The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	341608	351387	4610863		Synechococcus_phage(50.0%)	9	NA	NA
WP_066158522.1|341608_342907_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.7	7.7e-19
WP_066158519.1|342972_343695_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FDR9	Synechococcus_phage	43.0	1.4e-46
WP_066158517.1|343682_343934_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	33.3	1.2e-05
WP_066158514.1|343930_344614_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_066158512.1|344597_346823_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.9	9.4e-166
WP_066158510.1|346798_348211_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.3	1.4e-50
WP_066158509.1|348231_349266_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.2	4.6e-67
WP_066158506.1|349265_349844_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.0	6.2e-29
WP_066158504.1|349848_351387_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.0	4.0e-75
>prophage 2
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	379463	457253	4610863	portal,capsid,terminase,integrase,tRNA,tail,holin	Bacillus_phage(50.0%)	110	394306:394324	467102:467120
WP_066158464.1|379463_379754_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_066158460.1|379771_381229_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_066158458.1|381244_382675_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_066158456.1|382855_383758_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_066158455.1|383882_385253_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	47.8	1.3e-120
WP_066158454.1|385305_386436_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.8	1.3e-115
WP_066158453.1|386529_386880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169801154.1|386854_387472_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_066158448.1|387557_387887_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	38.5	8.2e-10
WP_066158447.1|388052_388292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066158445.1|388335_388542_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	56.4	4.6e-11
WP_066158443.1|388544_388784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158441.1|388807_389116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158439.1|389094_389478_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	45.2	6.4e-22
WP_066158437.1|389536_389800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158435.1|389818_390376_+	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	54.1	9.9e-48
WP_157076897.1|390501_391194_+	recombinase	NA	Q0ILF6	Lactococcus_phage	43.3	4.5e-34
WP_066158432.1|391450_391834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158430.1|391871_392069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158429.1|392362_392644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158427.1|392634_393402_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	64.8	1.6e-85
WP_066158425.1|393467_393662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158423.1|393701_393902_+	hypothetical protein	NA	W8EEZ5	Geobacillus_phage	53.8	6.9e-12
WP_066158422.1|394042_394276_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
394306:394324	attL	GTAATCATTATATTAAATT	NA	NA	NA	NA
WP_066158420.1|394454_394709_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157076894.1|394724_394862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158418.1|394862_395576_+	antA/AntB antirepressor family protein	NA	A0A0S2MYI3	Enterococcus_phage	59.4	3.8e-76
WP_066158416.1|395709_396498_+	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	41.3	1.0e-50
WP_157076893.1|396433_397255_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	39.3	2.8e-43
WP_066158412.1|397265_397496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158410.1|397449_397704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158408.1|397700_398339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157076892.1|398423_398948_+	HNH endonuclease	NA	A6M989	Geobacillus_virus	44.6	1.4e-27
WP_157076891.1|398928_399078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158404.1|399115_399352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158402.1|399467_399647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157076896.1|399710_400220_+	HNH endonuclease	NA	U5PX11	Bacillus_phage	45.2	4.5e-31
WP_066158398.1|400220_400640_+	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	59.0	1.7e-36
WP_066158397.1|400659_400875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158395.1|400871_401381_+	dUTP diphosphatase	NA	A0A2H4J260	uncultured_Caudovirales_phage	42.6	2.5e-34
WP_157076890.1|401382_401529_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_066158394.1|401509_401944_+	DUF1064 domain-containing protein	NA	B5LPP8	Bacillus_virus	45.1	7.2e-22
WP_066158392.1|402028_402421_+	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	40.0	4.1e-16
WP_157076889.1|402430_402580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158390.1|402763_403213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157076895.1|403830_403971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158386.1|404635_404830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158383.1|404961_405432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158381.1|405530_406367_+|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	57.3	2.9e-75
WP_066158379.1|406363_407644_+|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	67.9	1.3e-172
WP_157076888.1|407658_409149_+|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	61.6	3.8e-163
WP_066158376.1|409153_410329_+|capsid	phage minor capsid protein	capsid	Q5YA73	Bacillus_phage	65.4	5.5e-149
WP_066158374.1|410344_410716_+	hypothetical protein	NA	A0A0U3SQD7	Bacillus_phage	68.9	8.9e-45
WP_066158372.1|410817_411471_+	hypothetical protein	NA	B3GW02	Streptococcus_phage	42.2	1.1e-08
WP_066158370.1|411494_412397_+|capsid	capsid protein	capsid	A0A1B1P885	Bacillus_phage	66.7	1.1e-112
WP_066158368.1|412442_412727_+	hypothetical protein	NA	B5LPR5	Bacillus_virus	50.8	5.4e-10
WP_066158366.1|412744_413143_+	hypothetical protein	NA	Q5YA68	Bacillus_phage	73.5	8.9e-51
WP_066158364.1|413136_413478_+|capsid	minor capsid protein	capsid	Q5YA67	Bacillus_phage	85.0	2.0e-51
WP_066158532.1|413480_413804_+|capsid	capsid protein	capsid	Q5YA66	Bacillus_phage	60.4	2.8e-31
WP_066158362.1|413803_414199_+|capsid	minor capsid protein	capsid	Q5YA65	Bacillus_phage	72.5	9.7e-50
WP_066158360.1|414202_414658_+|tail	phage tail protein	tail	Q5YA64	Bacillus_phage	81.8	5.5e-65
WP_066158358.1|414700_415153_+	hypothetical protein	NA	Q5YA63	Bacillus_phage	74.0	1.2e-54
WP_066158356.1|415161_415719_+	hypothetical protein	NA	Q5YA62	Bacillus_phage	66.5	8.9e-65
WP_085449717.1|415719_417435_+	tape measure protein	NA	Q5YA61	Bacillus_phage	45.3	9.6e-110
WP_157108273.1|417437_419198_+	hypothetical protein	NA	Q5YA61	Bacillus_phage	32.8	2.4e-47
WP_066158352.1|419202_420063_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	36.9	5.1e-51
WP_085449719.1|420078_421152_+	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	45.7	2.6e-28
WP_085449720.1|421222_421426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158345.1|421494_422727_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	36.8	1.4e-73
WP_066158343.1|422726_423116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085449721.1|423129_424323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085449722.1|424298_424685_+	hypothetical protein	NA	A0A2P9HXN3	Yersinia_phage	31.3	7.6e-07
WP_085449723.1|425008_426091_+	RNA-directed DNA polymerase	NA	D6PSR5	Lactobacillus_phage	55.9	2.2e-107
WP_157076939.1|426032_426266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157076938.1|426240_426384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066161155.1|426695_427541_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_157076940.1|427515_427683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066161153.1|427702_427915_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	60.6	1.3e-16
WP_066161151.1|428036_428879_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	31.5	3.5e-28
WP_066161148.1|428928_429240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085449724.1|429279_429510_+|holin	phage holin	holin	NA	NA	NA	NA
WP_085449725.1|429502_430435_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1N7	Bacillus_phage	49.6	1.7e-60
WP_085449726.1|430491_431355_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_066158171.1|431377_431971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076881.1|432154_432304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169801150.1|432477_432678_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_066158166.1|432874_433159_+	hypothetical protein	NA	A0A1D6X8A3	Bacillus_phage	49.5	4.6e-17
WP_066158164.1|433544_433976_+	hypothetical protein	NA	A0A0E3T6D7	Bacillus_phage	43.3	1.4e-22
WP_157076879.1|433977_434121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158162.1|434120_436616_+	hypothetical protein	NA	A0A0E3JT76	Bacillus_phage	44.6	6.7e-205
WP_084372386.1|437237_437834_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066158155.1|437998_438952_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_066158153.1|439342_439936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066158151.1|440178_441171_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_066158149.1|441579_443271_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_066158145.1|444961_446593_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_066158143.1|446928_448455_-	sodium/proline symporter PutP	NA	A0A219Y9P9	Aeromonas_phage	24.0	2.7e-07
WP_084372384.1|448761_449799_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_084372382.1|449884_450199_+	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	54.4	6.4e-28
WP_066158140.1|450313_450565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084372390.1|451084_451354_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_066158138.1|451400_451661_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_066158136.1|451853_452333_+	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_157076883.1|452423_452723_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_066158132.1|452740_453025_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_066158129.1|453080_453647_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_066158126.1|453701_454829_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_066158124.1|454871_455099_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_066158121.1|455153_455930_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_066158119.1|456287_457253_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
467102:467120	attR	GTAATCATTATATTAAATT	NA	NA	NA	NA
>prophage 3
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	658839	666733	4610863	portal,capsid,head,integrase,tail	Staphylococcus_phage(33.33%)	11	658657:658708	674541:674592
658657:658708	attL	ACTCAAAATCGTGTTCCTTCTGGAGTGTCGGTTCGACCCCGACCACCGGTAC	NA	NA	NA	NA
WP_066161012.1|658839_659766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	36.0	2.4e-46
WP_066161009.1|659923_660823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169801174.1|660961_661111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066161006.1|661198_661555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066161003.1|662006_662405_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_066161000.1|662422_662641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066160997.1|663276_664497_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	45.3	6.0e-82
WP_066160994.1|664474_665578_+|capsid	phage major capsid protein	capsid	W5RV86	Staphylococcus_phage	45.1	5.1e-64
WP_066160989.1|665660_665963_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1G5SAS7	Enterococcus_phage	46.9	8.3e-17
WP_066160986.1|665976_666309_+|head	phage head closure protein	head	A0A2I7SD08	Paenibacillus_phage	48.5	7.7e-24
WP_066160983.1|666331_666733_+|tail	phage major tail protein, TP901-1 family	tail	A0A0C5AMZ4	Paenibacillus_phage	66.2	9.0e-43
674541:674592	attR	ACTCAAAATCGTGTTCCTTCTGGAGTGTCGGTTCGACCCCGACCACCGGTAC	NA	NA	NA	NA
>prophage 4
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	2373493	2381867	4610863		Bacillus_phage(50.0%)	9	NA	NA
WP_066149362.1|2373493_2373922_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	31.3	6.3e-10
WP_066149364.1|2374042_2374246_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	67.2	2.0e-14
WP_066149366.1|2374463_2375699_+	MFS transporter	NA	NA	NA	NA	NA
WP_157076733.1|2375760_2376651_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	40.8	2.3e-46
WP_066149369.1|2376786_2378274_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	39.2	9.9e-87
WP_066149371.1|2378843_2379557_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_174521893.1|2379720_2379966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066149377.1|2380297_2380993_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.3	1.4e-14
WP_066149380.1|2381231_2381867_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	46.0	2.4e-37
>prophage 5
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	2437653	2464291	4610863	portal,capsid,terminase,head,integrase,coat,tail	Bacillus_phage(42.86%)	36	2436159:2436173	2445965:2445979
2436159:2436173	attL	ATTTTATCAAAATAT	NA	NA	NA	NA
WP_066149542.1|2437653_2438754_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_084371957.1|2438750_2440589_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_066149545.1|2440645_2441599_-	NAD-dependent epimerase/dehydratase family protein	NA	M4QPK0	Synechococcus_phage	31.3	3.5e-29
WP_066149548.1|2441595_2442870_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	33.9	5.9e-64
WP_066149551.1|2443054_2443861_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	44.3	7.3e-52
WP_066149555.1|2444257_2444455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066149558.1|2444754_2445921_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	35.8	1.0e-54
WP_066149561.1|2445978_2446209_-	hypothetical protein	NA	NA	NA	NA	NA
2445965:2445979	attR	ATTTTATCAAAATAT	NA	NA	NA	NA
WP_066149564.1|2446339_2446576_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066149566.1|2446580_2447024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085449796.1|2447025_2447427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149572.1|2447725_2447929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149575.1|2447925_2448552_-	replication-relaxation family protein	NA	A0A0S2GLL8	Bacillus_phage	44.3	7.4e-44
WP_066149578.1|2448551_2449805_-	hypothetical protein	NA	A0A0S2GLG9	Bacillus_phage	42.6	3.5e-69
WP_066149582.1|2449814_2450153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149585.1|2450605_2450830_+	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	39.2	3.5e-12
WP_066149589.1|2450892_2451300_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_157076737.1|2451312_2451462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066149592.1|2451728_2452112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149595.1|2452131_2452587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149598.1|2452888_2453086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149601.1|2453153_2455292_-|tail	phage tail tape measure protein	tail	A0A068A2C9	Staphylococcus_phage	27.6	7.2e-22
WP_157076738.1|2455291_2455543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149607.1|2455602_2455929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149609.1|2455984_2456536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149611.1|2456543_2456987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149614.1|2456983_2457319_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_066149617.1|2457318_2457639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149619.1|2457635_2457941_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_169801072.1|2457952_2458117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066149622.1|2458178_2458997_-	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	64.3	1.8e-98
WP_066149624.1|2459067_2459709_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	43.7	2.5e-31
WP_066149627.1|2459813_2460680_-|capsid	minor capsid protein	capsid	H7BWE7	unidentified_phage	31.4	9.7e-26
WP_066149631.1|2460666_2461989_-|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	36.9	2.7e-67
WP_084371959.1|2462000_2463605_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	32.2	2.2e-71
WP_066149633.1|2463730_2464291_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.1	2.8e-42
>prophage 6
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	2943590	3016470	4610863	tRNA,protease,integrase,coat	Bacillus_phage(27.27%)	58	2941796:2941810	3017828:3017842
2941796:2941810	attL	TATAATAAAACTTAC	NA	NA	NA	NA
WP_066151006.1|2943590_2944145_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	46.3	1.7e-28
WP_066151009.1|2944177_2945683_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_066151014.1|2945791_2947759_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_066151017.1|2947809_2948658_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_066151020.1|2948668_2951389_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.7	4.4e-40
WP_066151023.1|2951725_2952388_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066151026.1|2952502_2953333_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_066151029.1|2953817_2954999_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_066161133.1|2956187_2956484_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_066161131.1|2956480_2956687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161129.1|2956860_2957067_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_066161127.1|2957082_2957442_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_066161124.1|2957467_2958604_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	2.5e-13
WP_085449749.1|2958846_2959278_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_066160612.1|2959689_2960421_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_066160615.1|2960872_2961844_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_066160618.1|2961840_2963019_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_066160621.1|2963060_2964032_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_066160623.1|2964012_2965509_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.9e-21
WP_066160625.1|2965559_2966744_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_066160628.1|2966779_2967970_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066160632.1|2967992_2968802_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_066160635.1|2969050_2970046_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.8	5.7e-30
WP_066160637.1|2970878_2971601_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_066160640.1|2971797_2974719_-	substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.8	1.4e-44
WP_066160643.1|2976622_2977516_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	35.8	8.4e-57
WP_066160645.1|2977565_2979023_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	35.3	6.8e-72
WP_066160647.1|2979981_2980614_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_066160649.1|2980622_2981180_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_066160652.1|2981293_2982013_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	74.8	4.5e-45
WP_066160655.1|2982409_2983051_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_066160658.1|2984455_2984821_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066160664.1|2985944_2987051_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_066160666.1|2987164_2988121_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_066160669.1|2988796_2989213_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_085449804.1|2989515_2990910_-	group II intron reverse transcriptase/maturase	NA	H7BVE9	unidentified_phage	25.6	1.7e-08
WP_066160728.1|2991486_2991999_-	2,4'-dihydroxyacetophenone dioxygenase family protein	NA	NA	NA	NA	NA
WP_066160724.1|2992468_2994460_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_066160721.1|2995213_2995645_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_066160718.1|2995879_2997262_+	spore germination protein	NA	NA	NA	NA	NA
WP_066160715.1|2997276_2998353_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_084372528.1|2998342_2999434_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_066160706.1|2999520_3000711_-	thiolase family protein	NA	NA	NA	NA	NA
WP_066160702.1|3000720_3001383_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_066160698.1|3001342_3002065_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_180319879.1|3002080_3003250_-	chloromuconate cycloisomerase	NA	NA	NA	NA	NA
WP_157076931.1|3003170_3003734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084372524.1|3003824_3004751_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
WP_066160691.1|3005426_3006710_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_084372522.1|3006754_3007594_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_084372530.1|3008051_3009164_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_066160689.1|3009206_3009410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076930.1|3009536_3009701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157108290.1|3009826_3009976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085449805.1|3010485_3011517_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_085449806.1|3011573_3013565_-	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_066160684.1|3013883_3014162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160678.1|3015906_3016470_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	44.6	1.1e-30
3017828:3017842	attR	TATAATAAAACTTAC	NA	NA	NA	NA
>prophage 7
NZ_CP020814	Alkalihalobacillus krulwichiae strain AM31D chromosome, complete genome	4610863	3808327	3854491	4610863	portal,capsid,terminase,protease,head,integrase,tail,holin	Bacillus_phage(28.57%)	70	3810358:3810374	3849445:3849461
WP_066161067.1|3808327_3808558_-|holin	phage holin	holin	NA	NA	NA	NA
WP_066161064.1|3808598_3808910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161061.1|3808966_3809374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161058.1|3809354_3809729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161055.1|3809740_3813736_-	hypothetical protein	NA	A0A142F1N2	Bacillus_phage	59.4	4.8e-136
3810358:3810374	attL	CTTCAATTTCAACACCT	NA	NA	NA	NA
WP_085449827.1|3813786_3814629_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	32.2	2.4e-29
WP_066161153.1|3814750_3814963_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	60.6	1.3e-16
WP_157076940.1|3814982_3815150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161155.1|3815124_3815970_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_157108292.1|3816053_3816206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076938.1|3816281_3816425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076939.1|3816399_3816633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161142.1|3816574_3817657_-	RNA-directed DNA polymerase	NA	D6PSR5	Lactobacillus_phage	56.2	7.4e-108
WP_085449828.1|3817980_3819486_-	hypothetical protein	NA	A0A2P9HXN3	Yersinia_phage	33.7	3.6e-12
WP_066160366.1|3819514_3819976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160368.1|3819972_3821418_-|tail	phage tail family protein	tail	A0A142F1N1	Bacillus_phage	52.2	5.2e-117
WP_066160371.1|3821410_3824710_-|tail	phage tail tape measure protein	tail	Q9ZXE7	Bacillus_phage	46.8	1.4e-69
WP_066160375.1|3824904_3825237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160379.1|3825240_3825816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160381.1|3825818_3826157_-	hypothetical protein	NA	E2ELJ0	Clostridium_phage	30.4	6.0e-08
WP_066160384.1|3826153_3826555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160387.1|3826544_3826862_-|head	phage head closure protein	head	A0A0S2SXM4	Bacillus_phage	41.7	1.1e-11
WP_066160389.1|3826842_3827124_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	54.5	3.1e-18
WP_066160394.1|3827126_3827471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160514.1|3827483_3828674_-|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	51.6	1.7e-76
WP_066160517.1|3828722_3829307_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.9	3.6e-32
WP_066160397.1|3829284_3830481_-|portal	phage portal protein	portal	A0A290G4I4	Caldibacillus_phage	58.7	4.8e-132
WP_066160400.1|3830502_3832200_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	71.1	7.2e-243
WP_066160404.1|3832196_3832571_-	hypothetical protein	NA	A0A0P0IXJ8	Lactobacillus_phage	50.0	1.0e-24
WP_066160410.1|3832691_3833015_-	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	44.9	3.6e-18
WP_169801167.1|3833733_3833901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076927.1|3834245_3834383_-	hypothetical protein	NA	A0A0A0PKV2	Bacillus_phage	60.0	1.3e-06
WP_066160418.1|3834462_3834810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160420.1|3834844_3835057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157076928.1|3835092_3835269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160423.1|3835295_3835763_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	65.2	1.5e-52
WP_066160425.1|3835777_3836224_-	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	65.3	2.3e-47
WP_066160427.1|3836676_3837048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160430.1|3837059_3837272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160431.1|3837278_3837635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160432.1|3837627_3837906_-	hypothetical protein	NA	A0A0S2SXU6	Bacillus_phage	61.6	1.8e-18
WP_066160435.1|3837902_3838094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160439.1|3838068_3838464_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_066160442.1|3838460_3839009_-	hypothetical protein	NA	A0A0C5AFB5	Paenibacillus_phage	51.9	2.9e-44
WP_085449829.1|3839306_3839537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160447.1|3839663_3839936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160450.1|3839928_3841221_-	AAA family ATPase	NA	A0A2H4J268	uncultured_Caudovirales_phage	56.2	3.7e-130
WP_085449830.1|3841198_3841663_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4JAR8	uncultured_Caudovirales_phage	62.5	9.4e-44
WP_085449831.1|3841662_3842037_-	DUF4373 domain-containing protein	NA	A0A2H4JAR8	uncultured_Caudovirales_phage	68.7	3.3e-39
WP_066160456.1|3842054_3842378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160459.1|3842374_3843127_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	64.3	3.8e-87
WP_066160462.1|3843123_3843651_-	HNH endonuclease	NA	G0XNS0	Escherichia_phage	33.8	2.3e-06
WP_066160466.1|3843655_3844510_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	58.7	4.0e-56
WP_169801169.1|3844522_3844675_-	hypothetical protein	NA	A0A0S2MVC5	Bacillus_phage	54.0	2.5e-06
WP_066160468.1|3844671_3846195_-	DUF2813 domain-containing protein	NA	A0A0C5AN14	Bacteriophage	53.3	1.5e-138
WP_066160471.1|3846197_3846416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160474.1|3846431_3846719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084372516.1|3846724_3847195_-	sporulation initiation factor Spo0A C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_066160484.1|3847577_3848375_-	Rha family transcriptional regulator	NA	A0A0K2CXT4	Paenibacillus_phage	48.0	6.8e-50
WP_066160486.1|3848352_3848691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160489.1|3848946_3849144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160493.1|3849147_3849351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066160496.1|3849391_3849631_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	47.9	7.0e-11
3849445:3849461	attR	CTTCAATTTCAACACCT	NA	NA	NA	NA
WP_066160499.1|3849788_3850157_+	helix-turn-helix domain-containing protein	NA	A0A1L2JY18	Aeribacillus_phage	46.7	1.1e-15
WP_066160501.1|3850204_3850786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066160504.1|3850769_3851162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066160507.1|3851240_3851738_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	32.9	8.3e-14
WP_066160511.1|3851734_3853090_+	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	60.2	1.7e-146
WP_157108293.1|3853067_3853235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066161099.1|3853630_3854491_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.4	1.2e-15
