The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	0	8174	5380605		uncultured_Caudovirales_phage(75.0%)	9	NA	NA
WP_002916288.1|984_1542_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004151785.1|1550_1859_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_002916285.1|1997_2924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916283.1|2927_3500_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_002916282.1|3530_3824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002916281.1|4042_4372_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
WP_002916279.1|4423_5716_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916278.1|5725_6148_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916277.1|6620_8174_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 2
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	22648	24328	5380605	integrase	Escherichia_phage(100.0%)	2	16660:16674	26449:26463
16660:16674	attL	TTCAGCGTGGTGCCG	NA	NA	NA	NA
WP_002916189.1|22648_23257_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
WP_004151951.1|23722_24328_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
26449:26463	attR	TTCAGCGTGGTGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	44924	48395	5380605		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_002916003.1|44924_45686_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
WP_002916001.1|45981_47403_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_004149647.1|47399_48395_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
>prophage 4
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	54158	55286	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|54158_55286_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 5
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	61000	62011	5380605		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|61000_62011_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 6
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	67989	79907	5380605		Staphylococcus_phage(25.0%)	10	NA	NA
WP_002915977.1|67989_70149_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
WP_002915976.1|70141_71335_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915975.1|71437_72478_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915974.1|72698_72917_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915973.1|73040_73754_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_004143967.1|73817_74513_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915936.1|75195_75726_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002915935.1|75738_77985_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915934.1|78230_79106_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915933.1|79112_79907_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 7
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	85420	97100	5380605		Hokovirus(25.0%)	6	NA	NA
WP_002915886.1|85420_88306_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
WP_004151968.1|88302_91839_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_004188670.1|91835_93680_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_002915873.1|93737_94058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149616.1|94287_95619_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915870.1|95846_97100_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 8
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	129751	130576	5380605		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|129751_130576_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 9
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	135521	138022	5380605	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_002915577.1|135521_136343_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
WP_004151086.1|136385_136817_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915551.1|136816_138022_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
>prophage 10
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	149566	150322	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|149566_150322_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 11
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	156726	157749	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|156726_157749_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 12
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	168004	168850	5380605		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|168004_168850_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 13
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	176264	181730	5380605		Streptococcus_phage(33.33%)	3	NA	NA
WP_002915222.1|176264_177404_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
WP_004151066.1|177561_180312_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915220.1|180425_181730_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
>prophage 14
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	185272	190609	5380605		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_002915214.1|185272_186910_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
WP_002915213.1|186991_188290_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915212.1|188353_189463_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002915210.1|189937_190609_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
>prophage 15
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	199375	201408	5380605		Hokovirus(50.0%)	2	NA	NA
WP_002915159.1|199375_200803_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
WP_002915158.1|200802_201408_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 16
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	204478	210897	5380605		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_002915109.1|204478_205240_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
WP_002915108.1|205233_205860_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915107.1|205985_207122_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915106.1|207279_208272_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915104.1|208324_208702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151062.1|208698_209901_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151061.1|210009_210897_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
>prophage 17
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	214366	219530	5380605		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_004151059.1|214366_216928_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
WP_002915096.1|217196_217544_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004188736.1|217528_217978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915094.1|217989_218472_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151058.1|218750_219530_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
>prophage 18
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	231274	232096	5380605		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|231274_232096_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 19
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	242461	243862	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|242461_243862_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 20
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	270803	271769	5380605		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|270803_271769_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 21
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	277707	285912	5380605	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_004181011.1|277707_278385_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
WP_004149458.1|278381_279245_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004174698.1|279252_280131_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004181009.1|280270_280768_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.4e-29
WP_002914769.1|280858_281917_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_004181008.1|281984_282485_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914765.1|282735_285363_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|285726_285912_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 22
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	300630	305929	5380605		Bacillus_virus(25.0%)	5	NA	NA
WP_060544676.1|300630_301833_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.2	3.0e-25
WP_002914327.1|302189_303152_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|303162_305304_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|305276_305687_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|305683_305929_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 23
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	311110	312013	5380605		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|311110_312013_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 24
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	334171	335692	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|334171_335692_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 25
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	349852	350335	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002914164.1|349852_350335_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 26
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	365682	366753	5380605		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|365682_366753_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 27
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	373543	376117	5380605		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|373543_376117_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 28
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	382272	383568	5380605		Burkholderia_virus(100.0%)	1	NA	NA
WP_020324862.1|382272_383568_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
>prophage 29
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	388866	393401	5380605	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_002914091.1|388866_389292_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|389495_390581_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|390638_391328_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_004180937.1|391640_392024_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|392069_393401_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 30
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	399170	421237	5380605	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914069.1|399170_400970_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|400985_401960_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|402209_402890_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|402886_403792_+	GTPase Era	NA	NA	NA	NA	NA
WP_020324857.1|403803_404541_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004180923.1|404552_405284_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|405283_405664_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004144350.1|405676_405937_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_004144349.1|405993_406842_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180922.1|407055_407691_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004890375.1|407720_408263_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_004144346.1|408259_409876_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004185139.1|410050_413938_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914044.1|414527_415949_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004180916.1|415957_416665_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004180914.1|416651_417989_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914032.1|418054_418393_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002914028.1|418467_419658_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914027.1|419983_421237_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 31
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	436484	442805	5380605		Faustovirus(20.0%)	8	NA	NA
WP_002913992.1|436484_437699_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
WP_002913991.1|437725_438112_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913979.1|438129_438453_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_004174835.1|438527_439043_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004149343.1|439058_440909_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_002913956.1|440910_441246_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002913954.1|441247_441448_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004180902.1|441518_442805_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	5.8e-35
>prophage 32
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	453317	453749	5380605		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|453317_453749_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 33
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	464069	470694	5380605		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_004174856.1|464069_465461_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|465619_467086_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|467153_468731_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004180884.1|468825_470694_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 34
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	474463	474655	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002913843.1|474463_474655_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 35
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	481066	482742	5380605		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004145656.1|481066_481708_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_004180872.1|481704_482742_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.8e-71
>prophage 36
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	486281	489288	5380605	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_002913824.1|486281_487568_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_071527881.1|487666_488368_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_004180868.1|488364_489288_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 37
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	495933	496647	5380605		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|495933_496647_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 38
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	531550	535127	5380605		Paenibacillus_phage(50.0%)	5	NA	NA
WP_002913639.1|531550_532423_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
WP_002913637.1|532634_533060_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_020325279.1|533046_533496_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913630.1|533557_534133_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004145614.1|534227_535127_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
>prophage 39
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	538480	540605	5380605		Bacillus_virus(50.0%)	2	NA	NA
WP_002913623.1|538480_539575_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
WP_004145610.1|539693_540605_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
>prophage 40
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	544214	554141	5380605		Hokovirus(25.0%)	9	NA	NA
WP_002913506.1|544214_545942_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_002913505.1|545986_546244_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913498.1|546624_547596_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_004174922.1|547772_548534_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_085353186.1|548767_549826_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004180820.1|549895_551911_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
WP_002913440.1|551912_552131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913439.1|552127_553126_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913438.1|553214_554141_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
>prophage 41
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	568631	571078	5380605		Clostridioides_phage(50.0%)	2	NA	NA
WP_002913374.1|568631_569369_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_020324238.1|569380_571078_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	8.8e-47
>prophage 42
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	574348	578932	5380605		Pandoravirus(25.0%)	5	NA	NA
WP_004180790.1|574348_574807_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
WP_004180788.1|574939_575848_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180785.1|575857_576739_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|577107_577590_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_004149224.1|578002_578932_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
>prophage 43
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	588047	589133	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_032441816.1|588047_589133_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
>prophage 44
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	597618	598755	5380605		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|597618_598755_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 45
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	605195	606713	5380605		Mollivirus(100.0%)	1	NA	NA
WP_004180758.1|605195_606713_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	7.7e-87
>prophage 46
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	611006	611780	5380605		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|611006_611780_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 47
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	624182	624782	5380605		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|624182_624782_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 48
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	652811	653753	5380605	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_004180717.1|652811_653753_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 49
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	656868	658074	5380605		Oenococcus_phage(100.0%)	1	NA	NA
WP_004184969.1|656868_658074_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.1e-26
>prophage 50
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	665919	678050	5380605		Pseudomonas_phage(33.33%)	7	NA	NA
WP_020324250.1|665919_666990_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
WP_002913017.1|667453_667708_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004140835.1|667707_668838_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913016.1|668939_671225_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_002913014.1|671569_672298_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_020324481.1|672444_675078_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	4.6e-95
WP_002913009.1|675209_678050_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
>prophage 51
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	682190	685589	5380605		Enterobacteria_phage(50.0%)	3	NA	NA
WP_060544601.1|682190_683294_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.6	9.5e-119
WP_004180700.1|683398_684451_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_002913002.1|684524_685589_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
>prophage 52
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	689509	690670	5380605		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020324457.1|689509_690670_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 53
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	705350	710167	5380605	integrase	Vibrio_phage(100.0%)	4	694689:694709	706812:706832
694689:694709	attL	TTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
WP_020324474.1|705350_706607_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.7	1.3e-103
WP_002912990.1|706966_708727_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
706812:706832	attR	TTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
WP_004195346.1|708745_708973_-	YejL family protein	NA	NA	NA	NA	NA
WP_020324366.1|709159_710167_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	1.2e-83
>prophage 54
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	714401	720488	5380605		Vibrio_phage(33.33%)	5	NA	NA
WP_004144263.1|714401_716159_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
WP_002912977.1|716306_717026_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002912975.1|717022_718219_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912974.1|718550_718895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151118.1|718898_720488_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 55
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	726243	730554	5380605		Clostridioides_phage(50.0%)	4	NA	NA
WP_002912967.1|726243_726813_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
WP_004180648.1|727238_727946_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004144255.1|727989_728967_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004200498.1|729087_730554_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
>prophage 56
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	738386	739241	5380605		Catovirus(100.0%)	1	NA	NA
WP_020806192.1|738386_739241_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	3.4e-23
>prophage 57
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	743641	747548	5380605		Acinetobacter_phage(50.0%)	3	NA	NA
WP_020324292.1|743641_745615_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
WP_004151123.1|745685_746519_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002912924.1|746879_747548_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 58
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	751312	752833	5380605		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|751312_752833_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 59
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	764472	765207	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_004175087.1|764472_765207_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	1.5e-48
>prophage 60
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	769481	770036	5380605		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032441815.1|769481_770036_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	3.0e-20
>prophage 61
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	776570	783627	5380605	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_020324379.1|776570_777518_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.4e-24
WP_020324374.1|777501_778239_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912762.1|778213_778327_-	protein YohO	NA	NA	NA	NA	NA
WP_020324322.1|778556_780245_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	4.2e-259
WP_004144215.1|780238_780958_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912756.1|781005_781476_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_004195370.1|781593_783627_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 62
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	805810	810827	5380605	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_002912636.1|805810_806704_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_020324324.1|806949_808311_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.0e-206
WP_020324287.1|808629_809352_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_019705218.1|809348_810827_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 63
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	827946	834710	5380605		Catovirus(25.0%)	5	NA	NA
WP_002912442.1|827946_828588_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|828678_829260_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_032408614.1|829290_831138_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151147.1|831472_833056_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_001741945.1|833819_834710_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
>prophage 64
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	852968	869800	5380605		Ostreococcus_lucimarinus_virus(12.5%)	13	NA	NA
WP_032408624.1|852968_854375_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
WP_004180506.1|854599_856015_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_020324344.1|856037_857408_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.4e-31
WP_009484573.1|857571_858738_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_009484572.1|859162_859285_-	small membrane protein	NA	NA	NA	NA	NA
WP_004184806.1|859685_860690_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_002912373.1|861736_862504_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004175264.1|862503_863244_+	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.0e-07
WP_019724801.1|863259_865155_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_023304918.1|865170_866325_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
WP_004890862.1|866321_867215_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004175268.1|867227_868361_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004214010.1|868483_869800_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.5	7.1e-12
>prophage 65
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	876047	876947	5380605		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|876047_876947_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 66
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	881453	886541	5380605		Streptococcus_phage(50.0%)	3	NA	NA
WP_002912106.1|881453_883556_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
WP_020324327.1|883772_885197_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017879895.1|885371_886541_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.5	2.2e-182
>prophage 67
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	902061	902898	5380605		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|902061_902898_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 68
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	918744	919689	5380605		Caulobacter_phage(100.0%)	1	NA	NA
WP_023303961.1|918744_919689_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.1	5.4e-54
>prophage 69
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	936422	936608	5380605		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|936422_936608_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 70
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	944175	968831	5380605	integrase	Bacillus_phage(40.0%)	8	961920:961933	979213:979226
WP_000369501.1|944175_953667_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_038434404.1|953754_959862_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.4e-33
WP_000140406.1|960052_961012_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098391.1|961178_962981_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
961920:961933	attL	GGTTTTTCAGCGCG	NA	NA	NA	NA
WP_001593429.1|962967_964770_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_001286279.1|964762_966043_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703034.1|966070_967375_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000059622.1|967568_968831_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.1e-73
979213:979226	attR	CGCGCTGAAAAACC	NA	NA	NA	NA
>prophage 71
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	976947	978330	5380605	tRNA	Catovirus(100.0%)	1	NA	NA
WP_004175365.1|976947_978330_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.4	2.5e-44
>prophage 72
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	985718	989669	5380605	tRNA	Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000075719.1|985718_986540_-	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.9	1.2e-06
WP_000939730.1|986543_987458_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052115710.1|987710_989669_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.5	2.4e-120
>prophage 73
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	998619	1003050	5380605	integrase	Indivirus(50.0%)	3	991625:991637	1004161:1004173
991625:991637	attL	AGATCGTGGCTAT	NA	NA	NA	NA
WP_000544020.1|998619_999357_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.0	5.7e-11
WP_004175379.1|999635_1001609_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_000059621.1|1001793_1003050_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	3.3e-75
1004161:1004173	attR	ATAGCCACGATCT	NA	NA	NA	NA
>prophage 74
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1020638	1029081	5380605		Burkholderia_phage(40.0%)	8	NA	NA
WP_002911596.1|1020638_1021784_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|1022322_1022604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|1022646_1023354_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_022631353.1|1023397_1024831_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.1e-101
WP_002911592.1|1024811_1025306_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_004180449.1|1025280_1026192_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|1026375_1027287_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004180448.1|1027401_1029081_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 75
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1035682	1036435	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|1035682_1036435_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 76
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1053043	1054558	5380605		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|1053043_1054558_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 77
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1061495	1078042	5380605	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_004151452.1|1061495_1063229_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|1063464_1064034_+	VOC family protein	NA	NA	NA	NA	NA
WP_009307530.1|1064110_1064854_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_020956673.1|1064935_1065940_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|1065936_1066680_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|1066719_1067115_-	membrane protein	NA	NA	NA	NA	NA
WP_002911483.1|1067167_1067986_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|1067982_1068549_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|1068816_1070604_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_060544605.1|1070605_1071049_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911459.1|1071076_1071817_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911456.1|1071851_1072373_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911454.1|1072452_1073064_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004148860.1|1073072_1074083_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_004212745.1|1074146_1074932_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002911449.1|1074931_1075684_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_004180437.1|1075762_1076707_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911444.1|1076722_1078042_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
>prophage 78
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1081967	1083443	5380605		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|1081967_1083443_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 79
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1090867	1094782	5380605	lysis,integrase	Salmonella_phage(50.0%)	7	1093787:1093814	1098687:1098714
WP_002911407.1|1090867_1091527_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
WP_002911406.1|1091605_1091836_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_004151448.1|1091948_1092323_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_020956678.1|1092326_1093196_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_015874944.1|1093209_1093551_+	YebY family protein	NA	NA	NA	NA	NA
1093787:1093814	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_077253379.1|1093944_1094304_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	56.5	7.8e-14
WP_032419797.1|1094302_1094782_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	46.5	5.2e-29
1098687:1098714	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 80
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1100459	1101113	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_009484457.1|1100459_1101113_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.0e-56
>prophage 81
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1108620	1110669	5380605		Moraxella_phage(100.0%)	1	NA	NA
WP_032419784.1|1108620_1110669_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	6.8e-86
>prophage 82
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1115906	1116116	5380605		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1115906_1116116_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 83
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1123556	1125116	5380605		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|1123556_1125116_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 84
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1129024	1136393	5380605	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_020956685.1|1129024_1130380_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
WP_004145519.1|1130468_1130654_+	YoaH family protein	NA	NA	NA	NA	NA
WP_002910910.1|1130654_1130999_-	RidA family protein	NA	NA	NA	NA	NA
WP_020956686.1|1131130_1133041_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_004151443.1|1133186_1133882_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002910905.1|1133920_1134502_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002910904.1|1134707_1136393_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 85
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1152017	1152629	5380605		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|1152017_1152629_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 86
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1172013	1174308	5380605		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004200320.1|1172013_1174308_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	3.0e-159
>prophage 87
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1178170	1188914	5380605		Staphylococcus_phage(40.0%)	11	NA	NA
WP_004200318.1|1178170_1179046_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|1179042_1179762_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|1179767_1180661_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|1180944_1182588_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_004200317.1|1182637_1183114_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1183212_1184139_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|1184442_1185738_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_004175495.1|1185752_1186559_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|1186533_1187433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1187542_1188025_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004200316.1|1188215_1188914_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
>prophage 88
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1204766	1208872	5380605		Microcystis_phage(75.0%)	4	NA	NA
WP_004200301.1|1204766_1205660_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	8.8e-14
WP_004200300.1|1205843_1206737_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.4	2.8e-12
WP_004184615.1|1206912_1207806_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004189389.1|1207981_1208872_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
>prophage 89
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1225408	1228160	5380605		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004200291.1|1225408_1227088_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910407.1|1227212_1228160_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 90
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1231372	1237086	5380605		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002910403.1|1231372_1232455_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_004180387.1|1232454_1233303_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004145428.1|1233302_1233695_+	SirB family protein	NA	NA	NA	NA	NA
WP_002910395.1|1233698_1234511_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910393.1|1234550_1235405_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910392.1|1235491_1236592_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910389.1|1236855_1237086_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
>prophage 91
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1242598	1243387	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004200289.1|1242598_1243387_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 92
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1259880	1261416	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|1259880_1261416_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 93
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1265429	1271699	5380605		Synechococcus_phage(25.0%)	7	NA	NA
WP_004151854.1|1265429_1266272_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_002910109.1|1266314_1266773_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002910108.1|1266885_1267788_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_004175574.1|1267877_1268891_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910105.1|1269088_1269991_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910103.1|1270112_1270520_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910100.1|1271081_1271699_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 94
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1279958	1282856	5380605		Planktothrix_phage(33.33%)	3	NA	NA
WP_004200274.1|1279958_1280972_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
WP_002910083.1|1280968_1281973_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_002910080.1|1282028_1282856_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 95
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1292531	1299700	5380605	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002910026.1|1292531_1294460_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
WP_004189469.1|1294463_1295006_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|1295098_1295296_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1295346_1295703_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1295826_1295871_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_002909105.1|1296009_1296993_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_002909101.1|1297008_1299396_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909098.1|1299400_1299700_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 96
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1306768	1314735	5380605		Brazilian_cedratvirus(25.0%)	7	NA	NA
WP_004200263.1|1306768_1307518_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	8.4e-10
WP_002909082.1|1307597_1308062_+	lipoprotein	NA	NA	NA	NA	NA
WP_004184566.1|1308175_1309618_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	2.0e-55
WP_002909070.1|1309647_1309875_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_002909064.1|1309982_1311029_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909061.1|1311183_1312017_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909055.1|1312356_1314735_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 97
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1324714	1325476	5380605		Indivirus(100.0%)	1	NA	NA
WP_004200259.1|1324714_1325476_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.8e-15
>prophage 98
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1341967	1343188	5380605		environmental_halophage(100.0%)	1	NA	NA
WP_002908867.1|1341967_1343188_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 99
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1353108	1353858	5380605		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004200241.1|1353108_1353858_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	2.8e-05
>prophage 100
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1361295	1363259	5380605		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004200234.1|1361295_1362246_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
WP_004200233.1|1362242_1363259_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.3e-41
>prophage 101
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1373909	1378310	5380605		Bacillus_virus(50.0%)	3	NA	NA
WP_002908439.1|1373909_1374683_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
WP_004200219.1|1374910_1376983_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004200218.1|1377488_1378310_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	6.6e-16
>prophage 102
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1397835	1398906	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004200198.1|1397835_1398906_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 103
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1403763	1404387	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004200196.1|1403763_1404387_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	4.0e-05
>prophage 104
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1417176	1422821	5380605		Bacillus_phage(50.0%)	3	NA	NA
WP_004151175.1|1417176_1417881_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
WP_017896248.1|1418782_1419667_+	membrane protein	NA	NA	NA	NA	NA
WP_004200176.1|1419704_1422821_+	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.4	1.2e-54
>prophage 105
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1440152	1440983	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004180245.1|1440152_1440983_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 106
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1458292	1460241	5380605		Klosneuvirus(50.0%)	2	NA	NA
WP_004200153.1|1458292_1459264_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	2.4e-09
WP_004200151.1|1459260_1460241_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	9.0e-12
>prophage 107
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1465425	1466196	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|1465425_1466196_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 108
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1471670	1482712	5380605		Burkholderia_virus(20.0%)	11	NA	NA
WP_004180176.1|1471670_1472555_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
WP_065928302.1|1473079_1473541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072769241.1|1473537_1473765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200138.1|1474444_1475023_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_004200137.1|1475162_1475570_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004200136.1|1475745_1477119_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_004200129.1|1477348_1477984_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
WP_002907788.1|1478020_1479169_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907785.1|1479461_1480643_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907780.1|1480755_1481760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907778.1|1481686_1482712_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 109
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1485983	1486856	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|1485983_1486856_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 110
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1491043	1492531	5380605		Indivirus(50.0%)	2	NA	NA
WP_004200125.1|1491043_1491940_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
WP_004184268.1|1492009_1492531_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
>prophage 111
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1496337	1497699	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004200121.1|1496337_1497699_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 112
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1501035	1502310	5380605	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|1501035_1502310_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 113
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1513565	1514936	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|1513565_1514936_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 114
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1520487	1522539	5380605		Escherichia_phage(50.0%)	3	NA	NA
WP_002907640.1|1520487_1521015_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
WP_002907563.1|1521120_1521396_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_004189749.1|1521420_1522539_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	1.8e-32
>prophage 115
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1529364	1532005	5380605		Moumouvirus(100.0%)	2	NA	NA
WP_004200105.1|1529364_1530870_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.5	2.5e-29
WP_004200104.1|1530916_1532005_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	9.1e-05
>prophage 116
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1542437	1544399	5380605		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|1542437_1544399_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 117
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1551307	1552321	5380605		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004200094.1|1551307_1552321_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 118
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1568009	1570100	5380605		Salmonella_phage(100.0%)	1	NA	NA
WP_085706575.1|1568009_1570100_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 119
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1574680	1575232	5380605		Leuconostoc_phage(100.0%)	1	NA	NA
WP_004200078.1|1574680_1575232_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 120
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1581170	1581950	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004200076.1|1581170_1581950_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 121
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1591389	1592091	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004200066.1|1591389_1592091_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	9.6e-32
>prophage 122
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1597733	1599278	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_004200061.1|1597733_1599278_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 123
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1605385	1606885	5380605		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|1605385_1606885_+	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 124
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1614141	1614915	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004143751.1|1614141_1614915_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 125
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1626186	1627803	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_004200039.1|1626186_1627803_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	2.5e-19
>prophage 126
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1631391	1636134	5380605		Tupanvirus(66.67%)	4	NA	NA
WP_002906221.1|1631391_1632402_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
WP_002906218.1|1632654_1633254_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_019725529.1|1633428_1634382_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004200033.1|1634418_1636134_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	4.7e-32
>prophage 127
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1642622	1644959	5380605		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_085706576.1|1642622_1643495_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	3.9e-83
WP_004143718.1|1644192_1644378_+	general stress protein	NA	NA	NA	NA	NA
WP_004143717.1|1644743_1644959_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 128
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1649766	1650171	5380605		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|1649766_1650171_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 129
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1660198	1662811	5380605		Rathayibacter_phage(100.0%)	1	NA	NA
WP_014343099.1|1660198_1662811_+	family 78 glycoside hydrolase catalytic domain	NA	A0A1P8VV88	Rathayibacter_phage	21.5	2.4e-11
>prophage 130
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1668974	1669655	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|1668974_1669655_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 131
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1686177	1688258	5380605		Bacillus_phage(100.0%)	2	NA	NA
WP_004199992.1|1686177_1686918_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	8.5e-31
WP_014343090.1|1686914_1688258_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.8e-10
>prophage 132
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1692238	1696356	5380605		Klosneuvirus(50.0%)	4	NA	NA
WP_004199985.1|1692238_1693624_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
WP_004199983.1|1693930_1694866_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004143673.1|1694890_1695631_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004180001.1|1695627_1696356_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	3.7e-18
>prophage 133
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1702302	1703559	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_014343088.1|1702302_1703559_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.5e-19
>prophage 134
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1731313	1732051	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_004143660.1|1731313_1732051_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
>prophage 135
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1747629	1748682	5380605		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|1747629_1748682_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 136
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1763355	1764138	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002904975.1|1763355_1764138_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 137
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1772314	1773577	5380605	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_000608644.1|1772314_1773577_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 138
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1780102	1780621	5380605		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004199889.1|1780102_1780621_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	38.2	3.4e-26
>prophage 139
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1792911	1793685	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|1792911_1793685_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 140
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1800965	1802522	5380605		Catovirus(100.0%)	1	NA	NA
WP_004199868.1|1800965_1802522_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 141
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1809884	1811060	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_004199865.1|1809884_1811060_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 142
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1836839	1838219	5380605		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004199850.1|1836839_1838219_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	9.1e-18
>prophage 143
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1848712	1849504	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004176216.1|1848712_1849504_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 144
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1862538	1863912	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_085666577.1|1862538_1863912_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 145
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1869359	1870121	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|1869359_1870121_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 146
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1882069	1882444	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|1882069_1882444_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 147
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1885690	1887196	5380605		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004151618.1|1885690_1886389_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
WP_002904321.1|1886398_1887196_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 148
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1891347	1907242	5380605		Escherichia_phage(70.0%)	15	NA	NA
WP_002904248.1|1891347_1892451_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
WP_002904247.1|1892599_1892998_-	rhodanese	NA	NA	NA	NA	NA
WP_004198831.1|1893065_1894163_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004205985.1|1894131_1894347_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_002904139.1|1894399_1894840_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004151614.1|1895094_1896159_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_004151613.1|1896355_1899463_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|1899517_1900783_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1900813_1901902_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|1901988_1902249_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|1902546_1903407_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1903427_1904189_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|1904449_1905352_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|1905363_1906629_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|1906621_1907242_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 149
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1917162	1917837	5380605		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|1917162_1917837_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 150
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1922975	1934034	5380605		Escherichia_phage(57.14%)	12	NA	NA
WP_002903728.1|1922975_1923407_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_002903726.1|1923671_1925135_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903724.1|1925388_1926672_-	MFS transporter	NA	NA	NA	NA	NA
WP_002903722.1|1926785_1927112_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_002903720.1|1927256_1927598_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_002903719.1|1927675_1928236_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004219441.1|1928229_1928940_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_002903714.1|1929041_1929311_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_004199830.1|1929461_1931897_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	4.1e-215
WP_004152235.1|1931907_1932525_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002903710.1|1932526_1933384_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152236.1|1933425_1934034_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
>prophage 151
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1951158	1952118	5380605		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|1951158_1952118_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 152
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1961561	1964339	5380605		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|1961561_1964339_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 153
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1983684	1984200	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|1983684_1984200_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 154
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	1995443	1996745	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|1995443_1996745_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 155
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2009565	2013093	5380605		Salmonella_phage(50.0%)	6	NA	NA
WP_004151566.1|2009565_2009769_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
WP_002903238.1|2009838_2010357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903236.1|2010554_2010908_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002903234.1|2011011_2012220_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903233.1|2012216_2012450_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903231.1|2012700_2013093_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
>prophage 156
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2025267	2026473	5380605		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|2025267_2026473_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 157
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2035159	2039797	5380605		Bacillus_phage(50.0%)	2	NA	NA
WP_004151576.1|2035159_2035834_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
WP_004198150.1|2035894_2039797_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
>prophage 158
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2065977	2066967	5380605		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|2065977_2066967_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 159
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2072085	2079232	5380605	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902433.1|2072085_2073240_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
WP_002902432.1|2073383_2073596_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902424.1|2073686_2074112_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902422.1|2074345_2075281_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|2075326_2076700_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|2077225_2078209_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_002902419.1|2078488_2079232_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
>prophage 160
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2086839	2087853	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|2086839_2087853_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 161
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2116779	2121805	5380605		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002902166.1|2116779_2119158_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
WP_002902163.1|2119150_2121805_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
>prophage 162
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2129231	2129480	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002902136.1|2129231_2129480_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
>prophage 163
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2134315	2175708	5380605	integrase,terminase	uncultured_Caudovirales_phage(33.33%)	61	2163893:2163907	2169902:2169916
WP_004152576.1|2134315_2135182_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2135181_2135955_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2135951_2137148_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2137147_2137501_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2137502_2138156_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2138209_2138776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2138818_2139001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032441788.1|2139050_2139398_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	4.7e-24
WP_004152569.1|2139390_2140413_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|2140415_2140718_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|2140718_2141318_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2141317_2143321_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2143310_2143463_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2143498_2143924_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|2143927_2144368_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|2144378_2145524_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2145527_2145968_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2146062_2146449_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2146448_2146955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2146951_2147371_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2147339_2147621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2147660_2148602_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2148613_2149108_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2149111_2150314_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2150365_2150914_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2150969_2152421_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2152658_2154059_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|2154009_2154762_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|2154863_2155184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2155418_2155808_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2155804_2156335_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2156337_2156586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|2156991_2157774_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2157770_2158247_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|2158243_2159206_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2159207_2160866_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2161442_2161664_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2161761_2162430_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2162600_2162915_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2162907_2163096_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2163265_2163631_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|2163623_2163878_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|2163849_2164068_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
2163893:2163907	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|2164064_2164490_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|2164486_2164681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|2164677_2165505_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|2165609_2166128_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|2166133_2166844_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|2166833_2167058_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|2167054_2167267_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|2167263_2167743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|2167921_2168164_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2168144_2169326_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|2169522_2170071_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
2169902:2169916	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|2170269_2171802_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|2172018_2172780_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|2172888_2173803_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|2174103_2174292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|2174362_2174671_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004218009.1|2174676_2174814_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
WP_004152141.1|2174838_2175708_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
>prophage 164
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2205713	2218910	5380605	transposase,integrase	Salmonella_phage(18.18%)	12	2205495:2205510	2216216:2216231
2205495:2205510	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|2205713_2206385_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|2206571_2207399_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|2207474_2208740_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|2208741_2209161_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|2209240_2210725_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|2211251_2211956_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|2212548_2212971_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|2213465_2214170_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153574.1|2214852_2216040_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|2216216_2217107_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
2216216:2216231	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|2217106_2218099_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|2218100_2218910_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 165
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2223541	2225476	5380605		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|2223541_2225476_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 166
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2231066	2231669	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|2231066_2231669_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 167
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2236509	2241875	5380605	protease	Tupanvirus(50.0%)	5	NA	NA
WP_002901763.1|2236509_2239107_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|2239513_2239765_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|2239812_2240859_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004148112.1|2240903_2241119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901754.1|2241113_2241875_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
>prophage 168
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2248994	2251952	5380605		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004148109.1|2248994_2250590_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
WP_002901733.1|2250593_2251952_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 169
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2264196	2264874	5380605		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|2264196_2264874_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 170
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2272168	2277902	5380605		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_002901621.1|2272168_2272930_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
WP_002901611.1|2273021_2273612_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004151918.1|2273747_2275139_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_004140343.1|2275198_2275531_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_002901554.1|2275643_2277902_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 171
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2284166	2284994	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|2284166_2284994_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 172
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2291667	2292888	5380605		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|2291667_2292888_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 173
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2298945	2299578	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|2298945_2299578_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 174
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2304880	2310894	5380605	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_002901390.1|2304880_2306827_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
WP_002901388.1|2306831_2307875_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901387.1|2308100_2308847_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_085955203.1|2309530_2310894_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 175
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2314768	2318827	5380605		Tupanvirus(50.0%)	4	NA	NA
WP_002901282.1|2314768_2315410_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
WP_002901278.1|2315447_2316806_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901274.1|2316947_2317706_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901272.1|2317843_2318827_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
>prophage 176
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2324519	2325773	5380605		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|2324519_2325773_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 177
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2329457	2330312	5380605		Indivirus(100.0%)	1	NA	NA
WP_002901238.1|2329457_2330312_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
>prophage 178
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2333586	2345020	5380605		Bacillus_phage(14.29%)	12	NA	NA
WP_004152363.1|2333586_2334870_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901231.1|2334915_2335479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|2335637_2336120_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901229.1|2336241_2336553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152362.1|2336810_2337692_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152361.1|2337867_2339085_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901225.1|2339081_2339831_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004140447.1|2339997_2340903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152360.1|2340909_2342175_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_002901192.1|2342177_2342597_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152765.1|2342675_2344160_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901096.1|2344777_2345020_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 179
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2351949	2355535	5380605		Bacillus_phage(50.0%)	7	NA	NA
WP_004150781.1|2351949_2352963_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|2353020_2353122_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|2353121_2353196_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|2353313_2353439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|2353498_2353762_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|2353892_2354531_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|2354620_2355535_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 180
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2358824	2360609	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004150787.1|2358824_2360609_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 181
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2375219	2376470	5380605		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|2375219_2376470_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 182
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2379698	2381069	5380605		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004150804.1|2379698_2381069_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 183
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2387634	2388771	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|2387634_2388771_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 184
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2393203	2399269	5380605		Staphylococcus_phage(33.33%)	6	NA	NA
WP_004150815.1|2393203_2394832_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
WP_002900906.1|2395083_2395428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176563.1|2395518_2396349_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_004150816.1|2396363_2397275_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002900801.1|2397323_2398568_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002900798.1|2398567_2399269_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 185
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2418993	2419635	5380605		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|2418993_2419635_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 186
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2422914	2424096	5380605		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2422914_2423151_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_002899294.1|2423361_2424096_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 187
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2443251	2443503	5380605		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|2443251_2443503_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 188
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2446744	2447665	5380605		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|2446744_2447665_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 189
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2456016	2456544	5380605		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|2456016_2456544_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 190
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2464645	2465704	5380605		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|2464645_2465704_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 191
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2482268	2485787	5380605		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898812.1|2482268_2482763_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
WP_002898810.1|2482784_2484107_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_004199515.1|2484513_2485452_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002898708.1|2485613_2485787_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 192
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2509925	2510585	5380605	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|2509925_2510585_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 193
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2515527	2517582	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|2515527_2517582_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 194
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2530274	2532182	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|2530274_2532182_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 195
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2540948	2546071	5380605		Bacillus_virus(33.33%)	3	NA	NA
WP_004150838.1|2540948_2541722_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
WP_002898220.1|2541926_2544542_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_002898217.1|2544868_2546071_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 196
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2552133	2553534	5380605	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
WP_002898206.1|2552133_2553534_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 197
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2572567	2577110	5380605		Bacillus_phage(100.0%)	3	NA	NA
WP_002898170.1|2572567_2574316_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
WP_002898168.1|2574352_2576617_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002898165.1|2576822_2577110_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 198
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2581283	2582372	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|2581283_2582372_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 199
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2586422	2688305	5380605	tRNA,portal,plate,terminase,integrase,capsid,tail,lysis,protease,head	Salmonella_phage(53.23%)	100	2650880:2650898	2688380:2688398
WP_002898148.1|2586422_2588705_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
WP_002898145.1|2588896_2589637_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_004150843.1|2589799_2590948_-	MFS transporter	NA	NA	NA	NA	NA
WP_004147798.1|2591064_2591211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150844.1|2591222_2592086_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004150845.1|2592087_2592705_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002898141.1|2592715_2595154_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_002898139.1|2595354_2596647_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|2596737_2598081_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2598089_2598701_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|2598823_2603077_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|2603212_2603707_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|2604212_2605208_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|2605322_2607089_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|2607089_2608811_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2608855_2609557_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2609910_2610129_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2610249_2612529_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2612559_2612877_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2613202_2613424_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2613500_2615441_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2615437_2616553_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|2616699_2618358_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|2618777_2619473_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|2619588_2620488_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|2620631_2622284_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|2622294_2623263_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|2623474_2623909_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|2624060_2625779_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|2625817_2626819_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|2626829_2628272_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|2628359_2629373_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|2629369_2630200_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|2630231_2631371_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|2632248_2632764_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|2632990_2633719_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|2633739_2634471_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|2634477_2635194_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|2635193_2635862_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|2636045_2636777_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|2636819_2638292_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|2638288_2639005_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|2639083_2640211_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|2640252_2640741_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2640798_2641644_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2641640_2642594_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|2642604_2643738_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|2643901_2645014_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2645362_2645842_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2645930_2646833_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|2647654_2647942_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2648144_2648408_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|2648414_2648798_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|2649064_2650750_+	transporter	NA	NA	NA	NA	NA
2650880:2650898	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|2650969_2651188_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|2651279_2652380_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|2652376_2652862_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|2652858_2655486_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|2655478_2655598_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|2655612_2655912_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|2655964_2656480_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|2656489_2657662_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|2657800_2658877_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|2658906_2659110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|2659106_2659838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|2659841_2662793_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|2662794_2663394_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|2663386_2664295_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|2664281_2664644_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|2664640_2665213_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|2665307_2666000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|2665996_2666443_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|2666435_2666867_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|2666962_2667391_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|2667387_2667771_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|2667775_2668285_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|2668265_2668481_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|2668484_2668688_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|2668687_2669152_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|2669247_2669898_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_060544654.1|2669901_2670960_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	5.4e-180
WP_002895967.1|2670976_2671810_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|2671952_2673719_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|2673718_2674744_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|2674805_2676548_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|2676823_2677501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2677615_2677849_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2677859_2678048_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|2678201_2680616_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|2680612_2681470_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|2681466_2681694_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|2681693_2681927_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|2681994_2682336_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|2682299_2682500_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|2682507_2683017_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|2683049_2683271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2683416_2684295_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|2684306_2685251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|2685349_2686834_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|2687252_2688305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
2688380:2688398	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 200
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2693380	2695380	5380605		Escherichia_phage(50.0%)	2	NA	NA
WP_004151717.1|2693380_2694139_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004151716.1|2694177_2695380_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
>prophage 201
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2707085	2708945	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|2707085_2708945_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 202
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2713188	2715621	5380605		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|2713188_2715621_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 203
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2723600	2725193	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|2723600_2725193_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 204
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2728202	2729579	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|2728202_2729579_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 205
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2733580	2738732	5380605		Escherichia_phage(33.33%)	6	NA	NA
WP_002895845.1|2733580_2734093_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
WP_002895842.1|2734444_2735332_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895841.1|2735569_2736073_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895839.1|2736481_2737228_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895837.1|2737353_2738013_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004142040.1|2738009_2738732_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 206
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2742806	2750771	5380605		Erwinia_phage(20.0%)	8	NA	NA
WP_004176771.1|2742806_2743067_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
WP_002895824.1|2743087_2743354_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_002895822.1|2743639_2743900_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895821.1|2744009_2744978_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895819.1|2745007_2747176_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
WP_004151702.1|2747363_2748719_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895757.1|2748933_2749926_-	transketolase family protein	NA	NA	NA	NA	NA
WP_002895753.1|2749925_2750771_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 207
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2755976	2757716	5380605		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|2755976_2757716_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 208
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2767883	2768789	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|2767883_2768789_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 209
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2775286	2776009	5380605		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|2775286_2776009_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 210
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2779812	2785435	5380605		Klosneuvirus(50.0%)	4	NA	NA
WP_002895578.1|2779812_2781102_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
WP_002895575.1|2781172_2781649_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_004147672.1|2782427_2783810_-	amino acid permease	NA	NA	NA	NA	NA
WP_002895420.1|2783908_2785435_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
>prophage 211
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2795527	2796262	5380605		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151694.1|2795527_2796262_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 212
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2801108	2807631	5380605		Planktothrix_phage(33.33%)	7	NA	NA
WP_002895161.1|2801108_2802167_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
WP_002895159.1|2802169_2802859_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151692.1|2802858_2803632_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895156.1|2803774_2803924_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002895154.1|2804076_2804865_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895152.1|2804932_2806405_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895150.1|2806614_2807631_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 213
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2811992	2815503	5380605		Edwardsiella_phage(33.33%)	4	NA	NA
WP_002895086.1|2811992_2813045_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
WP_002895084.1|2813359_2813725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147641.1|2813842_2814787_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_004151689.1|2814783_2815503_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 214
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2839826	2840618	5380605		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|2839826_2840618_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 215
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2846427	2853857	5380605		Acinetobacter_phage(33.33%)	6	NA	NA
WP_004199663.1|2846427_2847906_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	6.5e-46
WP_004152225.1|2847877_2849320_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_002894847.1|2849503_2849710_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020323459.1|2850019_2850109_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004152226.1|2850108_2851788_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004152227.1|2851808_2853857_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
>prophage 216
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2860683	2861457	5380605		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|2860683_2861457_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 217
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2866145	2869947	5380605	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_002894753.1|2866145_2867813_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
WP_004147599.1|2867991_2869947_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 218
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2874700	2876365	5380605		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|2874700_2876365_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 219
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2880405	2881452	5380605		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|2880405_2881452_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 220
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2887456	2895422	5380605	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_002894706.1|2887456_2888182_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
WP_002894704.1|2888555_2890226_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894701.1|2890291_2892085_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
WP_002894699.1|2892130_2892613_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002894696.1|2892839_2895422_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
>prophage 221
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2902466	2904953	5380605		Synechococcus_phage(50.0%)	2	NA	NA
WP_004147579.1|2902466_2903615_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_002894539.1|2903753_2904953_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 222
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2909831	2910492	5380605		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002894459.1|2909831_2910215_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
WP_002439184.1|2910282_2910492_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 223
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2914582	2916653	5380605		Morganella_phage(50.0%)	2	NA	NA
WP_002894401.1|2914582_2915011_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
WP_002894398.1|2915087_2916653_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
>prophage 224
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2919788	2933503	5380605		Streptococcus_phage(20.0%)	12	NA	NA
WP_002894369.1|2919788_2921012_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
WP_004151651.1|2920996_2921623_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_002894362.1|2921623_2922784_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002894359.1|2922910_2923600_+	acireductone synthase	NA	NA	NA	NA	NA
WP_002894357.1|2923596_2924139_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_004151652.1|2924246_2926556_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894353.1|2926964_2927945_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002894349.1|2927941_2929492_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
WP_004147555.1|2929488_2930478_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894258.1|2930474_2931479_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894256.1|2931490_2932432_+	sugar kinase	NA	NA	NA	NA	NA
WP_002894255.1|2932474_2933503_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
>prophage 225
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2950614	2955035	5380605		Staphylococcus_phage(50.0%)	5	NA	NA
WP_004151659.1|2950614_2952117_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
WP_004151660.1|2952280_2953369_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002893908.1|2953426_2954170_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_002893907.1|2954353_2954656_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893905.1|2954630_2955035_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
>prophage 226
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2967377	2972118	5380605		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_002893737.1|2967377_2968172_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
WP_004151663.1|2968236_2972118_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
>prophage 227
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2983510	2985055	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002893593.1|2983510_2985055_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 228
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	2991758	2997672	5380605	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_004142478.1|2991758_2993792_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
WP_004151671.1|2993920_2994508_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002893471.1|2994521_2995994_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004142489.1|2996007_2997672_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 229
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3002229	3003757	5380605		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151673.1|3002229_3003066_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
WP_004151674.1|3003052_3003757_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
>prophage 230
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3006827	3011507	5380605		Bacillus_virus(50.0%)	5	NA	NA
WP_004151676.1|3006827_3007589_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
WP_002893189.1|3007581_3008247_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002893187.1|3008261_3008903_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893184.1|3008950_3009802_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032441862.1|3010043_3011507_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
>prophage 231
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3016013	3017377	5380605	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3016013_3017377_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 232
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3021910	3024625	5380605		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004151826.1|3021910_3024625_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 233
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3067527	3068643	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|3067527_3068643_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 234
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3083425	3084223	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|3083425_3084223_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 235
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3090845	3096646	5380605		Bacillus_phage(50.0%)	5	NA	NA
WP_004199626.1|3090845_3092246_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
WP_004151799.1|3092275_3093280_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151798.1|3093327_3093936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892599.1|3094119_3095151_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142660.1|3095161_3096646_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 236
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3100493	3101856	5380605	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3100493_3101856_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 237
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3106335	3109660	5380605	tRNA	Catovirus(50.0%)	2	NA	NA
WP_002892491.1|3106335_3107853_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|3108184_3109660_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
>prophage 238
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3115883	3116804	5380605		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|3115883_3116804_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 239
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3128277	3130396	5380605		Enterobacterial_phage(33.33%)	3	NA	NA
WP_002892355.1|3128277_3128595_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
WP_004151791.1|3128594_3128834_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
WP_022644740.1|3128911_3130396_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 240
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3134863	3180138	5380605	lysis,tRNA,head,integrase	Escherichia_phage(26.42%)	63	3128076:3128122	3177210:3177256
3128076:3128122	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|3134863_3137341_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3137327_3137723_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3137719_3138190_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|3138189_3138609_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|3138708_3142155_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3142247_3142751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3142878_3143664_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3143729_3144443_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3144432_3144603_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3144702_3145062_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3145078_3145549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3145842_3146097_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3146099_3146855_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3147030_3147708_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3147760_3148513_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3148581_3148974_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3148970_3149396_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3149398_3149761_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3149760_3149934_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3149933_3150314_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3150316_3150556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3150566_3151661_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3151672_3152101_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3152104_3153490_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3153562_3154039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3154080_3155085_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3155059_3156481_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3156493_3157966_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3157965_3158568_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3158938_3159268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3159373_3159838_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3159834_3160365_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3160367_3160616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|3161525_3162215_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|3162211_3162742_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|3162734_3162872_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|3162868_3163504_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|3163496_3163667_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|3163666_3164122_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|3164622_3165270_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|3165442_3166285_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|3166391_3166898_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3166894_3167188_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|3167187_3168618_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|3168607_3169507_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|3169731_3169953_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|3169993_3170227_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|3170354_3171044_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|3171394_3171610_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|3171709_3171904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|3171992_3172277_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|3172292_3173138_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|3173134_3173815_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|3173811_3173970_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|3173966_3174623_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|3174619_3175387_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|3175383_3175602_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|3175603_3175819_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|3175820_3176156_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|3176032_3177196_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|3177626_3178493_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3177210:3177256	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|3178494_3178707_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3178752_3180138_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 241
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3188683	3189370	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|3188683_3189370_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 242
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3192552	3197758	5380605		Bacillus_virus(50.0%)	5	NA	NA
WP_002892260.1|3192552_3193230_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
WP_002892258.1|3193370_3194288_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004151325.1|3194284_3194743_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|3194739_3195150_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004151326.1|3195256_3197758_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
>prophage 243
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3207903	3215714	5380605	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_002892181.1|3207903_3209778_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
WP_002892177.1|3209889_3210495_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|3210494_3210827_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004151328.1|3210884_3212792_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892145.1|3212884_3213436_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|3213586_3213964_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|3214033_3214561_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|3214573_3214747_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892131.1|3214814_3215714_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
>prophage 244
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3221235	3230626	5380605		Leptospira_phage(33.33%)	10	NA	NA
WP_002892069.1|3221235_3224382_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|3224867_3225242_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|3225268_3225487_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|3225645_3226212_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892026.1|3226344_3226815_+	membrane protein	NA	NA	NA	NA	NA
WP_002892023.1|3226789_3228241_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|3228341_3229040_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|3229036_3229177_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|3229176_3229440_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|3229555_3230626_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 245
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3239800	3240910	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_002891989.1|3239800_3240910_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	32.7	5.4e-13
>prophage 246
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3251833	3255377	5380605		Bacillus_phage(100.0%)	2	NA	NA
WP_002891880.1|3251833_3253612_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
WP_002891876.1|3253604_3255377_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
>prophage 247
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3259804	3260506	5380605		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|3259804_3260506_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 248
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3263736	3268905	5380605	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|3263736_3264009_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_004151336.1|3264218_3266573_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002891807.1|3266756_3268031_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_002891804.1|3268281_3268905_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 249
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3283211	3284909	5380605		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|3283211_3284909_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 250
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3297694	3302354	5380605		Klosneuvirus(33.33%)	6	NA	NA
WP_002891359.1|3297694_3298669_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
WP_004191729.1|3298714_3299218_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891357.1|3299210_3300182_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_002891356.1|3300253_3300673_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|3300692_3301163_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002890420.1|3301250_3302354_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
>prophage 251
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3305952	3310291	5380605	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890403.1|3305952_3306924_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
WP_002890400.1|3306934_3308782_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890398.1|3308808_3309141_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890395.1|3309163_3310291_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
>prophage 252
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3327096	3335616	5380605		Bacillus_phage(60.0%)	6	NA	NA
WP_002890344.1|3327096_3328392_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
WP_002890343.1|3328413_3329103_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890342.1|3329285_3330491_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_004151346.1|3330487_3333625_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890286.1|3333698_3334613_-	fructokinase	NA	NA	NA	NA	NA
WP_002890285.1|3334704_3335616_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 253
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3356099	3356867	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|3356099_3356867_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 254
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3367870	3371591	5380605		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151354.1|3367870_3368653_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
WP_002890126.1|3368645_3369341_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_002890108.1|3369457_3369628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002890106.1|3369961_3370771_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151355.1|3370772_3371591_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 255
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3380664	3381507	5380605		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|3380664_3381507_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 256
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3388351	3401347	5380605	integrase	Enterobacteria_phage(72.73%)	14	3390143:3390157	3413200:3413214
WP_004144576.1|3388351_3389404_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
WP_004144574.1|3389693_3390797_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
3390143:3390157	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|3390807_3392061_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|3392413_3393604_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|3393591_3394542_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|3394541_3394967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|3395535_3396102_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|3396119_3396365_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|3396361_3397099_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|3397640_3397907_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|3397903_3398461_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|3398457_3398685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|3398681_3399002_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|3399013_3401347_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
3413200:3413214	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 257
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3409803	3411201	5380605		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|3409803_3411201_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 258
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3415848	3416844	5380605		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|3415848_3416844_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 259
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3424377	3425661	5380605		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|3424377_3425661_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 260
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3442910	3443492	5380605		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|3442910_3443492_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 261
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3449000	3453210	5380605		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_004152034.1|3449000_3449732_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
WP_002889686.1|3449796_3450264_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_002889685.1|3450260_3450983_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004152035.1|3451015_3451771_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889632.1|3451842_3453210_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 262
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3457275	3458079	5380605		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|3457275_3458079_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 263
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3464586	3465618	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|3464586_3465618_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 264
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3478602	3482702	5380605		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_002889378.1|3478602_3482085_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
WP_002889376.1|3482102_3482702_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 265
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3491533	3492292	5380605		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|3491533_3492292_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 266
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3503870	3505304	5380605	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|3503870_3505304_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 267
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3509259	3509604	5380605		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|3509259_3509604_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 268
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3515570	3516368	5380605		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|3515570_3516368_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 269
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3538503	3545274	5380605	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_004151944.1|3538503_3540933_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
WP_004145901.1|3541005_3541542_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_002888848.1|3541541_3542258_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002888845.1|3542420_3542876_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004145903.1|3542935_3543817_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071526609.1|3543879_3545274_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 270
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3550678	3560555	5380605	transposase	Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
WP_002888823.1|3550678_3551605_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
WP_002888821.1|3551789_3552452_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888819.1|3552511_3553048_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888816.1|3553252_3555643_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888811.1|3555726_3557325_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888808.1|3557470_3557818_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888804.1|3558065_3558476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151949.1|3558472_3559315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|3559363_3560555_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 271
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3570205	3571630	5380605		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|3570205_3571630_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 272
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3582970	3583534	5380605		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|3582970_3583534_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 273
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3587801	3588845	5380605		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|3587801_3588845_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 274
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3615037	3616762	5380605		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|3615037_3616762_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 275
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3628161	3628917	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|3628161_3628917_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 276
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3637616	3638318	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|3637616_3638318_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 277
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3644614	3650066	5380605		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_002888349.1|3644614_3646972_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
WP_004151368.1|3647159_3650066_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 278
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3662524	3664108	5380605		Pseudomonas_phage(50.0%)	2	NA	NA
WP_002888321.1|3662524_3663373_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
WP_002888320.1|3663628_3664108_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 279
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3670449	3671598	5380605		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|3670449_3671598_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 280
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3690395	3700348	5380605	tRNA	Tupanvirus(25.0%)	7	NA	NA
WP_002887972.1|3690395_3693212_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
WP_002887969.1|3693255_3694194_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887965.1|3694523_3694787_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887961.1|3694906_3695803_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887958.1|3695857_3697033_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887955.1|3697210_3698344_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_004146997.1|3698431_3700348_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 281
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3704719	3705673	5380605		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|3704719_3705673_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 282
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3722830	3727990	5380605		Bacillus_phage(33.33%)	3	NA	NA
WP_002887806.1|3722830_3724768_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
WP_002887805.1|3724996_3726664_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887802.1|3726757_3727990_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 283
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3734321	3735644	5380605		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|3734321_3735644_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 284
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3740379	3743100	5380605		Salmonella_phage(50.0%)	3	NA	NA
WP_002887716.1|3740379_3740541_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
WP_004146042.1|3740670_3741291_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887711.1|3741510_3743100_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 285
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3756323	3757603	5380605		Salmonella_phage(50.0%)	2	NA	NA
WP_002887624.1|3756323_3756863_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
WP_002887623.1|3756865_3757603_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 286
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3760763	3763931	5380605	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_002887616.1|3760763_3761702_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
WP_085955148.1|3761841_3762873_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002887612.1|3762869_3763931_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
>prophage 287
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3770935	3771958	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|3770935_3771958_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 288
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3804059	3804986	5380605	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|3804059_3804986_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 289
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3820573	3822058	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|3820573_3822058_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 290
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3825974	3828719	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|3825974_3828719_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 291
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3838472	3840579	5380605		Hokovirus(50.0%)	2	NA	NA
WP_002887275.1|3838472_3839906_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
WP_002887273.1|3839895_3840579_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 292
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3843817	3848775	5380605		Leptospira_phage(33.33%)	4	NA	NA
WP_002887262.1|3843817_3846967_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
WP_002887261.1|3847039_3847387_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887259.1|3847396_3847930_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887258.1|3848046_3848775_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 293
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3869585	3875410	5380605		Enterobacteria_phage(100.0%)	7	NA	NA
WP_004152207.1|3869585_3871919_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|3871933_3872254_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|3872250_3872478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|3872474_3873023_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|3873846_3874584_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|3874580_3874826_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|3874843_3875410_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 294
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3878785	3880048	5380605	integrase	Stenotrophomonas_phage(100.0%)	1	3871064:3871078	3881596:3881610
3871064:3871078	attL	GCGGCAGGGCGACAA	NA	NA	NA	NA
WP_004152198.1|3878785_3880048_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
WP_004152198.1|3878785_3880048_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
3881596:3881610	attR	TTGTCGCCCTGCCGC	NA	NA	NA	NA
>prophage 295
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3883130	3887956	5380605		Tupanvirus(50.0%)	5	NA	NA
WP_004177639.1|3883130_3884150_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
WP_002886983.1|3884292_3885165_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002886980.1|3885154_3886042_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002886979.1|3886052_3886877_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886975.1|3886882_3887956_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
>prophage 296
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3903847	3912897	5380605	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_002886957.1|3903847_3905350_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
WP_002886956.1|3905398_3906481_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886955.1|3906480_3907578_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886954.1|3907967_3909479_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886953.1|3909598_3910042_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886952.1|3910041_3912897_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
>prophage 297
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3922990	3929048	5380605		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002886928.1|3922990_3923926_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
WP_002886927.1|3923939_3924401_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_032441834.1|3924553_3924940_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_004152273.1|3925012_3927721_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_002886919.1|3928100_3929048_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
>prophage 298
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3936805	3939937	5380605		Vibrio_phage(33.33%)	3	NA	NA
WP_002886904.1|3936805_3938944_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
WP_002886903.1|3939184_3939649_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886902.1|3939652_3939937_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
>prophage 299
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3956070	3962649	5380605		Klosneuvirus(33.33%)	6	NA	NA
WP_002886827.1|3956070_3957069_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
WP_002886825.1|3957111_3958110_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004152011.1|3958096_3959122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886772.1|3959132_3960635_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_002886769.1|3960758_3961715_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886766.1|3962118_3962649_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 300
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3979148	3979973	5380605		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|3979148_3979973_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 301
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	3999570	4003914	5380605		Lactococcus_phage(50.0%)	3	NA	NA
WP_002885668.1|3999570_4002003_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
WP_002885667.1|4002039_4002465_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885665.1|4002615_4003914_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 302
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4009844	4013070	5380605		Wolbachia_phage(50.0%)	2	NA	NA
WP_004152020.1|4009844_4011704_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
WP_004152021.1|4011714_4013070_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 303
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4017912	4018458	5380605		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|4017912_4018458_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 304
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4025812	4031006	5380605		Tupanvirus(33.33%)	6	NA	NA
WP_004146714.1|4025812_4026790_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
WP_004152023.1|4027065_4028856_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_002885531.1|4028848_4029583_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_002885530.1|4029593_4029989_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885526.1|4029999_4030359_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885523.1|4030472_4031006_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
>prophage 305
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4042185	4047831	5380605		Bacillus_phage(33.33%)	5	NA	NA
WP_060544621.1|4042185_4044309_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	1.7e-31
WP_002885443.1|4044321_4045185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152419.1|4045239_4045593_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885441.1|4045853_4047500_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152420.1|4047537_4047831_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 306
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4067901	4072987	5380605		Escherichia_phage(50.0%)	5	NA	NA
WP_004199298.1|4067901_4068585_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
WP_002885338.1|4068730_4069648_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885324.1|4069647_4069953_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004151723.1|4071649_4072021_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_004146678.1|4072030_4072987_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 307
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4077351	4078854	5380605		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|4077351_4078854_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 308
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4084214	4085761	5380605		Bacillus_virus(50.0%)	2	NA	NA
WP_002885198.1|4084214_4084973_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
WP_002885196.1|4085080_4085761_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 309
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4091141	4092662	5380605		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|4091141_4092662_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 310
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4098603	4105388	5380605		Escherichia_phage(50.0%)	5	NA	NA
WP_077598858.1|4098603_4100751_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
WP_004151733.1|4100980_4101667_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004146659.1|4101703_4103017_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004226113.1|4103128_4103329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885145.1|4103429_4105388_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
>prophage 311
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4117671	4119021	5380605		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|4117671_4119021_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 312
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4126550	4127582	5380605		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004177837.1|4126550_4127582_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 313
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4139561	4144868	5380605		Vibrio_phage(33.33%)	3	NA	NA
WP_060544675.1|4139561_4141142_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	8.3e-07
WP_004151744.1|4141266_4141791_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004146620.1|4142042_4144868_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 314
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4148049	4150576	5380605		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_002884943.1|4148049_4149129_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
WP_002884942.1|4149160_4150576_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 315
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4156571	4157180	5380605		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|4156571_4157180_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 316
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4164246	4165356	5380605		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|4164246_4165356_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 317
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4181865	4182669	5380605		Moumouvirus(100.0%)	1	NA	NA
WP_002884614.1|4181865_4182669_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 318
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4189237	4192921	5380605		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|4189237_4192921_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 319
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4206458	4208048	5380605		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|4206458_4208048_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 320
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4213469	4215233	5380605		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|4213469_4213742_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_002884331.1|4213928_4214519_-	YjaG family protein	NA	NA	NA	NA	NA
WP_004152311.1|4214561_4215233_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
>prophage 321
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4223658	4236102	5380605		Bacillus_phage(33.33%)	6	NA	NA
WP_004171439.1|4223658_4225191_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
WP_002884150.1|4225363_4225669_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002884149.1|4225672_4225990_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884148.1|4226032_4227373_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884146.1|4227773_4231997_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_004152306.1|4232073_4236102_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 322
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4240329	4243450	5380605		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|4240329_4241514_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002883524.1|4242499_4243450_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 323
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4253377	4253992	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|4253377_4253992_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 324
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4262710	4266054	5380605		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_002883427.1|4262710_4263490_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
WP_002883426.1|4263492_4264029_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883425.1|4264032_4264284_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883424.1|4264413_4266054_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 325
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4278055	4281517	5380605	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_002883410.1|4278055_4278964_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
WP_004152056.1|4279008_4279629_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_004152055.1|4279690_4281517_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 326
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4285352	4289197	5380605		Bacillus_phage(50.0%)	3	NA	NA
WP_002883398.1|4285352_4287515_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
WP_002883397.1|4287578_4288295_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883396.1|4288294_4289197_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 327
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4305564	4311706	5380605		uncultured_marine_virus(20.0%)	6	NA	NA
WP_002883310.1|4305564_4306695_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_004146507.1|4306700_4307375_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883307.1|4307352_4308234_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_002883303.1|4308252_4309320_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883302.1|4309316_4310579_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883297.1|4310575_4311706_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 328
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4315756	4317693	5380605		Indivirus(50.0%)	2	NA	NA
WP_002883224.1|4315756_4316086_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_002883222.1|4316427_4317693_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
>prophage 329
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4322184	4324206	5380605		Bacillus_phage(100.0%)	1	NA	NA
WP_004152491.1|4322184_4324206_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 330
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4332309	4333956	5380605		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|4332309_4333956_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 331
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4344010	4345849	5380605		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|4344010_4345849_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 332
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4360479	4361142	5380605		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|4360479_4361142_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 333
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4365913	4367470	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|4365913_4367470_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 334
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4378534	4379869	5380605		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|4378534_4379869_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 335
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4384371	4387874	5380605		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_002882901.1|4384371_4385070_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_002882898.1|4385066_4386440_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882896.1|4386506_4387181_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882894.1|4387253_4387874_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 336
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4396212	4397724	5380605		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_060544663.1|4396212_4397724_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 337
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4420695	4421613	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|4420695_4421613_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 338
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4428435	4430903	5380605		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_004146229.1|4428435_4429485_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
WP_002882749.1|4429493_4430903_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 339
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4434791	4437584	5380605		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|4434791_4437584_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 340
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4451877	4457756	5380605		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002882536.1|4451877_4452768_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
WP_002882531.1|4452795_4453761_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882529.1|4453766_4455272_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882527.1|4455282_4455702_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882520.1|4455887_4457756_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
>prophage 341
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4460921	4461914	5380605		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|4460921_4461914_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 342
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4474264	4481824	5380605		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_004151550.1|4474264_4475635_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
WP_004151549.1|4475818_4477648_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004150308.1|4477984_4479025_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004145004.1|4479153_4480113_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004151547.1|4480112_4481003_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145006.1|4481050_4481824_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
>prophage 343
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4487600	4488938	5380605		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|4487600_4488938_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 344
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4496430	4503960	5380605		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004151536.1|4496430_4496688_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
WP_004151535.1|4496651_4497011_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|4497026_4497167_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151534.1|4497788_4499192_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004151533.1|4499196_4500297_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151532.1|4500443_4501517_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004173845.1|4501545_4503960_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
>prophage 345
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4509727	4510876	5380605		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|4509727_4510876_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 346
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4514311	4516231	5380605		Cyanophage(33.33%)	3	NA	NA
WP_004151523.1|4514311_4514725_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_004145074.1|4514841_4515270_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151522.1|4515406_4516231_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
>prophage 347
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4527240	4532679	5380605		Salmonella_phage(50.0%)	6	NA	NA
WP_002923297.1|4527240_4528425_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
WP_002923296.1|4528600_4529434_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002923294.1|4529501_4529948_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923292.1|4530038_4530128_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923286.1|4530790_4530886_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004198592.1|4530990_4532679_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
>prophage 348
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4544856	4545969	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|4544856_4545969_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 349
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4564404	4565568	5380605		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|4564404_4565568_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 350
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4582828	4583878	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|4582828_4583878_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 351
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4597137	4598529	5380605		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|4597137_4598529_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 352
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4601663	4602515	5380605		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|4601663_4602515_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 353
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4613496	4621786	5380605		Bordetella_phage(25.0%)	7	NA	NA
WP_004151503.1|4613496_4615617_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|4615635_4615911_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|4615965_4616589_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_002922662.1|4616847_4618524_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922654.1|4618529_4619147_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004151501.1|4619421_4620672_+	chloride channel protein	NA	NA	NA	NA	NA
WP_004151500.1|4620727_4621786_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
>prophage 354
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4626828	4627746	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152982.1|4626828_4627746_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 355
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4631205	4635947	5380605		Xanthomonas_phage(25.0%)	7	NA	NA
WP_002922593.1|4631205_4631661_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
WP_002922591.1|4631641_4632856_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_002922589.1|4633028_4633694_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|4633910_4634147_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|4634167_4634335_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002922508.1|4634470_4635280_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922501.1|4635467_4635947_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 356
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4648715	4657865	5380605		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_002922463.1|4648715_4649648_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
WP_002922462.1|4649861_4651055_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922461.1|4651067_4652093_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922460.1|4652261_4653050_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922459.1|4653055_4654003_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922458.1|4654006_4655278_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_004152046.1|4655287_4656832_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922436.1|4657077_4657509_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002922429.1|4657613_4657865_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 357
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4673702	4675544	5380605		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|4673702_4675544_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 358
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4683517	4685059	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|4683517_4685059_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 359
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4690527	4691523	5380605		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|4690527_4691523_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 360
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4695899	4697830	5380605		Hokovirus(50.0%)	2	NA	NA
WP_004152429.1|4695899_4697519_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	24.6	3.4e-16
WP_000014594.1|4697617_4697830_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 361
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4701233	4702205	5380605		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|4701233_4702205_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 362
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4707364	4710104	5380605		Escherichia_phage(50.0%)	2	NA	NA
WP_004152428.1|4707364_4709695_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
WP_002921915.1|4709663_4710104_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
>prophage 363
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4722609	4728582	5380605		Planktothrix_phage(33.33%)	5	NA	NA
WP_002921785.1|4722609_4723593_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
WP_002921784.1|4723589_4724603_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_004151436.1|4725118_4725658_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921735.1|4725659_4726451_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_002921733.1|4726470_4728582_+	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 364
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4772312	4774355	5380605		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|4772312_4774355_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 365
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4782896	4783688	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|4782896_4783688_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 366
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4789790	4793897	5380605		Tupanvirus(66.67%)	3	NA	NA
WP_002921037.1|4789790_4790930_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
WP_002921035.1|4790931_4791915_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921032.1|4791911_4793897_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 367
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4800197	4804334	5380605		Dickeya_phage(50.0%)	4	NA	NA
WP_002920860.1|4800197_4800863_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
WP_002920858.1|4801069_4801315_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_004151416.1|4801418_4803629_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920827.1|4803707_4804334_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
>prophage 368
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4807418	4813219	5380605		Staphylococcus_phage(25.0%)	5	NA	NA
WP_002920817.1|4807418_4808087_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
WP_002920816.1|4808079_4809135_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|4809404_4810259_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_004200671.1|4810311_4811835_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920814.1|4811953_4813219_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
>prophage 369
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4820540	4822773	5380605		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920803.1|4820540_4821308_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
WP_004145133.1|4821309_4822023_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920802.1|4822186_4822408_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002920800.1|4822404_4822773_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 370
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4826199	4828007	5380605		Planktothrix_phage(50.0%)	2	NA	NA
WP_002920787.1|4826199_4827270_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_002920785.1|4827266_4828007_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 371
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4845752	4848200	5380605		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|4845752_4848200_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 372
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4852057	4852816	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|4852057_4852816_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 373
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4856161	4858552	5380605		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|4856161_4858552_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 374
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4871378	4875150	5380605		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|4871378_4872098_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_002920333.1|4872094_4873450_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_002920331.1|4873527_4875150_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
>prophage 375
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4889973	4890801	5380605		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|4889973_4890801_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 376
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4902202	4911846	5380605		Acinetobacter_phage(25.0%)	9	NA	NA
WP_002920229.1|4902202_4902766_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
WP_002920226.1|4902856_4904077_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004151402.1|4904066_4906145_-	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_000242758.1|4906196_4906829_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_002920158.1|4907135_4907540_+	OsmC family protein	NA	NA	NA	NA	NA
WP_002920153.1|4907594_4908464_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920151.1|4908500_4908719_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920149.1|4908715_4909738_-	hydrolase	NA	NA	NA	NA	NA
WP_002920148.1|4909941_4911846_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
>prophage 377
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4919691	4923060	5380605		Streptococcus_phage(50.0%)	2	NA	NA
WP_002920103.1|4919691_4921806_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
WP_004174069.1|4921875_4923060_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 378
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4942963	4976220	5380605	tRNA,portal,tail,terminase,capsid,integrase,protease,head	uncultured_Caudovirales_phage(73.33%)	33	4960570:4960587	4976565:4976582
WP_002919147.1|4942963_4943911_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|4943925_4944435_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|4944563_4945688_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|4945659_4946133_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|4946158_4946701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|4946705_4947278_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|4947281_4948100_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|4948096_4948354_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|4948329_4948884_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|4954678_4954900_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|4955193_4958304_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|4958316_4959456_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|4959834_4960485_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4960570:4960587	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|4960760_4961987_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|4962079_4963021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|4963202_4963487_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|4963497_4964277_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|4964728_4964998_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|4964990_4965179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|4965171_4965486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4965482_4965851_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|4965847_4966213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4966212_4968348_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|4968690_4969026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|4969074_4969587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|4969850_4971017_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|4971068_4971629_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|4971630_4972872_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|4972868_4973204_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|4973200_4973500_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|4973499_4973943_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|4974218_4974575_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|4974558_4976220_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
4976565:4976582	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 379
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	4987779	4988823	5380605		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|4987779_4988823_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 380
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5006532	5007900	5380605	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002918566.1|5006532_5007900_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 381
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5011845	5012340	5380605	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_002918465.1|5011845_5012340_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 382
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5019785	5020718	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|5019785_5020718_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 383
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5024662	5037593	5380605		Hokovirus(16.67%)	15	NA	NA
WP_002918444.1|5024662_5027002_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
WP_002918442.1|5027235_5027889_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918435.1|5027885_5028611_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918431.1|5028674_5028947_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918428.1|5028943_5029798_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918425.1|5029843_5030332_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918423.1|5030402_5030690_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918420.1|5030712_5032146_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918417.1|5032193_5032919_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918415.1|5032925_5033471_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918413.1|5033439_5034015_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918405.1|5034011_5034578_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918399.1|5034592_5035579_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918397.1|5035593_5036571_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004150950.1|5036780_5037593_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 384
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5041642	5043084	5380605		Vibrio_phage(50.0%)	2	NA	NA
WP_002918381.1|5041642_5041915_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
WP_002918380.1|5042112_5043084_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 385
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5049682	5052559	5380605	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_002918372.1|5049682_5051617_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_002918371.1|5051710_5052559_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 386
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5056823	5063442	5380605		Dickeya_phage(50.0%)	4	NA	NA
WP_004144895.1|5056823_5058167_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_002918364.1|5058759_5059212_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002918252.1|5059239_5060727_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918250.1|5060751_5063442_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 387
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5068856	5070788	5380605		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|5068856_5070788_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 388
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5076481	5086191	5380605		Invertebrate_iridovirus(20.0%)	12	NA	NA
WP_004152864.1|5076481_5076766_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
WP_002918223.1|5076821_5077265_+	YhbP family protein	NA	NA	NA	NA	NA
WP_002918221.1|5077226_5077763_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918218.1|5077891_5078539_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918216.1|5078614_5079655_+	permease	NA	NA	NA	NA	NA
WP_002918214.1|5079776_5080352_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918211.1|5080361_5080952_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918206.1|5080977_5081364_-	YraN family protein	NA	NA	NA	NA	NA
WP_004160309.1|5081321_5083439_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004144878.1|5083502_5084366_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_060544680.1|5084369_5085383_+	Fic family protein	NA	NA	NA	NA	NA
WP_002918124.1|5085417_5086191_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
>prophage 389
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5102297	5103443	5380605		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|5102297_5103443_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 390
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5120466	5121438	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|5120466_5121438_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 391
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5131001	5132489	5380605		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|5131001_5132489_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 392
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5136760	5138140	5380605		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|5136760_5138140_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 393
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5156218	5170578	5380605	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	13	NA	NA
WP_002917658.1|5156218_5157022_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
WP_002917655.1|5157073_5157379_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917651.1|5157405_5157981_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_004150926.1|5158251_5158893_+	YfdX family protein	NA	NA	NA	NA	NA
WP_004150925.1|5158983_5162226_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_002917647.1|5162230_5162845_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_071531177.1|5163197_5163512_+	HdeB family protein	NA	NA	NA	NA	NA
WP_002917638.1|5163580_5163853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|5164588_5165095_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|5165194_5167036_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|5167254_5169000_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|5169111_5169327_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|5169564_5170578_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 394
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5179871	5181113	5380605	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|5179871_5181113_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 395
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5186224	5193105	5380605		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
WP_002916858.1|5186224_5187658_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
WP_002916857.1|5187876_5188074_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916856.1|5188109_5188382_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916855.1|5188759_5189413_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916852.1|5189474_5190245_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916851.1|5190431_5191223_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916850.1|5191267_5192428_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916849.1|5192433_5193105_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
>prophage 396
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5197447	5199343	5380605		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|5197447_5199343_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 397
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5202654	5212557	5380605		Stx_converting_phage(25.0%)	8	NA	NA
WP_002916833.1|5202654_5203050_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
WP_002916831.1|5203127_5203997_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916828.1|5204118_5206377_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916826.1|5206568_5207306_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004144547.1|5207389_5208802_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916798.1|5208925_5211109_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004150920.1|5211166_5211694_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916796.1|5211729_5212557_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 398
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5232266	5233637	5380605		Lactococcus_phage(100.0%)	1	NA	NA
WP_004150913.1|5232266_5233637_-	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 399
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5238526	5239894	5380605		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|5238526_5239894_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 400
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5246174	5246930	5380605		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|5246174_5246930_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 401
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5268485	5269853	5380605		Morganella_phage(100.0%)	1	NA	NA
WP_004150873.1|5268485_5269853_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 402
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5280247	5281783	5380605		Vibrio_phage(100.0%)	4	NA	NA
WP_004152612.1|5280247_5280499_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
WP_004155677.1|5280602_5280848_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152613.1|5280926_5281382_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152614.1|5281522_5281783_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
>prophage 403
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5288482	5289463	5380605		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|5288482_5289463_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 404
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5297009	5298092	5380605		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|5297009_5298092_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 405
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5312966	5314121	5380605		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|5312966_5314121_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 406
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5327876	5328671	5380605		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|5327876_5328671_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 407
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5345924	5347157	5380605		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|5345924_5347157_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 408
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5355100	5357974	5380605		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|5355100_5357974_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 409
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5362549	5363983	5380605		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|5362549_5363983_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 410
NZ_CP020901	Klebsiella pneumoniae strain K66-45 chromosome, complete genome	5380605	5368679	5376581	5380605	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
WP_004144729.1|5368679_5369576_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
WP_002916301.1|5369598_5370312_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004151783.1|5370317_5372051_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_095858446.1|5372136_5373234_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_002916299.1|5373244_5374762_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_002916298.1|5374996_5375551_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004157874.1|5375867_5376581_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 1
NZ_CP020902	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence	338512	5355	70588	338512	transposase	Enterobacteria_phage(21.43%)	52	NA	NA
WP_014386491.1|5355_6336_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_087759866.1|6580_7700_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_014386493.1|8115_9318_+	type II restriction enzyme	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_060544665.1|9407_10823_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026464.1|10949_11693_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_004026465.1|11689_12124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|12156_12417_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026468.1|12670_13114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181826.1|13344_13704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032451555.1|13888_14299_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	3.9e-41
WP_040120314.1|14423_14738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196710.1|14728_15307_-	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_044816269.1|15406_15871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181820.1|16967_17387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181819.1|17517_18195_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_040120315.1|18341_20747_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_014386497.1|20882_23288_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_014386498.1|23426_25832_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_014386499.1|26553_27564_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_014386500.1|27563_28811_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
WP_065310894.1|30997_31228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|32266_33387_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_071596344.1|35022_35544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196657.1|35908_37087_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
WP_040120319.1|37214_37979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386506.1|38034_38703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026504.1|39977_40346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198097.1|40447_40750_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_004196647.1|40768_41629_+	traE family protein	NA	NA	NA	NA	NA
WP_004026506.1|41630_42800_+	traK family protein	NA	NA	NA	NA	NA
WP_014386508.1|42796_43315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437928.1|43274_44645_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_004181799.1|44647_45112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386509.1|45114_45966_+	protein DsbC	NA	NA	NA	NA	NA
WP_004181797.1|45975_46713_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004196678.1|46757_49475_+	TraC family protein	NA	NA	NA	NA	NA
WP_014386510.1|49501_49918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196661.1|49889_50390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120320.1|50376_51093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386512.1|51082_51886_-	protein TrhO	NA	NA	NA	NA	NA
WP_004196672.1|52569_53028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120321.1|53002_53407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181791.1|53394_53931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386514.1|54058_58300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026522.1|58437_58962_+	signal peptidase I	NA	NA	NA	NA	NA
WP_014386515.1|58948_60310_+	conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004026524.1|60306_61344_+	traU family protein	NA	NA	NA	NA	NA
WP_014386516.1|61353_64539_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_014386517.1|64587_65436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120325.1|67135_68323_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.3	1.3e-142
WP_077256229.1|68358_68787_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.1	2.4e-33
WP_040120327.1|69361_70588_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.7	1.2e-154
>prophage 2
NZ_CP020902	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence	338512	83297	132319	338512	integrase,transposase	Escherichia_phage(23.08%)	46	83246:83305	116885:117704
83246:83305	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|83297_84002_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004896925.1|84886_85429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|85764_86397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|86425_87829_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_000155092.1|88070_88955_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|89010_90486_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|90884_92069_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|92117_92303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|92522_92804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|92784_93558_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|94956_96498_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|96902_97742_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|97735_98083_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|98246_99038_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|99043_99334_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|99445_99943_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|100087_101101_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|101422_101980_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|101982_104955_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|105033_106038_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004186900.1|106953_107838_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_136537796.1|108734_109019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386530.1|109237_110305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|110390_110645_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386529.1|110821_111958_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|112023_112341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|112485_112815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|112811_113570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|113566_114526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|114568_114976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|114985_115450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|115497_115740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120785101.1|115726_116110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|116187_116892_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001516695.1|120604_121261_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
116885:117704	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTCAATATTGCCAGGATGTCACCGCAGAAAAGGATGGCGGTTCTGGTTGCCTTTGTCCTTGCATGGGAAACGCTGGCGCTGGATGATGCATTGGACGTTCTGGACGCCATGCTGGCCGTTATCATCCGTGACGCCAGAAAGATTGGGCAGAAAAAACGGCTCCGCTCGCTGAAGGATCTGGATAAATCTGCATTGGCGCTCGCCAGCGCATGTTCGTACCTGCTGAAAGAAGAAACACCGGACGAATCGATTCGTGCTGAGGTGTTCAGCTACATCCCAAGGCAAAAGCTGGCTGAAATCATCACGCTTGTCCGTGAAATTGCCCGGCCCTCAGACGATAATTTTCATGAAGAAATGGTGGAGCAGTACGGGCGCGTTCGTCGTTTCCTGCCCCATCTGCTGAATACCGTTAAATTTTCATCCGCACCTGCCGGGGTTACCACTCTGAATGCCTGTGACTACCTCAGCCGGGAGTTCAGCTCACGGCGGCAGTTTTTTGACGACGCACCAACGGAAATTATCAGTCGGTCATGGAAACGGCTGGTGATTAACAAGGAAAAACATATCACCCGCAGGGGATACACGCTCTGCTTTCTCAGTAAACTGCAGGATAGTCTGAGGCGGAGGGATGTCTACGTTACCGGCAGTAACCGGTGGGGAGATCCTCGTGCAAGATTACTACAGGGTGCTGACTGGCAGGCAAACCGGATTAAGGTTTATCGTTCTTTGGGGCACCCGACAGACCCGCAGGAAGCAATAA	NA	NA	NA	NA
WP_001493761.1|122040_123432_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|123468_124041_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|124177_124768_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014386410.1|125138_125918_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_071905678.1|127104_128136_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004201164.1|128350_129163_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|129166_129532_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|129536_130175_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|130185_131217_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|131221_131551_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_001067855.1|131614_132319_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP020902	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence	338512	136706	193213	338512	integrase,transposase,bacteriocin	uncultured_Caudovirales_phage(19.23%)	52	162456:162496	201379:201419
WP_032722221.1|136706_137258_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	8.1e-18
WP_099755463.1|137547_137745_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001549890.1|138862_139195_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118521.1|139191_139914_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|139971_140400_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|140449_141733_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|141828_142182_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|142665_144144_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_060544630.1|144162_144990_+	universal stress protein	NA	NA	NA	NA	NA
WP_000427614.1|146045_147050_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_060544631.1|147422_148625_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_060544632.1|148632_149313_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.7	7.6e-26
WP_060544633.1|149572_150622_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060544648.1|150896_152039_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544634.1|152053_152734_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.7e-30
WP_060544649.1|152749_154207_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	1.4e-21
WP_060544635.1|154271_154751_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060544636.1|154728_155490_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060544637.1|155499_156084_+	flavodoxin	NA	NA	NA	NA	NA
WP_060544638.1|156191_157256_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060544639.1|157499_158351_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.6	1.5e-47
WP_060544640.1|158377_159367_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544641.1|159401_160295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060544642.1|160443_161229_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060544643.1|161263_161848_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.0e-22
162456:162496	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAA	NA	NA	NA	NA
WP_060544645.1|162937_163882_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088263321.1|164033_165035_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_060544646.1|165037_166087_+	phenylacetaldoxime dehydratase family protein	NA	NA	NA	NA	NA
WP_060544647.1|166083_166959_+	transporter	NA	NA	NA	NA	NA
WP_032440835.1|167473_167881_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
WP_004200420.1|167877_168228_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_088263322.1|169482_169677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117044058.1|169637_169751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_120785103.1|169769_169928_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	72.4	3.8e-05
WP_012579081.1|170126_171050_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_060544655.1|171095_171449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|171448_174685_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_000342688.1|174684_176214_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|176215_176632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039464.1|177188_177575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280007.1|178198_178576_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	7.9e-57
WP_004114612.1|178572_178920_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004181747.1|178969_180508_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_032430786.1|183588_185073_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_060544670.1|185482_185914_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.8e-28
WP_004118291.1|185913_187185_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|187266_188244_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|188240_189446_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|189861_190131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|190487_191354_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|192121_192379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|192436_193213_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
201379:201419	attR	TTGCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC	NA	NA	NA	NA
>prophage 4
NZ_CP020902	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence	338512	202093	259180	338512	protease,transposase	Stx2-converting_phage(27.78%)	60	NA	NA
WP_000427623.1|202093_203098_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_008786737.1|205576_205954_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008786738.1|205997_207095_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_019396551.1|207319_207577_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_008786740.1|207586_208897_+	MFS transporter	NA	NA	NA	NA	NA
WP_008786741.1|208935_209292_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032216024.1|211241_212222_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_062826775.1|212764_213655_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|215258_215819_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_032492248.1|215944_216157_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|216119_216239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|216222_216459_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|216455_216821_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|216838_218524_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|218562_218988_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|219015_219291_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294654.1|219306_219687_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|219758_220214_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017900807.1|220872_221325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902257.1|222154_222496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902255.1|222603_222816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902250.1|222934_223213_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014386536.1|223203_223686_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004902239.1|224720_225260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442757.1|225364_225757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902235.1|225857_226613_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_014386537.1|226639_227287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032430779.1|227418_228918_-	kinase	NA	NA	NA	NA	NA
WP_032412835.1|228945_230679_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|230678_231719_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032430777.1|231811_232450_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|232450_233092_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_014386542.1|233116_233755_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|234233_234692_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386543.1|234694_235918_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014386544.1|235928_236885_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_014386545.1|236884_237964_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	3.3e-39
WP_004181732.1|237965_238739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287198.1|238731_239874_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_014386547.1|239885_240944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004210240.1|241255_241840_+	tellurium resistance protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_014386549.1|241836_242988_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_040120331.1|243010_243466_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_012540178.1|243489_244530_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.1e-71
WP_004026609.1|244568_245147_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|245233_245809_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004201219.1|245995_247534_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|247582_247930_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|247926_248331_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_060544599.1|248466_249597_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	24.7	1.3e-09
WP_004026615.1|249933_250581_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_060544598.1|251201_252815_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	2.3e-182
WP_000624722.1|252845_253196_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|253192_253618_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_040120332.1|253705_254095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120333.1|254160_254919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386553.1|255151_255883_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_014386554.1|256142_256745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085706578.1|257737_258268_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_012579081.1|258256_259180_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
>prophage 5
NZ_CP020902	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence	338512	312878	325185	338512		Escherichia_phage(30.77%)	18	NA	NA
WP_004197197.1|312878_314120_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_014386579.1|315003_315459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026394.1|315746_316355_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_004026395.1|316424_316874_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_040120310.1|317642_317915_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_016947069.1|318184_318370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099743439.1|318369_318972_-	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
WP_016947068.1|319055_319538_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_153236429.1|319874_320210_-	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	3.3e-14
WP_004197183.1|320293_320509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197228.1|320788_321175_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004883219.1|321591_322236_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_062826758.1|322937_323126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386581.1|323122_323620_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
WP_004026415.1|323713_323932_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004197205.1|324097_324349_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026416.1|324469_324784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026417.1|324864_325185_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
>prophage 1
NZ_CP020903	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence	200365	5122	43913	200365	protease,transposase	Escherichia_phage(50.0%)	35	NA	NA
WP_000616807.1|5122_5776_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|5868_6126_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|6058_6460_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|6874_7579_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|7722_8277_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|8407_9238_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|9869_10574_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|12195_12438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470728.1|12469_13147_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|13225_14425_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|14456_15341_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|15478_15871_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_032409011.1|16647_17172_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	34.4	8.8e-14
WP_001067855.1|17201_17906_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|18056_18872_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044117068.1|19061_19730_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000427623.1|20021_21026_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004217321.1|22360_23065_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014386147.1|23920_24748_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_004152695.1|24744_25608_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|25616_26444_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|26452_27463_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|27456_28326_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386148.1|29534_30515_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004118209.1|31716_31980_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|31994_32258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|32501_32783_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|32817_33387_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|33501_36297_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|36296_36494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|36731_37481_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|37467_38430_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|40272_41619_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|41848_42481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|42509_43913_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020904	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence	120533	44414	65811	120533	transposase,bacteriocin	Escherichia_phage(50.0%)	20	NA	NA
WP_004178051.1|44414_46736_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|46737_47016_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004152294.1|47284_47836_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004199332.1|48156_48435_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|48651_48729_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|48721_49579_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_011977766.1|50622_50958_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|51130_51412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|51465_52077_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001445937.1|52261_53218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|53598_54303_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|54934_55765_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|55895_56450_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|56593_57298_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|57404_58265_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|58277_58820_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|60013_60718_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|63038_63371_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|63417_64293_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|64548_65811_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 2
NZ_CP020904	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence	120533	96575	108667	120533		Enterobacteria_phage(25.0%)	12	NA	NA
WP_004152345.1|96575_98603_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|98714_98930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|99154_99487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|99863_100838_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|100834_102040_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|102361_103258_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|103658_104930_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|104929_105361_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|105592_106564_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|106566_107238_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|107298_107529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|107965_108667_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP020905	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-4, complete sequence	41111	0	13702	41111		Acanthamoeba_polyphaga_mimivirus(33.33%)	17	NA	NA
WP_060544570.1|1078_1537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060544569.1|1728_2034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544593.1|2372_2594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001623607.1|2903_3221_-	CcdB family protein	NA	NA	NA	NA	NA
WP_060544567.1|3220_3466_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_001610336.1|3987_4176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544658.1|4952_5456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610345.1|5439_5736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610343.1|5802_6366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610342.1|6415_6940_-	DnaJ domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	42.5	1.0e-06
WP_001610340.1|7343_7673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544592.1|8160_10488_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.3	1.9e-36
WP_060544591.1|10699_10969_-	pilus assembly protein PilI	NA	NA	NA	NA	NA
WP_060544590.1|10971_11346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544589.1|11356_11947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544588.1|11957_12695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544587.1|13210_13702_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.3	1.4e-16
>prophage 2
NZ_CP020905	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-4, complete sequence	41111	30011	31715	41111		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_060544578.1|30011_31715_+	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	27.2	5.8e-14
>prophage 3
NZ_CP020905	Klebsiella pneumoniae strain K66-45 plasmid pK66-45-4, complete sequence	41111	40080	40746	41111		Burkholderia_virus(100.0%)	1	NA	NA
WP_001623616.1|40080_40746_-	hypothetical protein	NA	A4JWV7	Burkholderia_virus	29.8	2.5e-05
