121122_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_001277958.1|3121342_3121645_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557703.1|3121644_3121869_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|3121932_3122433_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001389237.1|3122610_3122967_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3123075_3123375_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3123468_3124464_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3124495_3125293_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000886683.1|3126492_3127785_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_044864092.1|3127875_3129219_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_001295343.1|3129229_3129841_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3129999_3133989_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3134123_3134618_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3135162_3136128_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
3135254:3135270	attR	AACCTGTGCTGATTACC	NA	NA	NA	NA
WP_001043598.1|3136250_3138017_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202175.1|3138017_3139739_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3139780_3140485_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3140769_3140988_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3141672_3143949_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3143979_3144300_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 9
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	3708982	3791438	4888773	transposase,integrase,holin,protease	Micromonas_sp._RCC1109_virus(10.0%)	76	3784797:3784847	3799841:3799891
WP_000131044.1|3708982_3711016_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3711144_3711732_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3711745_3713218_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3713231_3714902_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3715114_3715783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3716025_3716721_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3716713_3718141_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3718151_3718871_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3719397_3720252_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3720477_3721803_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3721911_3722148_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3722159_3722753_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3723342_3724194_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001301257.1|3725105_3725648_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3725722_3726310_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3726367_3727036_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_085381463.1|3727061_3729587_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3729576_3731220_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3731188_3731899_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3732211_3732541_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000192349.1|3733801_3734848_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_044864534.1|3734956_3735889_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_057107709.1|3735875_3737279_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_085381464.1|3737553_3738765_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|3738834_3739848_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_000044265.1|3739844_3740795_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	5.3e-33
WP_000222149.1|3741610_3742477_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001568600.1|3742505_3743468_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001254932.1|3744916_3746068_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_032149279.1|3746989_3748180_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	1.6e-47
WP_157108328.1|3748506_3748770_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|3748784_3749048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643630.1|3749277_3749559_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057107661.1|3749593_3750163_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000101612.1|3750268_3753151_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|3753150_3753342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085381466.1|3753402_3755130_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	5.7e-86
WP_001275372.1|3755217_3755676_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|3755698_3756613_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001005473.1|3756715_3757603_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090787.1|3757692_3758304_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_057107660.1|3758383_3759529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786815.1|3759518_3759959_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_044864659.1|3759962_3761678_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|3761674_3762172_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_044864660.1|3762149_3763115_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323729.1|3763139_3764291_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_001065555.1|3766983_3767847_+	GTPase family protein	NA	NA	NA	NA	NA
WP_085381467.1|3767938_3768760_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.6e-46
WP_023326104.1|3768976_3769678_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_057107659.1|3769718_3769955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239438.1|3769954_3770398_+	phage transcriptional regulator	NA	NA	NA	NA	NA
WP_057107658.1|3770421_3770889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|3770965_3771205_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|3771302_3771761_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000691994.1|3772260_3772482_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070396.1|3772500_3772818_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000854680.1|3772838_3773180_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_033801639.1|3773719_3774934_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033801635.1|3774969_3775248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045148748.1|3775586_3777452_-	cell envelope integrity protein TolA	NA	A0A1D7XFE4	Escherichia_phage	31.7	2.5e-63
WP_033801633.1|3777444_3777642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801631.1|3777990_3778350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801630.1|3778346_3778562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085381469.1|3780008_3780347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085381539.1|3780339_3780576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157108329.1|3781130_3781424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246052.1|3782568_3783312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000019402.1|3783836_3784817_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
3784797:3784847	attL	GAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGAC	NA	NA	NA	NA
WP_157108330.1|3784815_3785199_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	99.1	1.7e-59
WP_000051905.1|3785075_3786239_+|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_001407714.1|3786411_3787812_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3787928_3788369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3788365_3788590_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023567973.1|3788708_3789563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|3790225_3791438_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
3799841:3799891	attR	GAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGAC	NA	NA	NA	NA
>prophage 10
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	4181401	4186164	4888773	transposase	Enterobacteria_phage(57.14%)	8	NA	NA
WP_000684852.1|4181401_4182358_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000175457.1|4182358_4183126_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4183682_4183940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001547737.1|4184084_4184435_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_085381488.1|4184582_4185038_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
WP_001244670.1|4185030_4185318_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_064455212.1|4185310_4185901_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001149161.1|4185897_4186164_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
>prophage 11
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	4189798	4290976	4888773	tail,plate,transposase,head,portal,protease,capsid,integrase,terminase,holin,tRNA	Enterobacteria_phage(72.13%)	105	4218251:4218267	4237605:4237621
WP_085381490.1|4189798_4191052_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	3.6e-74
WP_001344104.1|4191495_4192515_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.2e-44
WP_001344103.1|4192644_4194147_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
WP_001295681.1|4194307_4195390_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4195389_4196490_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4196756_4198268_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4198525_4198969_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|4198968_4201824_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000079628.1|4201879_4203076_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059398.1|4203268_4203772_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4203817_4204234_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012933.1|4204395_4205409_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_044863984.1|4205477_4207130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001344097.1|4207252_4207705_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000256663.1|4207849_4208443_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500721.1|4208513_4209227_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230266.1|4209357_4209753_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4210033_4210168_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4210171_4211107_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4211119_4211581_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_085381491.1|4211653_4212040_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471899.1|4212245_4214942_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4215082_4215136_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181329.1|4215320_4216268_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	4.6e-13
WP_001299664.1|4216386_4217808_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001344094.1|4217857_4219513_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
4218251:4218267	attL	GGCGAACCAGAAACGCC	NA	NA	NA	NA
WP_000187778.1|4219906_4222045_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|4222202_4222667_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_001232240.1|4222711_4223098_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4223280_4224633_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4224726_4225278_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219814.1|4225428_4226802_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4226977_4227976_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596026.1|4228008_4229004_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001311334.1|4228990_4230013_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205814.1|4230026_4231529_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265942.1|4231668_4232625_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4232934_4233465_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_001372721.1|4233923_4234919_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	100.0	2.4e-193
WP_021580386.1|4234985_4235285_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	100.0	1.2e-44
WP_001158283.1|4235393_4235819_+	regulatory protein	NA	A0A0A7NPS5	Enterobacteria_phage	100.0	9.1e-78
WP_000664580.1|4235856_4236207_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	100.0	5.4e-60
WP_000159895.1|4236217_4236496_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	100.0	1.2e-43
WP_000514277.1|4236507_4236750_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|4236746_4236860_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_001560998.1|4236946_4237150_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	100.0	4.0e-31
WP_000153676.1|4237146_4237392_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	100.0	6.7e-41
WP_046788693.1|4237388_4237703_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	100.0	5.4e-51
4237605:4237621	attR	GGCGAACCAGAAACGCC	NA	NA	NA	NA
WP_001036809.1|4237699_4237903_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	100.0	4.8e-29
WP_001603062.1|4237899_4238730_+|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	100.0	8.7e-133
WP_085381492.1|4239097_4239328_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	1.4e-32
WP_074568454.1|4239400_4239766_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	3.3e-60
WP_085381493.1|4239772_4242646_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
WP_000686544.1|4242670_4243630_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000211267.1|4243634_4243946_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000087812.1|4245066_4246113_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_064506808.1|4246112_4247864_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262639.1|4248018_4248855_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	2.1e-147
WP_001055107.1|4248878_4249931_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_000632345.1|4249976_4250777_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063093.1|4250878_4251373_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000864901.1|4251372_4251573_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|4251575_4251899_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072328.1|4251895_4252288_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000920594.1|4252829_4253297_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356320.1|4253289_4253925_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.5e-113
WP_001271922.1|4253921_4254503_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.5e-102
WP_000213447.1|4254499_4254850_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111925.1|4254853_4255750_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_001443704.1|4255742_4256273_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_085381494.1|4256275_4258294_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	87.7	6.1e-305
WP_021520805.1|4258297_4258825_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	96.0	2.0e-90
WP_021520804.1|4258853_4259387_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	5.5e-96
WP_047616109.1|4259389_4259947_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	89.7	4.5e-85
WP_000905061.1|4260165_4260765_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|4260793_4261282_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_085381495.1|4261294_4264102_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.0	0.0e+00
WP_000333503.1|4264088_4264244_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|4264252_4264627_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290450.1|4264682_4265195_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_085381496.1|4265194_4266379_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	9.9e-223
WP_001519190.1|4266536_4267646_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_001448290.1|4267688_4267949_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|4268139_4268280_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_071533696.1|4268409_4268643_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_000288983.1|4268635_4268878_-	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	100.0	2.5e-40
WP_001219160.1|4269053_4269395_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060860.1|4269397_4273177_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_044863985.1|4273173_4274907_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001305659.1|4275112_4275751_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4276074_4277418_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4277479_4277686_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_044863987.1|4278010_4278565_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937663.1|4278654_4279566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886916.1|4279777_4280518_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_044864029.1|4280707_4282651_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4282779_4283160_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560580.1|4283248_4284109_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001344083.1|4284216_4285182_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331457.1|4285289_4285952_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4285996_4287409_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4287716_4288337_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4288555_4289194_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001344082.1|4289328_4290537_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	2.3e-206
WP_000604959.1|4290544_4290976_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.1e-41
>prophage 12
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	4557924	4681866	4888773	tail,transposase,plate,head,portal,protease,capsid,integrase,holin,tRNA	Enterobacteria_phage(35.56%)	117	4616250:4616294	4650103:4650147
WP_000187022.1|4557924_4559025_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4559064_4559424_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4559423_4560074_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4560404_4561805_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4561787_4562705_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_016241742.1|4562971_4564345_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4564405_4565182_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935364.1|4565189_4566194_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_004025957.1|4566403_4567537_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	33.8	4.9e-46
WP_001446285.1|4568036_4569188_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005586.1|4569539_4572191_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_044863836.1|4572373_4574107_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_085381506.1|4574321_4575173_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044863839.1|4575159_4575501_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_044863840.1|4576345_4578643_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4578693_4579014_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4579028_4580108_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_047085185.1|4580416_4582918_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4582929_4583592_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4583602_4584706_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_001514755.1|4584981_4585599_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4585625_4586531_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|4586624_4588805_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4589133_4590024_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4590372_4592805_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4592807_4593968_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4594244_4594562_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_032237140.1|4594745_4595354_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4595414_4595627_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001400571.1|4595829_4598028_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4598183_4599209_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4599300_4600260_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4600352_4600883_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4600892_4602224_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4602290_4603217_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4603309_4603795_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4603879_4604125_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4604549_4605395_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4605417_4606926_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4607060_4608071_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4608167_4608914_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4608918_4609347_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4609373_4609673_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4609884_4610325_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4610425_4611025_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4611132_4611900_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708995.1|4611954_4612710_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4612816_4613806_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4614125_4615088_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4615268_4616171_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4616250:4616294	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_063217269.1|4616414_4616798_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	66.1	5.0e-43
WP_085381544.1|4616923_4617172_-	hypothetical protein	NA	A0A0F7LDQ9	Escherichia_phage	47.7	1.8e-09
WP_063217268.1|4617211_4618348_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	74.9	1.0e-160
WP_063217267.1|4618501_4619683_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.9	3.6e-172
WP_006117904.1|4619683_4620199_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.7e-60
WP_045292898.1|4620247_4620565_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	9.9e-21
WP_032424037.1|4620570_4620726_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_085381545.1|4620712_4623679_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	53.3	2.0e-264
WP_063217265.1|4623693_4624182_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	73.5	7.0e-66
WP_085381508.1|4624705_4625146_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.0	5.8e-51
WP_085381509.1|4625117_4625723_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.4	6.3e-64
WP_085381510.1|4625722_4626805_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	56.4	3.2e-103
WP_085381511.1|4626794_4627409_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	7.2e-68
WP_063217263.1|4627401_4628298_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.1	1.7e-105
WP_063217262.1|4628284_4628653_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_063217261.1|4628649_4629231_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	67.9	2.4e-73
WP_085381512.1|4629227_4629866_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.6	2.1e-57
WP_058651648.1|4629858_4630329_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	68.0	3.8e-61
WP_058651649.1|4630333_4630870_-	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	75.0	1.2e-26
WP_058651650.1|4630866_4631307_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	82.9	1.2e-64
WP_058651651.1|4631293_4631626_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	90.9	7.7e-48
WP_058651652.1|4631635_4631836_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	78.5	2.5e-22
WP_058651653.1|4631835_4632360_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.3	3.9e-38
WP_058651655.1|4633361_4634411_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.0	5.1e-106
WP_085381513.1|4634434_4635271_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.4e-101
WP_063217259.1|4635430_4637161_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.8	3.3e-267
WP_058651658.1|4637160_4638219_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.8	1.4e-143
WP_085381514.1|4638655_4640881_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_040118242.1|4640894_4642028_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.0	1.1e-16
WP_085381546.1|4642153_4644391_-	replication endonuclease	NA	Q6K1F3	Salmonella_virus	43.4	1.4e-137
WP_058651661.1|4644645_4644930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058651662.1|4644926_4645781_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	66.1	1.9e-103
WP_058651663.1|4645777_4646350_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_058651664.1|4646419_4646812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063217257.1|4647145_4647508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074149901.1|4647595_4647823_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.0	7.3e-26
WP_080465295.1|4647998_4648208_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.2	9.8e-09
WP_063217255.1|4648261_4648543_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	72.0	3.7e-35
WP_063217254.1|4648651_4648957_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	51.5	1.5e-18
WP_063217253.1|4649023_4650004_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	93.3	4.0e-177
WP_001223800.1|4650172_4650673_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4650103:4650147	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_001033722.1|4650822_4651521_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4651517_4652891_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_085381515.1|4652996_4653671_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4653819_4654803_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|4655062_4655683_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_044863842.1|4655967_4657002_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_072022777.1|4656998_4657937_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217139.1|4657920_4658757_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144074.1|4659044_4660514_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_000211497.1|4660510_4661770_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179745.1|4662220_4663045_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619493.1|4663054_4663369_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_032255424.1|4666057_4666504_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_085381517.1|4666514_4667966_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019484.1|4667955_4669026_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001544240.1|4669025_4670774_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001295677.1|4670823_4671879_-	YiiG family protein	NA	NA	NA	NA	NA
WP_085381518.1|4672031_4672865_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_010723259.1|4673058_4676109_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4676121_4677024_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4677020_4677656_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027705.1|4677652_4678582_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4678911_4679154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4679371_4679590_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|4680442_4681384_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4681428_4681866_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP020835	Escherichia coli strain CFSAN051542 chromosome, complete genome	4888773	4830442	4858524	4888773	transposase,integrase,tRNA	Chrysochromulina_ericina_virus(20.0%)	26	4851229:4851242	4859838:4859851
WP_000499788.1|4830442_4832332_+|tRNA	tRNA uridine(34) 5-carboxymethylaminomethyl synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000932839.1|4832395_4833019_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000116695.1|4833635_4834016_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000135625.1|4834024_4834840_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|4834886_4835126_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_001052219.1|4835187_4835658_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_001288587.1|4835672_4836206_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001176745.1|4836218_4837760_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000896498.1|4837810_4838674_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_000190497.1|4838700_4840083_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_001251965.1|4840103_4840523_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000933736.1|4840872_4842243_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_085381524.1|4842404_4844234_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	8.6e-133
WP_001029679.1|4844393_4845215_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|4845201_4847310_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4847306_4848974_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4848976_4850503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4850503_4852120_+|transposase	transposase	transposase	NA	NA	NA	NA
4851229:4851242	attL	TAAGGATTATTTAG	NA	NA	NA	NA
WP_001271300.1|4852350_4852728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4853137_4853509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4853569_4854067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|4854142_4854931_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|4854988_4855513_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_063860585.1|4855581_4856322_-	subclass B1 metallo-beta-lactamase IMP-27	NA	NA	NA	NA	NA
WP_001339197.1|4856493_4857702_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000071896.1|4857987_4858524_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
4859838:4859851	attR	CTAAATAATCCTTA	NA	NA	NA	NA
