The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018398	Burkholderia pseudomallei strain 2013746777 chromosome 2, complete sequence	3078985	1262426	1309753	3078985	transposase,plate	Streptococcus_phage(14.29%)	25	NA	NA
WP_004539275.1|1262426_1263155_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_085561146.1|1263368_1265123_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071811408.1|1265371_1265737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129112169.1|1265704_1266010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561145.1|1266010_1275379_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_164978234.1|1275528_1276727_-|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.0e-102
WP_004525642.1|1276863_1278084_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.8	2.7e-239
WP_076849157.1|1278178_1278376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|1278376_1278640_-	putative Immunity protein 75	NA	NA	NA	NA	NA
WP_028200696.1|1279232_1283891_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004524859.1|1283877_1285146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085508262.1|1287057_1289262_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	1.3e-45
WP_085561144.1|1289258_1291925_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_028358324.1|1291937_1293383_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009935240.1|1295256_1295805_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190698.1|1295823_1296315_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190849.1|1296374_1297883_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004524810.1|1297875_1298454_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009982092.1|1298516_1299596_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_076851822.1|1299648_1302237_-	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004529325.1|1302235_1302463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122985123.1|1302447_1303404_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004524806.1|1303385_1307015_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004529328.1|1307017_1308334_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190585.1|1308349_1309753_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	264622	270241	4191510	transposase	Burkholderia_virus(57.14%)	9	NA	NA
WP_004196630.1|264622_264886_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076833215.1|264869_265055_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_009920998.1|265075_265801_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_071810609.1|265807_266410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028200809.1|266751_267258_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_028200808.1|267254_267677_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
WP_004557051.1|267957_268353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|268606_268834_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_164978234.1|269042_270241_-|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.0e-102
>prophage 2
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	896017	977066	4191510	transposase,portal,integrase,tail,head,capsid,terminase,plate,tRNA	Burkholderia_virus(18.75%)	89	904216:904233	960061:960078
WP_004199443.1|896017_896419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|896624_896882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|897042_897360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526847.1|897560_898283_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004521679.1|898521_898800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|898948_899206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|899255_899546_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004525642.1|900135_901356_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.8	2.7e-239
WP_004531206.1|901421_902627_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_009930627.1|902977_903469_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_009966380.1|903479_904682_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
904216:904233	attL	CGACCGGCGCGGCGACGG	NA	NA	NA	NA
WP_004535480.1|905383_906568_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	28.4	4.4e-13
WP_009966381.1|907067_909188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526841.1|909309_909714_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526840.1|909772_910177_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	41.1	2.8e-12
WP_004526839.1|910249_912682_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004534778.1|912769_913783_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.3	3.5e-27
WP_004192938.1|913931_914291_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004191477.1|914321_914519_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071810680.1|914711_915236_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.7	4.1e-11
WP_004191232.1|915285_917193_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.7e-123
WP_004205973.1|917651_919889_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004526838.1|919933_920287_-	RidA family protein	NA	NA	NA	NA	NA
WP_011832186.1|920360_921497_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024431237.1|921664_922567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192063.1|922592_923498_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526835.1|923685_924243_+	ester cyclase	NA	NA	NA	NA	NA
WP_045597370.1|924257_925358_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_085560903.1|925401_926124_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004191181.1|926548_927190_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004192091.1|927191_927896_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_004191840.1|928148_928694_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_004554431.1|929265_930798_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_004536448.1|931726_932800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191805.1|933177_933609_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004192152.1|933653_934433_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009966388.1|934613_936287_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_085560902.1|936426_937890_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	5.2e-80
WP_004534774.1|938057_939167_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_009937746.1|939531_941466_-	MFS transporter	NA	NA	NA	NA	NA
WP_085560901.1|941565_942030_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004192500.1|942246_942567_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193660.1|942738_944052_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_085560900.1|944205_945237_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	38.8	3.7e-56
WP_085560899.1|945197_945707_-	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	81.3	3.6e-57
WP_009905952.1|945703_946249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227429.1|946245_946743_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	93.3	1.3e-83
WP_009905959.1|946735_946918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560898.1|947040_947838_+	SGNH/GDSL hydrolase family protein	NA	A0A1P8L663	Pectobacterium_phage	28.2	3.6e-11
WP_085560897.1|947841_948993_+	acyltransferase	NA	C6ZR20	Salmonella_phage	27.9	1.6e-12
WP_145956512.1|948989_949181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560896.1|949189_949894_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	77.4	2.5e-88
WP_085560895.1|950526_951123_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_085560894.1|951129_952293_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	29.7	6.7e-22
WP_085560893.1|952294_952741_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	39.9	2.2e-21
WP_085561053.1|952744_953266_-|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	41.4	5.6e-29
WP_172411960.1|953307_954387_-	hypothetical protein	NA	U5P0H6	Shigella_phage	27.8	3.0e-24
WP_085560891.1|954449_956099_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_085561052.1|956115_957540_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	27.2	5.5e-26
WP_145956513.1|957536_957644_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_085560890.1|957703_958264_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_085560889.1|958267_958642_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_085560888.1|958711_960202_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	U5P0H3	Shigella_phage	43.7	7.6e-103
960061:960078	attR	CCGTCGCCGCGCCGGTCG	NA	NA	NA	NA
WP_085560887.1|960198_960378_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_145956514.1|960387_960993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560885.1|960985_961330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560884.1|961333_961570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560883.1|961578_962625_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	30.1	3.8e-32
WP_085560882.1|962698_963112_-|head	head decoration protein	head	NA	NA	NA	NA
WP_085560881.1|963139_963727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560880.1|963748_964645_-	S49 family peptidase	NA	S4TQW3	Salmonella_phage	44.9	5.6e-45
WP_085560879.1|964666_966322_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	34.7	8.2e-90
WP_085561051.1|966318_966555_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_101609988.1|966596_968492_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.6	3.0e-136
WP_085560878.1|968610_969189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560877.1|969357_970050_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	28.6	4.9e-12
WP_085560876.1|970046_970250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956516.1|970467_970839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560875.1|970848_971223_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_085560873.1|971726_972125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560872.1|972150_972411_-	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	48.8	1.3e-15
WP_085560871.1|972410_972650_-	hypothetical protein	NA	A4JX60	Burkholderia_virus	45.6	8.0e-15
WP_085560870.1|972646_972979_-	hypothetical protein	NA	Q6JIF6	Burkholderia_virus	74.1	1.1e-41
WP_085560869.1|972981_973425_-	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	87.8	1.6e-72
WP_085560868.1|973421_973763_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101609992.1|973775_974297_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	44.6	7.6e-26
WP_085560866.1|974317_974998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560865.1|975002_975857_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	47.6	4.9e-30
WP_085560863.1|976748_977066_-	hypothetical protein	NA	A1YZR1	Burkholderia_virus	65.2	2.1e-34
>prophage 3
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	984073	991460	4191510		Burkholderia_phage(66.67%)	16	NA	NA
WP_085560851.1|984073_985069_+	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	35.4	1.1e-41
WP_085560850.1|985081_985807_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085560849.1|985803_986088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560848.1|986106_986415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560847.1|986428_987049_+	hypothetical protein	NA	A1YZU8	Burkholderia_virus	53.0	1.9e-23
WP_172412004.1|987011_987785_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q6IWS1	Burkholderia_phage	62.9	1.1e-86
WP_172411940.1|987781_988504_+	hypothetical protein	NA	Q3HQW1	Burkholderia_phage	44.6	2.4e-14
WP_085561048.1|988595_989102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560845.1|989094_989577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956522.1|989573_989852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560844.1|989848_990157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956523.1|990168_990429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560843.1|990425_990785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157129623.1|990781_990937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956524.1|990933_991128_+	hypothetical protein	NA	A9YWV0	Burkholderia_phage	84.0	1.1e-19
WP_085560842.1|991124_991460_+	hypothetical protein	NA	A9YWU9	Burkholderia_phage	84.3	2.9e-26
>prophage 4
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	1045253	1113558	4191510	transposase,coat,plate,tRNA	Klosneuvirus(14.29%)	47	NA	NA
WP_085560837.1|1045253_1047878_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004531186.1|1048474_1049695_+	CoA transferase	NA	NA	NA	NA	NA
WP_004196731.1|1050023_1050263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|1050512_1052222_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004531184.1|1052579_1053062_-	NUDIX hydrolase	NA	A0A0G2SS60	Proteus_phage	42.0	4.4e-20
WP_004193860.1|1053080_1053467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024428664.1|1053754_1055854_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_085560836.1|1055955_1056816_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004538370.1|1056859_1058266_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009966435.1|1058499_1060083_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004538373.1|1060280_1061474_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004531180.1|1062097_1063285_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_085560835.1|1063457_1065077_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_129112202.1|1065078_1066779_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192810.1|1067082_1067715_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085560834.1|1067715_1069797_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.3	3.9e-12
WP_004521738.1|1070207_1071173_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_172411962.1|1071188_1073600_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_085560833.1|1073644_1074484_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|1074501_1075026_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|1075102_1075663_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542516.1|1075715_1076261_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004531175.1|1076518_1076740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|1077059_1077953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552892.1|1078396_1079656_+	MFS transporter	NA	NA	NA	NA	NA
WP_009966447.1|1079700_1080684_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|1081151_1081433_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004525642.1|1081673_1082894_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.8	2.7e-239
WP_009966448.1|1082998_1083271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162486887.1|1083588_1084023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009966451.1|1084165_1085479_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_172412005.1|1085738_1086659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004556892.1|1088209_1088503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560830.1|1088939_1091963_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_085560829.1|1091965_1092982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560828.1|1092985_1095820_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.4e-20
WP_004521762.1|1095832_1096138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009954547.1|1096155_1096398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009970724.1|1097956_1101292_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009943538.1|1103804_1104398_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_085561045.1|1105116_1105674_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_004535790.1|1105810_1106644_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038778629.1|1106646_1109454_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.7	3.4e-27
WP_004192367.1|1109487_1109715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1109974_1110241_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004546126.1|1110264_1111680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009966471.1|1111707_1113558_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	1543725	1606332	4191510	transposase,protease,portal,integrase,head,tail,capsid,lysis,terminase,plate	uncultured_Caudovirales_phage(27.03%)	70	1557993:1558009	1589837:1589853
WP_101610003.1|1543725_1544442_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	84.8	1.4e-110
WP_085561038.1|1544521_1544989_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	63.0	6.1e-51
WP_085539471.1|1544985_1545267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560791.1|1545328_1545754_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	47.0	4.9e-15
WP_172411300.1|1545756_1546260_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	2.3e-19
WP_085539468.1|1546601_1547204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172411299.1|1547206_1547908_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	43.7	8.6e-33
WP_085560790.1|1547943_1548732_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	6.1e-152
WP_009964551.1|1548875_1549421_-|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	92.8	7.3e-80
WP_085560789.1|1549420_1549918_-	lysozyme	NA	A4JX20	Burkholderia_virus	80.6	6.9e-69
WP_004533694.1|1549910_1550105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071810763.1|1550180_1551233_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	9.2e-79
WP_025405214.1|1551242_1551449_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	2.6e-14
WP_085560788.1|1551423_1552305_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	8.6e-30
WP_085560787.1|1552313_1554728_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.2	8.0e-62
WP_004533642.1|1554815_1555118_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_009964536.1|1555187_1555691_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
WP_009964534.1|1555701_1556871_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	3.7e-161
WP_009964532.1|1556937_1557390_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_004539647.1|1557405_1558869_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.8	8.0e-214
1557993:1558009	attL	CTTCCGCATCGACCGCT	NA	NA	NA	NA
WP_004539949.1|1558856_1559432_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_009964528.1|1559424_1560318_-|plate	baseplate J/gp47 family protein	plate	A0A1J0I2M3	Salmonella_phage	40.1	8.4e-49
WP_004547840.1|1560314_1560659_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_009964525.1|1560655_1560862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720980.1|1560926_1561607_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.1	9.0e-19
WP_004533675.1|1561609_1562143_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_009964520.1|1562132_1562663_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.0	4.1e-11
WP_009964519.1|1562664_1562955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964517.1|1562958_1563954_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.8e-109
WP_038720978.1|1564019_1564364_-|head	head decoration protein	head	NA	NA	NA	NA
WP_085560786.1|1564390_1565467_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.1	3.1e-50
WP_038720977.1|1565463_1566957_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.8	4.1e-133
WP_009964508.1|1566953_1567160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560785.1|1567170_1569159_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	1.1e-178
WP_009964504.1|1569121_1569691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405236.1|1569784_1569973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405237.1|1570192_1570966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964499.1|1571183_1573676_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
WP_009964497.1|1573797_1574268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071810769.1|1574398_1574578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975963.1|1574641_1575100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964493.1|1575101_1575557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405238.1|1575564_1575897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|1575910_1576438_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_076853252.1|1576526_1576754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|1576902_1577388_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_123850154.1|1577335_1577791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|1577919_1578138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|1578189_1578525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|1578521_1579127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964485.1|1579123_1579573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|1579572_1580889_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025405240.1|1581002_1581332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720986.1|1581340_1582120_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	6.5e-21
WP_009964477.1|1582116_1582347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964475.1|1582380_1583481_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_009982080.1|1584930_1585338_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|1585334_1585682_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|1585711_1587274_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_009982077.1|1587314_1587911_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_004543939.1|1588110_1588308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004556790.1|1588340_1590098_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
1589837:1589853	attR	AGCGGTCGATGCGGAAG	NA	NA	NA	NA
WP_020850843.1|1590122_1590347_-	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_004543927.1|1590365_1590545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123850157.1|1590646_1590937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004538232.1|1595612_1596833_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	4.6e-239
WP_004526357.1|1603144_1603621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|1604077_1604302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009969854.1|1604558_1605695_+	murein-DD-endopeptidase	NA	NA	NA	NA	NA
WP_004522511.1|1605792_1606332_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	1767636	1778592	4191510	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|1767636_1769937_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|1769933_1770248_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|1770780_1770984_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004536101.1|1771114_1772725_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009929279.1|1772737_1772920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|1772892_1774152_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|1774419_1774998_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|1775260_1775479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530837.1|1775670_1776180_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1776477_1778592_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 7
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	2579702	2647260	4191510	protease,transposase,tRNA	Stx2-converting_phage(17.65%)	58	NA	NA
WP_004203414.1|2579702_2580239_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|2580248_2581592_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|2582018_2582561_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|2582580_2583861_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|2583878_2584130_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|2584454_2585354_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|2585350_2586154_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004525865.1|2586120_2586813_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004545672.1|2587161_2588307_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004545692.1|2588303_2588918_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|2588929_2590243_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_172411983.1|2590232_2591258_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004531039.1|2591658_2592603_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531040.1|2592814_2593879_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.1	9.9e-81
WP_004190029.1|2594220_2594991_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|2595022_2595862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523090.1|2595988_2597461_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_009962426.1|2597463_2598954_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|2599066_2599366_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|2599731_2600775_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|2600894_2601968_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|2601964_2602477_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004525858.1|2602586_2604998_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004525857.1|2605009_2606158_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_028201345.1|2606885_2607662_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|2607658_2608444_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|2608865_2609318_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|2609337_2609970_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|2610063_2610798_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|2611265_2611949_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|2611949_2614358_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|2614359_2614950_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_009962382.1|2614946_2616356_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|2616843_2617701_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004525854.1|2617810_2618446_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004525853.1|2618566_2619550_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525852.1|2619581_2620085_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_004553745.1|2620313_2621504_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|2621563_2621935_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004525850.1|2622145_2624755_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|2624978_2626034_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085514494.1|2626471_2627488_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_085560660.1|2627608_2628478_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|2628515_2628920_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_009962369.1|2629546_2630116_+	SocA family protein	NA	NA	NA	NA	NA
WP_129111995.1|2630112_2630571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009979575.1|2630850_2631378_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	61.6	2.7e-55
WP_009982080.1|2631927_2632335_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|2632331_2632679_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|2632708_2634271_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
WP_009982077.1|2634311_2634908_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_009962364.1|2635227_2636442_+	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	67.4	3.9e-142
WP_009962363.1|2636613_2638344_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_009979570.1|2638340_2639798_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	31.6	1.5e-26
WP_024430097.1|2639801_2642264_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_038718170.1|2642473_2645116_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_009962344.1|2645112_2646243_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_101609909.1|2646448_2647260_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	2873199	2884427	4191510	integrase	Burkholderia_virus(22.22%)	10	2870612:2870629	2887206:2887223
2870612:2870629	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_004524472.1|2873199_2875287_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
WP_004202928.1|2875609_2876509_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_038710463.1|2877690_2878278_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.0	1.2e-43
WP_009922658.1|2878657_2878975_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_038737733.1|2878974_2879892_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	2.3e-46
WP_009932250.1|2880145_2880688_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|2880945_2881398_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|2881397_2882477_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_085560647.1|2882633_2882882_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	96.3	1.5e-40
WP_004195754.1|2883782_2884427_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
2887206:2887223	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 9
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	2940589	3013201	4191510	holin,integrase,transposase,capsid	Stx2-converting_phage(23.08%)	59	2977514:2977530	3004170:3004186
WP_004198632.1|2940589_2940943_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|2940960_2941791_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_009967284.1|2941974_2943465_-	6-aminohexanoate-cyclic-dimer hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|2943560_2944253_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004530393.1|2944579_2945680_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_004525689.1|2946135_2947278_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004524391.1|2947468_2948677_-	MFS transporter	NA	NA	NA	NA	NA
WP_004185224.1|2948989_2949670_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_004195767.1|2950054_2950348_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004525685.1|2950587_2951778_+	cation transporter	NA	NA	NA	NA	NA
WP_004195771.1|2951956_2952415_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195773.1|2952505_2953162_-	hypothetical protein	NA	A0A2L0UZL4	Agrobacterium_phage	38.2	1.1e-32
WP_004525684.1|2953158_2953803_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004554632.1|2954403_2955039_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	63.1	1.6e-22
WP_009967280.1|2955133_2956018_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_004535399.1|2956064_2956499_+	YraN family protein	NA	NA	NA	NA	NA
WP_004524382.1|2956621_2957200_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004196853.1|2957218_2958019_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004535805.1|2958015_2958381_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_145956540.1|2959091_2960636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560645.1|2960808_2961078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085561022.1|2961176_2962712_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085560644.1|2962861_2963998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560643.1|2964938_2966111_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085560642.1|2966434_2967769_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_085560641.1|2968209_2969568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956541.1|2969722_2970460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560640.1|2970695_2971352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560639.1|2971423_2973199_-	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	31.7	1.3e-48
WP_085560638.1|2973437_2973806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085560637.1|2973799_2974153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560636.1|2974154_2974454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560635.1|2974563_2975370_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_085560634.1|2975697_2976828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560633.1|2976912_2977308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560632.1|2977304_2978231_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
2977514:2977530	attL	CATCGAGCGCGGCCTGG	NA	NA	NA	NA
WP_085560631.1|2978265_2979258_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	40.6	1.8e-55
WP_085561021.1|2979334_2980303_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.0	1.7e-55
WP_085560630.1|2980405_2980891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085560629.1|2981342_2983262_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	32.7	4.9e-38
WP_085560628.1|2983266_2984562_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_085561441.1|2985695_2986763_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	30.1	2.0e-25
WP_085560627.1|2986743_2987247_+	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_085561020.1|2987352_2989743_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_085560626.1|2989739_2991119_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_157129617.1|2991105_2991276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560625.1|2991272_2994335_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	6.7e-21
WP_085560624.1|2994511_2995642_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_085560623.1|2995638_2998281_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_085560622.1|2998555_2999815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085560621.1|2999825_3001550_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_101610016.1|3001968_3002892_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009982080.1|3002849_3003257_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.0e-14
WP_017335489.1|3003253_3003601_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_085504666.1|3003630_3005193_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.5	5.6e-149
3004170:3004186	attR	CATCGAGCGCGGCCTGG	NA	NA	NA	NA
WP_009982077.1|3005233_3005830_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_085560619.1|3008245_3009640_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_085560618.1|3009636_3011763_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_164978234.1|3012002_3013201_-|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.0e-102
>prophage 10
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	3121947	3175481	4191510	protease,transposase,integrase,plate	uncultured_Mediterranean_phage(28.57%)	53	3148383:3148402	3179972:3179991
WP_004196743.1|3121947_3122661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521923.1|3122952_3127656_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_004527896.1|3127749_3129216_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_004196738.1|3129496_3131008_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004201288.1|3131004_3131565_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_085560614.1|3131773_3133540_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_004521927.1|3134142_3135276_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004199938.1|3135324_3135522_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_004199935.1|3135574_3136390_+	thiazole synthase	NA	NA	NA	NA	NA
WP_085560613.1|3136386_3137487_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004199931.1|3137589_3138408_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.4e-20
WP_004199929.1|3138404_3139172_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004199927.1|3139184_3139745_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_004531853.1|3139792_3140752_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_004199924.1|3140866_3141499_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199923.1|3141495_3141765_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004521934.1|3142060_3142987_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	2.0e-21
WP_004199919.1|3142983_3143739_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009932072.1|3143824_3144064_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009967216.1|3144077_3145427_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004199915.1|3145423_3146080_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004527888.1|3146121_3147459_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004521936.1|3147614_3148685_+	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.9	5.6e-15
3148383:3148402	attL	TTCCTGCTCGAGCGCGTCGA	NA	NA	NA	NA
WP_004199911.1|3148748_3149336_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004199909.1|3149391_3150012_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_004199907.1|3150008_3150650_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004199906.1|3150817_3151573_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004550994.1|3151655_3152429_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004201279.1|3152428_3152842_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004202813.1|3152838_3153207_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_004202812.1|3153259_3153649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185206.1|3153677_3154043_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004199902.1|3154131_3154365_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004521938.1|3154391_3154916_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004199900.1|3154954_3155737_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	8.7e-26
WP_004521939.1|3155979_3157188_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	8.5e-12
WP_071810438.1|3157209_3157956_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|3158176_3158797_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004199894.1|3158797_3160180_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_004521940.1|3160202_3160961_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|3161053_3161665_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004527881.1|3161734_3162256_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_123850113.1|3164675_3165149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080003363.1|3165542_3166400_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	58.9	2.0e-84
WP_004521948.1|3166486_3167272_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|3167268_3168615_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|3168723_3169338_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|3169713_3170385_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|3170421_3170940_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|3170956_3172447_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|3172519_3173023_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|3173080_3173563_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527836.1|3173642_3175481_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
3179972:3179991	attR	TCGACGCGCTCGAGCAGGAA	NA	NA	NA	NA
>prophage 11
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	3502007	3511264	4191510		Hokovirus(16.67%)	7	NA	NA
WP_004533561.1|3502007_3503960_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|3504226_3505357_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_028201129.1|3505390_3507409_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004194137.1|3507592_3508408_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|3508472_3509156_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|3509152_3509680_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_028201128.1|3509716_3511264_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 12
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	3889038	3897861	4191510		Bacillus_phage(16.67%)	8	NA	NA
WP_004537711.1|3889038_3890439_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	4.2e-79
WP_009921652.1|3890470_3891394_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004537712.1|3891452_3892445_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3892516_3892834_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004550116.1|3893159_3894062_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_009980800.1|3894288_3895578_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004522362.1|3895756_3896680_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_004535490.1|3897018_3897861_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.6	1.4e-16
>prophage 13
NZ_CP018399	Burkholderia pseudomallei strain 2013746777 chromosome 1, complete sequence	4191510	4119527	4160671	4191510	holin,terminase,integrase	Burkholderia_virus(94.29%)	45	4153566:4153582	4164784:4164800
WP_085561398.1|4119527_4119743_-	helix-turn-helix domain-containing protein	NA	Q6J1Q0	Burkholderia_virus	83.3	2.3e-21
WP_085561399.1|4119766_4121227_-	DEAD/DEAH box helicase	NA	Q6J1P9	Burkholderia_virus	83.0	1.1e-226
WP_172411995.1|4121223_4121379_-	hypothetical protein	NA	Q6J1P8	Burkholderia_virus	78.0	5.2e-15
WP_172411996.1|4121378_4121522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172411997.1|4122550_4124680_-	DNA polymerase I	NA	Q6J1P5	Burkholderia_virus	93.0	0.0e+00
WP_085561401.1|4124676_4125201_-	HNH endonuclease	NA	A0A0A0RNA9	Bacillus_phage	38.0	9.7e-21
WP_085561402.1|4125254_4125614_-	hypothetical protein	NA	Q6J1P3	Burkholderia_virus	89.8	1.2e-59
WP_085561403.1|4125603_4125954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561404.1|4125950_4126451_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_145956546.1|4126636_4127242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561406.1|4127295_4127904_-	DUF2815 family protein	NA	Q6J1N9	Burkholderia_virus	67.7	1.2e-70
WP_085561407.1|4127931_4129305_-	DUF2800 domain-containing protein	NA	Q6J1N8	Burkholderia_virus	88.4	1.5e-227
WP_085561408.1|4129301_4129496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561409.1|4129498_4130179_-	hypothetical protein	NA	Q6J1N6	Burkholderia_virus	77.8	2.5e-45
WP_172411943.1|4130307_4130454_-	hypothetical protein	NA	A6N3E2	Burkholderia_virus	68.1	8.3e-15
WP_145956547.1|4130481_4130742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561410.1|4130738_4130963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561411.1|4131378_4132047_-	helix-turn-helix domain-containing protein	NA	Q6J1N3	Burkholderia_virus	75.4	1.3e-102
WP_085561412.1|4132129_4132360_+	helix-turn-helix domain-containing protein	NA	Q6J1N2	Burkholderia_virus	88.7	1.9e-29
WP_085561413.1|4132528_4135087_+	PriCT-2 domain-containing protein	NA	Q6J1N1	Burkholderia_virus	91.6	0.0e+00
WP_085561414.1|4135314_4135617_+	hypothetical protein	NA	Q6J1S6	Burkholderia_virus	84.0	1.3e-41
WP_085561415.1|4135613_4136114_+	HNH endonuclease	NA	K7ZJS8	Xanthomonas_citri_phage	52.6	6.4e-14
WP_085561416.1|4136106_4136826_+|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	80.5	4.2e-107
WP_085561417.1|4137097_4138519_+	TerL	NA	Q6J1S4	Burkholderia_virus	98.1	7.6e-286
WP_085561418.1|4138579_4138807_+	hypothetical protein	NA	Q6J1S3	Burkholderia_virus	76.8	2.4e-16
WP_085561419.1|4138882_4140532_+	hypothetical protein	NA	Q6J1S2	Burkholderia_virus	94.2	1.2e-290
WP_085561420.1|4140531_4140828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085561421.1|4140824_4141169_+	hypothetical protein	NA	Q6J1S1	Burkholderia_virus	94.7	1.7e-53
WP_172411998.1|4141182_4141338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085561422.1|4141395_4142133_+	hypothetical protein	NA	Q6J1S0	Burkholderia_virus	83.0	1.7e-79
WP_085561423.1|4142142_4143135_+	hypothetical protein	NA	Q6J1R9	Burkholderia_virus	77.3	1.3e-151
WP_085561424.1|4143198_4143618_+	hypothetical protein	NA	Q6J1R8	Burkholderia_virus	95.0	2.4e-67
WP_085561425.1|4143681_4143906_+	hypothetical protein	NA	Q6J1R7	Burkholderia_virus	49.4	2.3e-08
WP_085561426.1|4143917_4144541_+	hypothetical protein	NA	Q6J1R6	Burkholderia_virus	85.9	2.8e-99
WP_085561427.1|4144549_4146859_+	hypothetical protein	NA	Q6J1R5	Burkholderia_virus	84.0	0.0e+00
WP_085561428.1|4146848_4147274_+	GNAT family acetyltransferase	NA	Q6J1R4	Burkholderia_virus	73.8	2.8e-55
WP_085561430.1|4147893_4150005_+	hypothetical protein	NA	Q6J1R2	Burkholderia_virus	87.1	0.0e+00
WP_085561431.1|4150004_4152263_+	lytic transglycosylase domain-containing protein	NA	Q6J1R1	Burkholderia_virus	83.2	0.0e+00
WP_085561432.1|4152263_4154852_+	hypothetical protein	NA	Q6J1R0	Burkholderia_virus	96.5	0.0e+00
4153566:4153582	attL	CTCGCCGCGCTCGGCGA	NA	NA	NA	NA
WP_145956548.1|4154848_4155286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085561434.1|4157497_4157833_+|holin	holin	holin	Q6J1Q7	Burkholderia_virus	78.2	1.1e-38
WP_085561435.1|4157829_4158111_+|holin	holin	holin	Q6J1Q6	Burkholderia_virus	64.5	8.2e-27
WP_085561436.1|4158097_4158592_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.2	9.0e-77
WP_085561437.1|4158588_4159068_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	63.7	2.8e-43
WP_085561438.1|4159423_4160671_-|integrase	site-specific integrase	integrase	Q6J1Q2	Burkholderia_virus	92.5	2.7e-223
4164784:4164800	attR	TCGCCGAGCGCGGCGAG	NA	NA	NA	NA
