The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	355372	409710	4121819	plate,portal,integrase,head,tail,protease,transposase,capsid,terminase	uncultured_Caudovirales_phage(31.25%)	67	369136:369153	399282:399299
WP_009964559.1|355372_355795_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	1.1e-14
WP_038720984.1|356296_356770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975964.1|356813_357248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076853254.1|357613_357952_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	1.1e-25
WP_009964553.1|357987_358776_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	3.6e-152
WP_009964551.1|358918_359464_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.8	7.3e-80
WP_038720983.1|359463_359961_-	lysozyme	NA	A4JX20	Burkholderia_virus	80.0	2.0e-68
WP_009964547.1|359953_360148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964545.1|360223_361276_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	5.4e-79
WP_009964543.1|361285_361492_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	2.4e-15
WP_009964541.1|361466_362348_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.1	2.0e-31
WP_009964539.1|362356_364771_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	32.9	1.2e-62
WP_004533642.1|364858_365161_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_009964536.1|365230_365734_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
WP_009964534.1|365744_366914_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	3.7e-161
WP_009964532.1|366980_367433_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_004539647.1|367448_368912_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.8	8.0e-214
WP_004539949.1|368899_369475_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
369136:369153	attL	GCCGCGCTGTGCCGTCGC	NA	NA	NA	NA
WP_009964528.1|369467_370361_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	40.1	8.4e-49
WP_004547840.1|370357_370702_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_009964525.1|370698_370905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720980.1|370969_371650_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.1	9.0e-19
WP_004533675.1|371652_372186_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_009964520.1|372175_372706_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.0	4.1e-11
WP_009964519.1|372707_372998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964517.1|373001_373997_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.8e-109
WP_038720978.1|374062_374407_-|head	head decoration protein	head	NA	NA	NA	NA
WP_009964514.1|374433_375510_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.1	2.4e-50
WP_038720977.1|375506_377000_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.8	4.1e-133
WP_009964508.1|376996_377203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964506.1|377213_379202_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	6.6e-179
WP_009964504.1|379164_379734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405237.1|380235_381009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964499.1|381226_383719_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
WP_009964497.1|383840_384311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975963.1|384684_385143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964493.1|385144_385600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405238.1|385607_385940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|385953_386481_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_076853252.1|386569_386797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|386945_387431_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_123850154.1|387378_387834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|387962_388181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|388232_388568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|388564_389170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964485.1|389166_389616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|389615_390932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405240.1|391045_391375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720986.1|391383_392163_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	6.5e-21
WP_009964477.1|392159_392390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964475.1|392423_393524_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_009964473.1|393981_395196_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	44.0	3.3e-88
WP_135351040.1|395246_396446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085538036.1|397193_400061_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	8.6e-71
399282:399299	attR	GCCGCGCTGTGCCGTCGC	NA	NA	NA	NA
WP_004524588.1|400185_400527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524589.1|400523_400781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524590.1|400773_400950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004535931.1|401317_401797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011850884.1|401796_401967_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009951642.1|402189_402711_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_076831080.1|403118_404036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009969683.1|404028_405030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009969682.1|405756_406332_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	8.7e-23
WP_076852973.1|406804_407830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526371.1|408728_408989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004556796.1|409216_409357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004522504.1|409509_409710_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	591360	602309	4121819	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|591360_593661_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|593657_593972_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|594504_594708_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_045597308.1|594837_596442_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009929279.1|596454_596637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|596609_597869_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|598136_598715_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|598977_599196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530837.1|599387_599897_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|600194_602309_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 3
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	1641780	1673105	4121819	integrase,plate,holin,portal,head,tail,capsid,terminase	Burkholderia_phage(43.75%)	38	1635466:1635483	1675884:1675901
1635466:1635483	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_045597247.1|1641780_1642905_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	77.9	2.6e-164
WP_080340389.1|1642772_1643222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076852957.1|1644229_1646602_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	86.7	0.0e+00
WP_009969785.1|1646603_1647158_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	95.7	2.2e-95
WP_009969786.1|1647150_1648056_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	94.7	2.0e-154
WP_009969788.1|1648052_1648415_-|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.1	6.8e-58
WP_009969789.1|1648411_1649092_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	90.7	9.1e-112
WP_038722474.1|1649265_1650057_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	93.0	2.9e-138
WP_143293236.1|1650464_1651055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038722476.1|1651186_1651654_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	92.9	1.7e-72
WP_009969793.1|1651650_1652067_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	92.0	3.0e-65
WP_009969794.1|1652171_1652612_-	hypothetical protein	NA	K4NXJ2	Burkholderia_phage	89.0	2.9e-63
WP_009969795.1|1652608_1653421_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	92.6	6.5e-141
WP_004524440.1|1653417_1653690_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_009969796.1|1653691_1654036_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	98.2	8.5e-50
WP_009969797.1|1654050_1654257_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	94.1	2.2e-29
WP_009969798.1|1654253_1654505_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	83.1	9.9e-32
WP_045597244.1|1654504_1654984_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	95.6	5.1e-77
WP_009969687.1|1655083_1655773_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	96.1	3.2e-112
WP_009969688.1|1655769_1656783_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	92.6	1.0e-175
WP_009969689.1|1656816_1657626_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	87.7	3.7e-128
WP_009969690.1|1657769_1659539_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	95.1	0.0e+00
WP_009969691.1|1659535_1660591_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.6	3.1e-199
WP_009969692.1|1660634_1660991_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	98.9	6.1e-43
WP_076852953.1|1660993_1661317_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	96.3	4.1e-54
WP_076852952.1|1661899_1662637_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	30.4	9.4e-14
WP_143293235.1|1662637_1663957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143293234.1|1663969_1664404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076852949.1|1664479_1664926_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038722429.1|1665465_1665894_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004525725.1|1666212_1666956_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	9.4e-54
WP_009922658.1|1667335_1667653_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004530410.1|1667652_1668570_+	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009932250.1|1668823_1669366_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|1669623_1670076_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|1670075_1671155_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|1671311_1671560_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_011857935.1|1672403_1673105_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	4.8e-07
1675884:1675901	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	1932784	1947869	4121819	integrase,plate,tail,protease,transposase	Burkholderia_phage(42.86%)	17	1929392:1929408	1938425:1938441
1929392:1929408	attL	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_075018813.1|1932784_1933300_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004555439.1|1933959_1934964_+	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
WP_004555440.1|1935020_1937318_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_100209513.1|1937276_1937792_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_123903074.1|1937716_1938244_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_004527843.1|1938331_1938745_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	8.0e-71
1938425:1938441	attR	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_076852297.1|1938642_1939245_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	89.1	4.3e-81
WP_111952238.1|1939638_1940229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527840.1|1940332_1940698_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	2.5e-52
WP_004521948.1|1940799_1941585_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009967204.1|1941581_1942928_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|1943036_1943651_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_045597230.1|1944025_1944691_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009967200.1|1944727_1945246_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|1945262_1946753_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|1946825_1947329_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011205263.1|1947356_1947869_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	2278773	2288030	4121819		Hokovirus(16.67%)	7	NA	NA
WP_004533561.1|2278773_2280726_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|2280992_2282123_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_028201129.1|2282156_2284175_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004194137.1|2284358_2285174_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|2285238_2285922_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|2285918_2286446_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_028201128.1|2286482_2288030_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 6
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	2624664	2633530	4121819		Bacillus_phage(16.67%)	8	NA	NA
WP_004522358.1|2624664_2626065_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|2626096_2627020_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004537712.1|2627078_2628071_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|2628142_2628460_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|2628818_2629721_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_080340383.1|2629947_2631294_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|2631421_2632345_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_009966840.1|2632687_2633530_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	29.5	9.8e-15
>prophage 7
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	3147492	3151973	4121819		Burkholderia_virus(57.14%)	9	NA	NA
WP_004196630.1|3147492_3147756_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076833215.1|3147739_3147925_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_076804729.1|3147945_3148257_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_071810609.1|3148677_3149280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028200809.1|3149621_3150128_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_028200808.1|3150124_3150547_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
WP_004557051.1|3150827_3151223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|3151476_3151704_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004527234.1|3151739_3151973_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
>prophage 8
NZ_CP018373	Burkholderia pseudomallei strain 2002721184 chromosome 1, complete sequence	4121819	4053479	4059082	4121819	integrase	Burkholderia_virus(33.33%)	9	4045847:4045862	4068419:4068434
4045847:4045862	attL	CCTGCTCGAGCAGCAG	NA	NA	NA	NA
WP_004534827.1|4053479_4053902_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	4.9e-15
WP_004552921.1|4053898_4054408_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_045597343.1|4054400_4054874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204999.1|4054845_4055352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521809.1|4055360_4056074_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.3	1.5e-32
WP_009941993.1|4056094_4056301_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_071810706.1|4056251_4056680_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_038721088.1|4056945_4058313_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_009965540.1|4058476_4059082_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.7	6.1e-19
4068419:4068434	attR	CCTGCTCGAGCAGCAG	NA	NA	NA	NA
>prophage 1
NZ_CP018374	Burkholderia pseudomallei strain 2002721184 chromosome 2, complete sequence	3260317	1304873	1386005	3260317	transposase	Leptospira_phage(14.29%)	52	NA	NA
WP_004529292.1|1304873_1305602_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.7	8.4e-23
WP_009969386.1|1305805_1306246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802333.1|1306805_1307926_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009969387.1|1307956_1308331_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_004525642.1|1310874_1312095_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.8	2.7e-239
WP_009941131.1|1312143_1312473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038722308.1|1312479_1321791_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071811406.1|1321942_1322140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|1322140_1322404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076852886.1|1322995_1327627_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_009969391.1|1327640_1328909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935222.1|1328924_1331129_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.0	1.7e-42
WP_009969392.1|1332585_1333482_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	43.4	3.6e-23
WP_009982075.1|1334588_1335056_+	decarboxylase	NA	NA	NA	NA	NA
WP_009969395.1|1335211_1336237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009969396.1|1336800_1337400_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|1337424_1337835_-	RidA family protein	NA	NA	NA	NA	NA
WP_076853184.1|1337949_1339005_-	asparaginase	NA	NA	NA	NA	NA
WP_004544583.1|1339240_1339873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123850111.1|1341105_1341324_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	62.5	4.0e-05
WP_004524850.1|1341907_1342345_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076831005.1|1343083_1343269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540470.1|1343244_1343391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009969402.1|1343581_1344661_-	porin	NA	NA	NA	NA	NA
WP_011205726.1|1345072_1346512_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_025986264.1|1346712_1347897_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004557911.1|1347907_1348804_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_009969404.1|1348797_1349568_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004544686.1|1349582_1350446_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-13
WP_004524842.1|1350442_1351411_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004524841.1|1351431_1352430_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004524840.1|1352467_1353670_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	6.9e-46
WP_004557914.1|1353680_1354394_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004544619.1|1354525_1355416_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011205728.1|1355857_1356487_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
WP_004524834.1|1358073_1358421_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_004524833.1|1358417_1358825_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	3.2e-11
WP_009969406.1|1359257_1361291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546333.1|1361531_1363703_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|1363707_1364559_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_076853177.1|1364559_1365513_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|1365545_1366787_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|1366822_1368067_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_004553674.1|1368109_1370170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927050.1|1370520_1371579_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552182.1|1373392_1374178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076838784.1|1377520_1378087_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_071811399.1|1378088_1378343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004544694.1|1378346_1378748_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_076851816.1|1383030_1384182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080002868.1|1384192_1384522_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085508576.1|1385486_1386005_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	53.1	4.3e-21
>prophage 2
NZ_CP018374	Burkholderia pseudomallei strain 2002721184 chromosome 2, complete sequence	3260317	1806110	1872247	3260317	plate,transposase,holin	Ralstonia_phage(28.57%)	50	NA	NA
WP_004187738.1|1806110_1808306_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_009939047.1|1808497_1808653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076802259.1|1808791_1809538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023358215.1|1810091_1811261_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	30.1	1.9e-32
WP_080002191.1|1812623_1812878_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_009939053.1|1812874_1813894_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533753.1|1813913_1814366_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004533742.1|1814849_1815770_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076852848.1|1815753_1816608_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004552621.1|1816604_1817636_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004528499.1|1818223_1818529_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_076852851.1|1818858_1821636_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.6	3.1e-89
WP_045597627.1|1821649_1823890_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	6.8e-23
WP_095413486.1|1824028_1825567_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_045597630.1|1825576_1825840_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|1826254_1826674_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|1826693_1827020_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009967412.1|1827491_1828184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076836123.1|1828769_1829393_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_009967414.1|1829473_1831069_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_004533827.1|1831323_1831527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967418.1|1832221_1833679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157129648.1|1834023_1834383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085509746.1|1835231_1837505_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	5.3e-07
WP_076852902.1|1837571_1839059_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_004523708.1|1839094_1839310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004549711.1|1839320_1839875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533867.1|1840459_1841005_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004533804.1|1841069_1841807_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_076852906.1|1842030_1844664_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025986099.1|1844656_1845229_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076847500.1|1845293_1845950_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004523701.1|1845952_1847629_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004523700.1|1848006_1848546_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|1848579_1850079_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|1850278_1850761_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_095413485.1|1850888_1851431_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004523698.1|1851436_1852786_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004556024.1|1852782_1854084_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009981084.1|1854098_1858007_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004529647.1|1858196_1858766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080304704.1|1858830_1861536_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.4e-35
WP_004523693.1|1861610_1861880_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_028200913.1|1861892_1865345_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038721648.1|1865237_1866596_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.4	3.4e-110
WP_004536657.1|1866628_1867657_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009967433.1|1867711_1868782_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004544916.1|1868800_1869850_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|1869846_1871727_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|1871728_1872247_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP018374	Burkholderia pseudomallei strain 2002721184 chromosome 2, complete sequence	3260317	2255047	2261696	3260317	transposase	Burkholderia_virus(50.0%)	10	NA	NA
WP_101536333.1|2255047_2256167_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	9.5e-50
WP_076853050.1|2256289_2256697_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	53.3	9.1e-35
WP_004542548.1|2258736_2259318_+	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_009967718.1|2259563_2259830_+	hypothetical protein	NA	Q8W6Q4	Burkholderia_virus	95.2	3.6e-40
WP_004552390.1|2259814_2260036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557715.1|2260062_2260170_-	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	97.1	8.2e-12
WP_009923452.1|2260171_2260303_-	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_004537565.1|2260312_2260588_-	bacteriophage protein Gp49	NA	Q6JIH4	Burkholderia_virus	95.6	5.2e-42
WP_004547086.1|2261206_2261428_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|2261411_2261696_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
>prophage 4
NZ_CP018374	Burkholderia pseudomallei strain 2002721184 chromosome 2, complete sequence	3260317	2392679	2477722	3260317	transposase,terminase,integrase,plate,tail,holin	Burkholderia_phage(93.33%)	84	2382395:2382414	2446106:2446125
2382395:2382414	attL	CGCGCGCTACGCGGCGCTCG	NA	NA	NA	NA
WP_009967802.1|2392679_2393912_-	hypothetical protein	NA	B5TA65	Burkholderia_phage	88.5	6.1e-215
WP_038721755.1|2394064_2395594_-	DUF935 family protein	NA	B5TA67	Burkholderia_phage	88.0	4.4e-247
WP_009967805.1|2395583_2397200_-|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.6	1.4e-304
WP_009967806.1|2397206_2397704_-	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	95.2	8.4e-83
WP_009927781.1|2397707_2397998_-	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038721757.1|2397994_2398216_-	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	1.9e-31
WP_009967808.1|2398784_2399459_-	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	81.2	2.2e-89
WP_038721770.1|2399455_2399767_-	membrane protein	NA	B5TA74	Burkholderia_phage	70.2	4.4e-37
WP_009967812.1|2399886_2400159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967814.1|2400155_2400638_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_009967816.1|2401001_2401535_-	hypothetical protein	NA	B5TA76	Burkholderia_phage	74.0	1.5e-66
WP_038721759.1|2401578_2402064_-	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	71.3	3.4e-52
WP_009927791.1|2402145_2402337_+	DNA-binding protein	NA	B5TA78	Burkholderia_phage	89.3	2.7e-21
WP_099975987.1|2402723_2403380_+	hypothetical protein	NA	B5TA79	Burkholderia_phage	81.9	1.0e-91
WP_038721760.1|2403419_2405045_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.2	6.6e-302
WP_009967820.1|2405054_2406047_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	97.0	3.9e-180
WP_009967822.1|2406054_2406243_+	hypothetical protein	NA	B5TA82	Burkholderia_phage	63.8	7.7e-13
WP_038721762.1|2406239_2406545_+	hypothetical protein	NA	B5TA83	Burkholderia_phage	73.3	6.4e-33
WP_038721763.1|2406531_2407119_+	hypothetical protein	NA	B5TA84	Burkholderia_phage	92.9	1.4e-84
WP_009967824.1|2407115_2407742_+	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	89.9	9.6e-100
WP_009967825.1|2407755_2408148_+	ASCH domain-containing protein	NA	B5TA86	Burkholderia_phage	83.1	2.3e-59
WP_009967826.1|2408211_2408484_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	85.6	2.6e-33
WP_009967827.1|2408572_2408890_+	hypothetical protein	NA	B5TA88	Burkholderia_phage	76.5	3.7e-07
WP_009967828.1|2408886_2409045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967829.1|2409041_2409353_+	hypothetical protein	NA	B5TA89	Burkholderia_phage	64.6	1.0e-30
WP_009967830.1|2409354_2409789_+	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	81.1	6.3e-58
WP_009967831.1|2409785_2410187_+	hypothetical protein	NA	B5TA91	Burkholderia_phage	89.5	1.7e-62
WP_009967832.1|2410402_2411551_+	hypothetical protein	NA	B5TA92	Burkholderia_phage	82.8	9.1e-181
WP_009967834.1|2411595_2411952_+	hypothetical protein	NA	B5TA94	Burkholderia_phage	77.1	1.1e-41
WP_009967836.1|2412003_2412951_+	hypothetical protein	NA	B5TA95	Burkholderia_phage	94.0	5.6e-168
WP_038721772.1|2413024_2413426_+	hypothetical protein	NA	B5TA96	Burkholderia_phage	75.8	2.5e-16
WP_009967839.1|2413422_2413926_+	DUF1320 domain-containing protein	NA	B5TA97	Burkholderia_phage	91.6	1.5e-87
WP_009967840.1|2413922_2414357_+	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	76.4	1.0e-55
WP_009967842.1|2414356_2414953_+	DUF1834 family protein	NA	B5TA99	Burkholderia_phage	48.2	2.4e-47
WP_009967844.1|2414939_2415206_+	hypothetical protein	NA	B5TAA0	Burkholderia_phage	63.2	3.1e-15
WP_009967845.1|2415252_2416731_+|tail	tail sheath protein	tail	B5TAA1	Burkholderia_phage	76.0	8.9e-221
WP_038721765.1|2416777_2417149_+	hypothetical protein	NA	B5TAA2	Burkholderia_phage	72.4	1.6e-46
WP_009967847.1|2417242_2417791_+	hypothetical protein	NA	B5TAA3	Burkholderia_phage	67.4	2.6e-61
WP_099975988.1|2418169_2420515_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	68.0	5.6e-193
WP_038721767.1|2420514_2421891_+	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	75.3	1.7e-194
WP_009967850.1|2421894_2423061_+	hypothetical protein	NA	B5TAA6	Burkholderia_phage	80.3	8.9e-184
WP_009967851.1|2423057_2423552_+|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	61.4	4.5e-52
WP_038721769.1|2423637_2424225_+|tail	tail protein	tail	B5TAA8	Burkholderia_phage	68.8	5.3e-76
WP_009967855.1|2424221_2425343_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	71.3	4.0e-149
WP_009967856.1|2425342_2425939_+	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	60.7	2.3e-58
WP_009967858.1|2425950_2427237_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.8	3.2e-126
WP_009967859.1|2427250_2427685_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	78.3	6.1e-45
WP_076853328.1|2427824_2428232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004551378.1|2428433_2429849_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004525527.1|2429943_2430885_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_004525528.1|2430893_2431850_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045597678.1|2431986_2435409_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004200656.1|2435596_2438245_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004542546.1|2438235_2439258_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045597680.1|2439445_2440948_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_076851909.1|2441075_2442263_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_004187681.1|2442576_2443650_-	FUSC family protein	NA	NA	NA	NA	NA
WP_004196021.1|2443888_2444854_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_076839602.1|2444995_2445694_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_009969848.1|2445839_2446907_-	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
2446106:2446125	attR	CGAGCGCCGCGTAGCGCGCG	NA	NA	NA	NA
WP_004530031.1|2446921_2448103_-	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004525540.1|2448099_2449788_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_004525541.1|2449784_2450552_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|2450590_2451592_-	HpnL family protein	NA	NA	NA	NA	NA
WP_009969809.1|2451588_2452362_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_009969808.1|2452358_2453054_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_009969807.1|2453418_2454933_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_076853326.1|2454902_2455235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525545.1|2456642_2457581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|2457614_2458163_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|2458159_2459671_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|2459814_2460342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|2460421_2460853_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|2460866_2462729_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|2462725_2463715_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|2463717_2466588_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004536618.1|2466578_2468870_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|2469035_2471324_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|2471327_2473544_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|2473543_2474614_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|2474616_2475333_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|2475375_2475765_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|2475770_2476364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|2476360_2477722_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
