The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	0	20087	4441591	transposase	Burkholderia_virus(12.5%)	17	NA	NA
WP_087902221.1|1612_2873_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003400271.1|3376_4585_+	DNA polymerase III subunit beta	NA	G8I4E4	Mycobacterium_phage	38.9	1.5e-64
WP_003899768.1|4604_5762_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003899769.1|5758_6322_+	DUF721 family protein	NA	NA	NA	NA	NA
WP_003917863.1|6564_8592_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	42.6	1.4e-131
WP_014584617.1|8626_11143_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	4.4e-87
WP_031709324.1|11238_12153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400294.1|12549_12741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400297.1|12879_13017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400307.1|13198_13636_-	cell wall synthesis protein CwsA	NA	NA	NA	NA	NA
WP_003400321.1|13792_14341_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.2	1.5e-24
WP_003899772.1|14457_14883_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003400344.1|15038_15320_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_003901765.1|15413_16202_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_003400352.1|16238_16937_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.0e-42
WP_003902584.1|16914_18795_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	35.1	8.0e-17
WP_003906262.1|18791_20087_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	28.8	6.7e-15
>prophage 2
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	29655	30513	4441591		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003901769.1|29655_30513_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	54.3	1.4e-21
>prophage 3
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	35600	37916	4441591		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003901773.1|35600_37916_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	27.5	5.2e-34
>prophage 4
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	45035	47945	4441591	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902585.1|45035_47945_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.6	2.1e-210
>prophage 5
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	51492	52596	4441591		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003400492.1|51492_52596_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	43.4	1.4e-74
>prophage 6
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	60066	69864	4441591		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_003400534.1|60066_60561_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	73.8	1.4e-58
WP_003400540.1|60602_60857_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003400543.1|60889_61348_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003900797.1|61376_61898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400547.1|61876_64501_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	47.5	4.9e-20
WP_003400548.1|64680_65373_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003400551.1|65389_66448_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	38.5	2.1e-22
WP_003400562.1|67032_68175_+	cellulase CelA	NA	NA	NA	NA	NA
WP_003902591.1|68403_69864_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.6	1.2e-20
>prophage 7
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	79128	80406	4441591		Aeromonas_phage(100.0%)	1	NA	NA
WP_003899799.1|79128_80406_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.2	2.5e-86
>prophage 8
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	98635	100921	4441591		uncultured_virus(100.0%)	1	NA	NA
WP_003899808.1|98635_100921_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	1.9e-84
>prophage 9
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	106212	120230	4441591		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003400792.1|106212_107835_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.2	3.2e-14
WP_003400793.1|107839_108076_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003400794.1|108057_115596_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	2.2e-81
WP_003900808.1|115770_117756_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003400797.1|117971_120230_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	3.5e-83
>prophage 10
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	123721	128599	4441591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003899815.1|123721_128599_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	30.1	5.4e-41
>prophage 11
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	132008	141935	4441591		Synechococcus_phage(40.0%)	9	NA	NA
WP_003900811.1|132008_134066_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.6	2.3e-41
WP_003910039.1|134347_135304_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	31.0	1.3e-36
WP_003400839.1|135377_135968_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.1	6.4e-13
WP_003400840.1|135999_136572_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003902603.1|136571_137732_+	D-alpha-D-heptose-7-phosphate kinase hddA	NA	A0A222YW25	Synechococcus_phage	37.4	2.1e-55
WP_003400850.1|138014_138203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400856.1|138325_139081_-	L,D-transpeptidase LdtMt1	NA	NA	NA	NA	NA
WP_003906284.1|139258_140203_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003400858.1|140186_141935_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.7	1.2e-27
>prophage 12
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	154798	155821	4441591		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003400908.1|154798_155821_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	70.3	1.9e-129
>prophage 13
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	159089	162911	4441591		Human_cytomegalovirus(50.0%)	3	NA	NA
WP_003400924.1|159089_159695_+	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	32.5	1.6e-19
WP_003400935.1|160863_161469_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003906289.1|161585_162911_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	26.2	4.6e-19
>prophage 14
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	175762	177529	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400998.1|175762_177529_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	39.0	1.0e-21
>prophage 15
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	185652	187059	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401047.1|185652_187059_-	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	34.5	2.0e-20
>prophage 16
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	190203	194879	4441591		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_003401058.1|190203_191355_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	7.8e-31
WP_003401060.1|191336_191792_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003401063.1|191845_192331_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003401065.1|192344_193037_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899837.1|193214_194879_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.7e-34
>prophage 17
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	223049	223712	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401129.1|223049_223712_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	51.2	1.4e-45
>prophage 18
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	231222	234807	4441591		Bacillus_phage(100.0%)	1	NA	NA
WP_003902618.1|231222_234807_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-44
>prophage 19
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	238863	240855	4441591	protease	Klosneuvirus(100.0%)	1	NA	NA
WP_003401172.1|238863_240855_-|protease	zinc metalloprotease	protease	A0A1V0SHG2	Klosneuvirus	38.5	3.2e-80
>prophage 20
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	258016	258988	4441591		Serratia_phage(100.0%)	1	NA	NA
WP_003401213.1|258016_258988_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A1S6UB31	Serratia_phage	28.9	7.8e-24
>prophage 21
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	264270	268371	4441591		Mycobacterium_phage(100.0%)	4	NA	NA
WP_003900831.1|264270_265179_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	31.4	1.2e-05
WP_003901829.1|265271_266600_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003401230.1|266601_267150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899863.1|267159_268371_+	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	42.4	8.7e-49
>prophage 22
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	303211	305152	4441591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003401322.1|303211_305152_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.4	9.1e-24
>prophage 23
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	327112	330598	4441591		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003401383.1|327112_327622_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1C9M039	Mycobacterium_phage	74.4	5.9e-23
WP_003401386.1|327686_328880_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_003899884.1|328915_330598_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	1.6e-24
>prophage 24
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	346570	354068	4441591		Mycobacterium_phage(100.0%)	3	NA	NA
WP_003401463.1|346570_348466_+	type VII secretion system ESX-3 AAA family ATPase EccA3	NA	V5UQM2	Mycobacterium_phage	40.6	3.1e-101
WP_003401472.1|348462_350079_+	type VII secretion system ESX-3 subunit EccB3	NA	V5UN45	Mycobacterium_phage	35.0	5.6e-59
WP_003401478.1|350075_354068_+	type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3	NA	V5UPA0	Mycobacterium_phage	26.3	8.0e-91
>prophage 25
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	358938	360324	4441591	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003401528.1|358938_360324_+|protease	type VII secretion system ESX-3 serine protease mycosin MycP3	protease	V5UPA7	Mycobacterium_phage	39.8	6.6e-69
>prophage 26
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	389588	398461	4441591		Acanthocystis_turfacea_Chlorella_virus(20.0%)	10	NA	NA
WP_003401625.1|389588_390359_-	glycerophosphodiester phosphodiesterase	NA	M1HUL1	Acanthocystis_turfacea_Chlorella_virus	27.1	2.2e-13
WP_003401627.1|390720_391515_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_003401632.1|391563_392232_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003401636.1|392303_392966_+	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	42.5	2.4e-24
WP_003898399.1|392997_393570_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	74.7	5.0e-79
WP_003898400.1|393675_395007_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	2.7e-67
WP_003401643.1|394995_395667_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_003401648.1|395767_396448_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_003902651.1|396454_397144_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003401650.1|397111_398461_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	21.8	5.0e-13
>prophage 27
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	403073	403940	4441591		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003401670.1|403073_403940_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	56.6	4.3e-90
>prophage 28
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	424250	428055	4441591		Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_003401814.1|424250_426128_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	2.3e-141
WP_003401817.1|426124_426832_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003401821.1|426867_428055_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.7	2.1e-15
>prophage 29
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	439715	441014	4441591		Pandoravirus(100.0%)	1	NA	NA
WP_003401829.1|439715_441014_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	34.6	6.4e-66
>prophage 30
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	456044	456524	4441591		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003401867.1|456044_456524_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.1	3.5e-17
>prophage 31
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	462085	466247	4441591		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_003401894.1|462085_462625_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	44.9	4.3e-16
WP_003401897.1|462705_463560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003401905.1|463700_466247_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	35.7	1.1e-120
>prophage 32
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	481573	482803	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003898432.1|481573_482803_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.0	2.4e-17
>prophage 33
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	488247	494209	4441591		Catovirus(50.0%)	2	NA	NA
WP_003900921.1|488247_490005_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	9.8e-09
WP_016719657.1|490237_494209_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.8	4.9e-32
>prophage 34
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	499331	501584	4441591		Moloney_murine_sarcoma_virus(100.0%)	1	NA	NA
WP_003402100.1|499331_501584_-	serine/threonine protein kinase	NA	Q85650	Moloney_murine_sarcoma_virus	26.1	3.0e-10
>prophage 35
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	514970	519590	4441591		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003898445.1|514970_519590_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.5	6.7e-41
>prophage 36
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	523001	523310	4441591		Gordonia_phage(100.0%)	1	NA	NA
WP_003402188.1|523001_523310_+	DUF3263 domain-containing protein	NA	A0A1B3AZ99	Gordonia_phage	43.5	1.6e-07
>prophage 37
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	526615	528802	4441591		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003402206.1|526615_528802_-	AAA family ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	42.6	1.4e-36
>prophage 38
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	532876	534499	4441591		uncultured_virus(100.0%)	1	NA	NA
WP_003402236.1|532876_534499_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.1	9.3e-155
>prophage 39
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	556882	558277	4441591		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003402301.1|556882_558277_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.1e-47
>prophage 40
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	564156	565980	4441591		Tupanvirus(100.0%)	2	NA	NA
WP_003900153.1|564156_565017_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.1	1.1e-29
WP_003402323.1|565116_565980_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.9	7.1e-29
>prophage 41
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	583617	585737	4441591		Bacillus_phage(100.0%)	2	NA	NA
WP_003402390.1|583617_584850_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-28
WP_003402393.1|585053_585737_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	2.0e-42
>prophage 42
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	594327	599024	4441591		Streptococcus_phage(33.33%)	6	NA	NA
WP_003900159.1|594327_595215_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.0	2.3e-22
WP_003402437.1|595355_595592_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003402602.1|595719_595821_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_003402607.1|595898_597029_+	SDR family oxidoreductase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	27.3	2.4e-08
WP_003898486.1|597035_598112_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003402621.1|598115_599024_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.8	4.9e-28
>prophage 43
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	612990	614301	4441591		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003402810.1|612990_614301_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.8	1.1e-12
>prophage 44
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	625151	626369	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003910801.1|625151_626369_+	AAA family ATPase	NA	V5UPR8	Mycobacterium_phage	32.6	5.7e-32
>prophage 45
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	631576	632617	4441591		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003901872.1|631576_632617_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	9.5e-20
>prophage 46
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	645424	647140	4441591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003402917.1|645424_647140_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	5.4e-28
>prophage 47
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	663778	672723	4441591		Mycobacterium_phage(25.0%)	8	NA	NA
WP_003402992.1|663778_665197_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	24.3	3.1e-13
WP_003402995.1|665331_665598_+	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_003402998.1|665623_667702_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	Q8V6N4	Halorubrum_phage	33.5	2.7e-90
WP_031709257.1|667815_669147_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003898507.1|669370_669712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403006.1|669762_669930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403007.1|670179_671571_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	40.5	2.1e-67
WP_003403008.1|671580_672723_-	CapA family protein	NA	S4VS02	Pandoravirus	50.8	2.1e-92
>prophage 48
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	703361	706338	4441591	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_003403148.1|703361_704123_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	1.7e-34
WP_003403164.1|704179_704491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900184.1|704562_705513_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_003403171.1|705753_706338_+|transposase	IS607-like element IS1536 family transposase	transposase	F9VHY9	Thermus_phage	32.4	7.7e-19
>prophage 49
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	724328	729337	4441591		Virus_Rctr197k(50.0%)	2	NA	NA
WP_003901883.1|724328_726056_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.5	3.8e-21
WP_003905355.1|726052_729337_-	RecBCD enzyme subunit RecB	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.9	1.4e-08
>prophage 50
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	740621	746941	4441591		Tupanvirus(60.0%)	6	NA	NA
WP_003900195.1|740621_741527_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.0	7.7e-26
WP_003403302.1|741591_742473_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.7	3.3e-29
WP_003905358.1|742620_743484_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	31.4	2.2e-30
WP_003403310.1|743650_744511_-	mycolic acid methyltransferase MmaA1	NA	A0A2K9L4K8	Tupanvirus	29.1	7.4e-26
WP_003403314.1|744557_745463_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003403317.1|745474_746941_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	32.1	4.8e-33
>prophage 51
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	756373	757453	4441591		Planktothrix_phage(100.0%)	1	NA	NA
WP_003403363.1|756373_757453_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-22
>prophage 52
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	764663	775407	4441591		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_003910996.1|764663_768182_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	21.8	3.9e-33
WP_031709258.1|768226_772177_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.7	5.5e-52
WP_003900994.1|772173_772548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900995.1|772540_774454_-	neutral ceramidase	NA	NA	NA	NA	NA
WP_003403419.1|774648_775407_+	deoxyribonuclease IV	NA	A0A1V0SID1	Klosneuvirus	28.2	7.9e-16
>prophage 53
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	787343	790870	4441591		Streptococcus_phage(50.0%)	2	NA	NA
WP_003898554.1|787343_789449_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.6	1.0e-60
WP_003403463.1|789679_790870_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.6	3.1e-30
>prophage 54
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	801791	803231	4441591		Catovirus(100.0%)	1	NA	NA
WP_003901900.1|801791_803231_+	mycofactocin system GMC family oxidoreductase MftG	NA	A0A1V0S9J5	Catovirus	25.6	5.6e-10
>prophage 55
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	813604	814504	4441591		Microcystis_virus(100.0%)	1	NA	NA
WP_003403610.1|813604_814504_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	29.0	5.0e-17
>prophage 56
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	825355	826336	4441591		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003403698.1|825355_826336_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.0	9.6e-22
>prophage 57
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	830981	831527	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003403726.1|830981_831527_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	35.1	1.3e-15
>prophage 58
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	856339	862768	4441591		Bacillus_phage(50.0%)	8	NA	NA
WP_003403867.1|856339_857083_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.9e-34
WP_003898576.1|857127_858585_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	5.4e-21
WP_003403876.1|858556_858958_-	HIT family protein	NA	NA	NA	NA	NA
WP_003403880.1|858997_859417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403885.1|859429_860557_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.8e-27
WP_003403887.1|860655_861201_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003403890.1|861203_861410_-	ferredoxin	NA	NA	NA	NA	NA
WP_003898577.1|861412_862768_-	cytochrome P450	NA	M1PWN0	Moumouvirus	23.1	2.4e-07
>prophage 59
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	878073	878967	4441591		Mollivirus(100.0%)	1	NA	NA
WP_003403962.1|878073_878967_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.4	3.2e-40
>prophage 60
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	893776	895037	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|893776_895037_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 61
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	900551	902816	4441591		Microbacterium_phage(100.0%)	1	NA	NA
WP_003404114.1|900551_902816_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
>prophage 62
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	906842	909551	4441591		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003901017.1|906842_908426_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|908456_909551_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
>prophage 63
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	915703	918234	4441591		Bacillus_phage(50.0%)	3	NA	NA
WP_003898599.1|915703_916471_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|916467_917415_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|917457_918234_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
>prophage 64
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	961232	962861	4441591		Acidianus_filamentous_virus(100.0%)	1	NA	NA
WP_003404428.1|961232_962861_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.1	1.0e-15
>prophage 65
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	967021	971015	4441591		Macacine_betaherpesvirus(50.0%)	5	NA	NA
WP_003900223.1|967021_968245_-	resuscitation-promoting factor RpfA	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-98
WP_003404559.1|968692_968971_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003404564.1|968974_970057_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003404566.1|970053_970443_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_003404570.1|970607_971015_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	44.4	1.1e-08
>prophage 66
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	995318	996176	4441591		Pandoravirus(100.0%)	1	NA	NA
WP_031651833.1|995318_996176_-	adenylate/guanylate cyclase domain-containing protein	NA	S4VR00	Pandoravirus	32.6	2.1e-09
>prophage 67
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1014452	1016846	4441591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003898639.1|1014452_1016846_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.5	7.0e-26
>prophage 68
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1024808	1032059	4441591	transposase	Vibrio_phage(25.0%)	7	NA	NA
WP_003404749.1|1024808_1026590_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.1	3.8e-24
WP_003404750.1|1026586_1026844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404754.1|1026932_1027409_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003404756.1|1027405_1027906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404757.1|1028218_1029538_-|transposase	IS256-like element IS1554 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.6	2.9e-29
WP_003404760.1|1029825_1030407_+|transposase	IS607-like element IS1535 family transposase	transposase	F9VHY9	Thermus_phage	33.5	1.4e-23
WP_003905412.1|1030406_1032059_+|transposase	transposase	transposase	M4I0H6	Staphylococcus_phage	23.6	6.0e-08
>prophage 69
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1040638	1051134	4441591		Tupanvirus(20.0%)	8	NA	NA
WP_003404782.1|1040638_1042633_-	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	27.5	1.5e-13
WP_003898652.1|1042654_1043767_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_003898653.1|1043982_1044813_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.9	4.5e-12
WP_003900236.1|1044833_1045958_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	27.0	1.2e-20
WP_003404792.1|1046017_1047034_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003404794.1|1047035_1047941_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003404795.1|1047917_1048739_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	51.5	6.1e-70
WP_003898655.1|1048854_1051134_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.8	5.7e-41
>prophage 70
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1060018	1066770	4441591		Bacillus_phage(50.0%)	7	NA	NA
WP_003404833.1|1060018_1060249_-	mycolyltransferase	NA	A0A2I6B0H1	Macacine_betaherpesvirus	60.4	1.0e-06
WP_003404835.1|1060165_1060360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404838.1|1060364_1060682_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003404859.1|1060978_1063294_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	37.1	2.4e-119
WP_003404862.1|1063374_1064373_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	41.5	8.3e-13
WP_003898659.1|1064682_1065846_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_003900240.1|1065858_1066770_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	29.9	2.0e-13
>prophage 71
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1070279	1072495	4441591		Synechococcus_phage(50.0%)	2	NA	NA
WP_003898661.1|1070279_1070927_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.5	9.5e-18
WP_003404890.1|1070923_1072495_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	41.0	1.5e-53
>prophage 72
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1081461	1083774	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003404941.1|1081461_1083774_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.7e-91
>prophage 73
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1099552	1100239	4441591		Bacillus_phage(100.0%)	1	NA	NA
WP_003916757.1|1099552_1100239_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	8.2e-36
>prophage 74
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1104533	1105280	4441591		Planktothrix_phage(100.0%)	1	NA	NA
WP_003900248.1|1104533_1105280_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-34
>prophage 75
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1112002	1112923	4441591		Bacillus_phage(100.0%)	1	NA	NA
WP_003405145.1|1112002_1112923_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	4.2e-43
>prophage 76
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1119261	1119879	4441591		Pacmanvirus(100.0%)	1	NA	NA
WP_003898684.1|1119261_1119879_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	29.4	3.4e-09
>prophage 77
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1124952	1131910	4441591	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_072433503.1|1124952_1126389_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.3	6.5e-35
WP_003405180.1|1126444_1128148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405183.1|1128174_1129734_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
WP_003405185.1|1129819_1130614_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003405187.1|1130821_1131910_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
>prophage 78
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1138231	1139212	4441591		Hokovirus(100.0%)	1	NA	NA
WP_003405263.1|1138231_1139212_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
>prophage 79
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1147294	1151838	4441591		Streptococcus_phage(50.0%)	5	NA	NA
WP_003901975.1|1147294_1148584_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.6	1.6e-133
WP_003405293.1|1148588_1149275_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003905434.1|1149291_1149759_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_003405299.1|1149749_1150709_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003905437.1|1151157_1151838_-	response regulator	NA	W8CYM9	Bacillus_phage	30.2	2.1e-23
>prophage 80
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1156454	1161467	4441591		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003405320.1|1156454_1158584_+	potassium-transporting ATPase subunit KdpB	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
WP_003405322.1|1158583_1159153_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_003405324.1|1159156_1160686_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003405328.1|1160693_1161467_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
>prophage 81
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1172154	1173402	4441591	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1172154_1173402_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 82
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1179659	1180105	4441591	integrase	Mycobacterium_phage(50.0%)	2	1177950:1177965	1185865:1185880
1177950:1177965	attL	GTGTCCTCGACCAGCG	NA	NA	NA	NA
WP_003905442.1|1179659_1179974_+	hypothetical protein	NA	Q854H9	Mycobacterium_phage	53.6	1.0e-09
WP_072139304.1|1179910_1180105_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1185865:1185880	attR	CGCTGGTCGAGGACAC	NA	NA	NA	NA
>prophage 83
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1183415	1185047	4441591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003405625.1|1183415_1185047_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.6	8.8e-28
>prophage 84
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1204034	1207551	4441591		Streptococcus_phage(50.0%)	3	NA	NA
WP_003405730.1|1204034_1205429_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.6e-57
WP_003901991.1|1205630_1206353_+	RDD family protein	NA	NA	NA	NA	NA
WP_003405736.1|1206384_1207551_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	34.9	2.5e-24
>prophage 85
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1212912	1213701	4441591		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003903314.1|1212912_1213701_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.0	1.2e-14
>prophage 86
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1222887	1226612	4441591		Aeromonas_phage(50.0%)	3	NA	NA
WP_003405797.1|1222887_1224168_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-86
WP_003405801.1|1224272_1225100_+	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003405802.1|1225310_1226612_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.2	1.0e-23
>prophage 87
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1235152	1237769	4441591		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_003405840.1|1235152_1236265_-	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	1.9e-29
WP_003405844.1|1236274_1236532_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003405846.1|1236521_1237769_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.3	7.5e-72
>prophage 88
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1242495	1248460	4441591		Mycobacterium_phage(33.33%)	7	NA	NA
WP_003898733.1|1242495_1243194_+	hypothetical protein	NA	A0A0K2FNG4	Mycobacterium_phage	35.7	1.9e-08
WP_003901093.1|1243311_1243497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651777.1|1243423_1243699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003405871.1|1243941_1244265_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003898734.1|1244279_1245140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898735.1|1246015_1247416_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.6	1.2e-62
WP_003405880.1|1247437_1248460_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	53.4	7.0e-92
>prophage 89
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1252240	1253713	4441591		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003898737.1|1252240_1253713_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	1.4e-69
>prophage 90
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1265313	1266575	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1265313_1266575_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 91
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1274821	1275574	4441591		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003405961.1|1274821_1275574_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	3.7e-05
>prophage 92
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1282570	1283284	4441591		Escherichia_phage(100.0%)	1	NA	NA
WP_003406044.1|1282570_1283284_-	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	33.5	4.4e-16
>prophage 93
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1294731	1296408	4441591		Escherichia_phage(100.0%)	1	NA	NA
WP_003406090.1|1294731_1296408_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.8	1.5e-19
>prophage 94
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1306597	1309168	4441591		Mamastrovirus(100.0%)	1	NA	NA
WP_003406167.1|1306597_1309168_+	FO synthase	NA	A9ZMK9	Mamastrovirus	33.8	3.4e-18
>prophage 95
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1317392	1323650	4441591		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003406192.1|1317392_1323650_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.6	5.7e-27
>prophage 96
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1328199	1329279	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003406195.1|1328199_1329279_-	PE-PPE domain-containing protein	NA	A0A222ZS78	Mycobacterium_phage	36.1	2.4e-18
>prophage 97
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1339461	1340883	4441591		Hepacivirus(100.0%)	1	NA	NA
WP_003905485.1|1339461_1340883_+	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	31.0	5.8e-28
>prophage 98
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1345024	1346272	4441591	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_003901078.1|1345024_1346272_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 99
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1352385	1352949	4441591		Enterococcus_phage(100.0%)	1	NA	NA
WP_003898770.1|1352385_1352949_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	32.1	1.7e-10
>prophage 100
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1365464	1371130	4441591	protease	Staphylococcus_phage(33.33%)	6	NA	NA
WP_003900295.1|1365464_1366400_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.3e-19
WP_003406254.1|1366389_1367028_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911448.1|1367169_1367844_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003406257.1|1368079_1368853_+	ECF RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	9.6e-09
WP_003406258.1|1369010_1369475_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003898779.1|1369543_1371130_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	27.2	8.6e-12
>prophage 101
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1384353	1385535	4441591		Planktothrix_phage(100.0%)	1	NA	NA
WP_003406299.1|1384353_1385535_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.2	6.6e-25
>prophage 102
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1403533	1406373	4441591		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_003898793.1|1403533_1405225_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.0	4.6e-56
WP_003406347.1|1405221_1406373_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	26.8	3.8e-09
>prophage 103
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1417523	1419404	4441591		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003898799.1|1417523_1419404_-	serine/threonine protein kinase	NA	M1HTZ5	Acanthocystis_turfacea_Chlorella_virus	34.1	6.8e-16
>prophage 104
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1423981	1427622	4441591		Bacillus_phage(100.0%)	2	NA	NA
WP_003406569.1|1423981_1425877_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	4.4e-55
WP_003406574.1|1425873_1427622_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	6.7e-42
>prophage 105
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1433633	1438843	4441591		Klosneuvirus(50.0%)	3	NA	NA
WP_003406598.1|1433633_1435220_+	oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	28.0	1.5e-48
WP_003900310.1|1435236_1437012_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_003406602.1|1437004_1438843_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-19
>prophage 106
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1442478	1444323	4441591		Hokovirus(100.0%)	1	NA	NA
WP_003406621.1|1442478_1444323_+	adenylyl-sulfate kinase	NA	A0A1V0SGC3	Hokovirus	25.6	1.1e-34
>prophage 107
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1461071	1461725	4441591		Pandoravirus(100.0%)	1	NA	NA
WP_003898815.1|1461071_1461725_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.5	2.3e-19
>prophage 108
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1480647	1484338	4441591		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_003406857.1|1480647_1481145_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	5.4e-21
WP_003406860.1|1481141_1482632_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003406864.1|1482712_1484338_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.1	2.5e-14
>prophage 109
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1487701	1489405	4441591		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_031709366.1|1487701_1489405_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	2.2e-13
>prophage 110
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1502344	1513337	4441591	protease	Bacillus_phage(20.0%)	13	NA	NA
WP_003901136.1|1502344_1504339_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.2	2.0e-50
WP_003900321.1|1504362_1505709_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	36.3	9.4e-44
WP_003406906.1|1505810_1506116_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003898829.1|1506075_1506732_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003406908.1|1506748_1507783_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_003898830.1|1507790_1508231_+	CysO-cysteine peptidase	NA	NA	NA	NA	NA
WP_003406910.1|1508252_1508534_+	sulfur carrier protein CysO	NA	NA	NA	NA	NA
WP_003406912.1|1508543_1509515_+	O-phosphoserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	37.5	5.9e-48
WP_003898831.1|1509505_1510228_+|protease	rhomboid family intramembrane serine protease	protease	L7RCY0	Acanthamoeba_polyphaga_moumouvirus	31.9	7.1e-06
WP_003406919.1|1510224_1511040_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003406922.1|1511066_1511888_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003406926.1|1511904_1512684_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003406931.1|1512722_1513337_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	30.5	7.6e-09
>prophage 111
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1518196	1523384	4441591		Bacillus_phage(66.67%)	3	NA	NA
WP_003406958.1|1518196_1520776_+	iron ABC transporter ATP-binding protein/permease IrtA	NA	W8CYL7	Bacillus_phage	26.7	4.8e-28
WP_003900322.1|1520772_1522512_+	iron ABC transporter ATP-binding protein/permease IrtB	NA	W8CYL7	Bacillus_phage	25.3	2.6e-22
WP_003406963.1|1522640_1523384_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	3.6e-05
>prophage 112
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1543539	1544590	4441591		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003407164.1|1543539_1544361_+	GTP pyrophosphokinase family protein	NA	A0A142K822	Mycobacterium_phage	51.1	1.7e-48
WP_003907641.1|1544329_1544590_+	hypothetical protein	NA	A0A142K823	Mycobacterium_phage	60.6	8.7e-15
>prophage 113
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1547806	1549068	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|1547806_1549068_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 114
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1569551	1576120	4441591		Abalone_herpesvirus(25.0%)	6	NA	NA
WP_003900331.1|1569551_1570178_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.2	1.1e-15
WP_003407248.1|1570243_1570576_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003898859.1|1570591_1571848_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.7e-37
WP_003900333.1|1571975_1573187_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.4	5.7e-117
WP_003407257.1|1573259_1574738_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003407260.1|1574734_1576120_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	25.6	2.2e-24
>prophage 115
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1580983	1581946	4441591		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003905554.1|1580983_1581946_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	28.3	2.4e-25
>prophage 116
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1590343	1597303	4441591		Staphylococcus_phage(100.0%)	8	NA	NA
WP_003898867.1|1590343_1591363_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	5.8e-38
WP_003407310.1|1591359_1592916_-	MFS transporter	NA	NA	NA	NA	NA
WP_003407315.1|1592921_1593632_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_003407318.1|1593716_1594322_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.1	4.1e-31
WP_071854210.1|1594529_1595051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407330.1|1595040_1595442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407334.1|1595546_1596824_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.4	5.7e-91
WP_003898872.1|1596820_1597303_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.4	3.6e-14
>prophage 117
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1601128	1603059	4441591		Thermobifida_phage(50.0%)	2	NA	NA
WP_003898873.1|1601128_1602034_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	3.3e-08
WP_003407352.1|1602030_1603059_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.8	7.9e-35
>prophage 118
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1606208	1613122	4441591		Mycobacterium_phage(66.67%)	5	NA	NA
WP_003407371.1|1606208_1607471_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	37.4	1.5e-35
WP_003898876.1|1607470_1609078_-	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	5.6e-27
WP_003407374.1|1609081_1609909_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003407376.1|1610027_1611296_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003407378.1|1611535_1613122_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	40.8	2.9e-28
>prophage 119
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1624942	1627243	4441591		Escherichia_phage(100.0%)	1	NA	NA
WP_003902073.1|1624942_1627243_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	31.6	2.4e-71
>prophage 120
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1630572	1632117	4441591		Synechococcus_phage(100.0%)	1	NA	NA
WP_003407443.1|1630572_1632117_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	35.8	1.5e-74
>prophage 121
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1648859	1658850	4441591		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1648859_1649801_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1649956_1651732_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1651779_1652586_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1652582_1655123_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1655119_1656313_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1656309_1657110_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1657111_1658365_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1658361_1658850_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 122
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1662651	1663913	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_151230898.1|1662651_1663913_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	1.1e-81
>prophage 123
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1673959	1683950	4441591		Staphylococcus_phage(20.0%)	8	NA	NA
WP_003901170.1|1673959_1674901_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.0e-17
WP_003407479.1|1675056_1676832_-	membrane protein	NA	NA	NA	NA	NA
WP_003902080.1|1676879_1677686_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003902081.1|1677682_1680223_+	Fe-S cluster assembly protein SufB	NA	A0A2K9VC86	Lactobacillus_phage	22.4	1.8e-11
WP_003407487.1|1680219_1681413_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003902082.1|1681409_1682210_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.9	1.6e-06
WP_003407490.1|1682211_1683465_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.3	6.8e-105
WP_003407491.1|1683461_1683950_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	45.5	4.3e-23
>prophage 124
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1687750	1694335	4441591	transposase	Burkholderia_virus(25.0%)	6	NA	NA
WP_151230898.1|1687750_1689012_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	1.1e-81
WP_003905583.1|1689010_1690987_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1691030_1691405_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1691420_1691792_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1691813_1692671_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1692706_1694335_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 125
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1700469	1701195	4441591		Streptomyces_phage(100.0%)	1	NA	NA
WP_003407525.1|1700469_1701195_+	NlpC/P60 family peptidoglycan endopeptidase RipB	NA	A0A1J0GW44	Streptomyces_phage	36.4	6.7e-12
>prophage 126
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1705490	1706234	4441591		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003898892.1|1705490_1706234_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.6e-08
>prophage 127
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1722900	1723929	4441591		Salmonella_phage(100.0%)	1	NA	NA
WP_003407612.1|1722900_1723929_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	32.2	2.6e-33
>prophage 128
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1731915	1737839	4441591		Synechococcus_phage(25.0%)	6	NA	NA
WP_003407628.1|1731915_1732278_+	hypothetical protein	NA	M4QRT5	Synechococcus_phage	60.0	7.2e-07
WP_003407632.1|1732261_1733143_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003901183.1|1733344_1734643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003407639.1|1735123_1736146_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	54.8	4.0e-103
WP_003407642.1|1736142_1737111_+	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	49.7	1.5e-83
WP_003407647.1|1737107_1737839_+	FkbM family methyltransferase	NA	G8DGX3	Emiliania_huxleyi_virus	28.0	2.1e-05
>prophage 129
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1744351	1746103	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003901187.1|1744351_1746103_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	22.8	8.3e-08
>prophage 130
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1750775	1754110	4441591		Shahe_endorna-like_virus(100.0%)	3	NA	NA
WP_003407671.1|1750775_1752020_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	37.5	2.5e-06
WP_003407672.1|1752066_1752852_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003407676.1|1752829_1754110_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	40.3	7.4e-06
>prophage 131
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1768568	1771694	4441591	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003407714.1|1768568_1771694_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	36.2	1.0e-162
>prophage 132
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1779743	1787482	4441591		Saccharomonospora_phage(50.0%)	4	NA	NA
WP_003407751.1|1779743_1783298_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	60.2	0.0e+00
WP_003903497.1|1783346_1785383_-	PPE family protein	NA	NA	NA	NA	NA
WP_024742859.1|1785539_1786088_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_003917498.1|1786093_1787482_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.1e-39
>prophage 133
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1803689	1808755	4441591		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003407794.1|1803689_1805879_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.4	2.3e-23
WP_003407798.1|1805977_1806670_-	NlpC/P60 family peptidoglycan-binding protein RipD	NA	A0A1J0GW44	Streptomyces_phage	36.5	4.3e-08
WP_003407802.1|1806909_1807194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003407803.1|1807441_1808755_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.2e-13
>prophage 134
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1823698	1824841	4441591		Faustovirus(100.0%)	1	NA	NA
WP_003407947.1|1823698_1824841_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.7e-17
>prophage 135
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1833042	1833861	4441591		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003407990.1|1833042_1833861_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.1	8.0e-30
>prophage 136
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1850982	1856182	4441591		Feldmannia_irregularis_virus(50.0%)	4	NA	NA
WP_003408045.1|1850982_1851600_+	ANTAR domain-containing response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.0	3.9e-05
WP_003408054.1|1851667_1852876_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_003408058.1|1852872_1853364_-	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_003901211.1|1853467_1856182_+	DNA polymerase I	NA	A0A060AFQ3	Listeria_phage	30.6	2.5e-43
>prophage 137
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1865700	1875681	4441591	tRNA	Mycobacterium_phage(25.0%)	6	NA	NA
WP_078387219.1|1865700_1866495_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	67.4	6.2e-11
WP_003408092.1|1866543_1869462_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.8	7.0e-294
WP_003408096.1|1869518_1869776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408099.1|1869791_1871261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003905614.1|1871319_1874838_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	35.8	9.6e-72
WP_003901217.1|1875075_1875681_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	35.3	9.5e-12
>prophage 138
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1881535	1882561	4441591	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003901219.1|1881535_1882561_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	5.1e-26
>prophage 139
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1891546	1892749	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003408163.1|1891546_1892749_+	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	28.2	8.7e-17
>prophage 140
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1898127	1909336	4441591		Paenibacillus_phage(100.0%)	2	NA	NA
WP_003902218.1|1898127_1904508_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.0	1.9e-25
WP_003902217.1|1904527_1909336_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.6	4.1e-25
>prophage 141
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1916400	1918176	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003408257.1|1916400_1918176_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.1e-39
>prophage 142
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1934986	1937710	4441591	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_003898975.1|1934986_1935754_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.9e-21
WP_003408373.1|1935812_1936424_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003408375.1|1936435_1937710_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	37.2	8.0e-61
>prophage 143
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1946662	1949971	4441591		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003408396.1|1946662_1948423_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	1.4e-127
WP_003408399.1|1948415_1949039_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003408401.1|1949035_1949971_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.7e-20
>prophage 144
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1959193	1961675	4441591		Natrialba_phage(50.0%)	3	NA	NA
WP_003898982.1|1959193_1960150_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.4	1.9e-22
WP_003408432.1|1960146_1960983_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003408436.1|1960979_1961675_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	27.2	2.5e-08
>prophage 145
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1974685	1977468	4441591		Pandoravirus(50.0%)	3	NA	NA
WP_003900395.1|1974685_1976071_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1976103_1976673_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1976697_1977468_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
>prophage 146
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1982837	1983470	4441591		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003408506.1|1982837_1983470_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
>prophage 147
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	1991986	1999210	4441591		Tupanvirus(33.33%)	5	NA	NA
WP_003898998.1|1991986_1993687_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1993971_1994373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1994362_1994974_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1995120_1996551_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|1996612_1999210_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
>prophage 148
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2009822	2011894	4441591	transposase,integrase	Burkholderia_virus(100.0%)	2	2000594:2000609	2014610:2014625
2000594:2000609	attL	AACCCGCCGTCGCCGC	NA	NA	NA	NA
WP_087902221.1|2009822_2011084_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|2011654_2011894_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
2014610:2014625	attR	GCGGCGACGGCGGGTT	NA	NA	NA	NA
>prophage 149
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2030251	2035944	4441591		Mycobacterium_phage(100.0%)	2	NA	NA
WP_003899021.1|2030251_2031772_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2031768_2035944_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
>prophage 150
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2046240	2053932	4441591	protease	Mycobacterium_phage(100.0%)	5	NA	NA
WP_003408854.1|2046240_2047998_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
WP_003408859.1|2047994_2049215_+	type VII secretion system ESX-5 subunit EccE5	NA	NA	NA	NA	NA
WP_003408868.1|2049211_2051044_+	type VII secretion system ESX-5 AAA family ATPase EccA5	NA	V5UQM2	Mycobacterium_phage	31.0	3.1e-66
WP_003899024.1|2051670_2051862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901256.1|2051964_2053932_+	PPE family protein PPE28	NA	A0A222ZKN7	Mycobacterium_phage	31.7	2.2e-17
>prophage 151
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2065954	2066659	4441591		Bacillus_virus(100.0%)	1	NA	NA
WP_003899032.1|2065954_2066659_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	3.8e-12
>prophage 152
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2075329	2077249	4441591		Bacillus_virus(100.0%)	1	NA	NA
WP_031709287.1|2075329_2077249_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.2	1.1e-05
>prophage 153
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2088341	2091167	4441591		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003900418.1|2088341_2091167_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	3.0e-257
>prophage 154
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2104723	2107647	4441591		Klosneuvirus(50.0%)	2	NA	NA
WP_003900420.1|2104723_2106160_-	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.1	3.1e-45
WP_025234866.1|2106195_2107647_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	26.6	6.6e-35
>prophage 155
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2119032	2123044	4441591		Planktothrix_phage(50.0%)	4	NA	NA
WP_003899051.1|2119032_2120142_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.0e-19
WP_003409337.1|2120194_2121172_+	alanine and proline-rich secreted protein Apa	NA	NA	NA	NA	NA
WP_003409339.1|2121623_2121929_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003409345.1|2122003_2123044_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	28.9	1.6e-19
>prophage 156
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2135633	2140427	4441591		Bodo_saltans_virus(50.0%)	6	NA	NA
WP_003409385.1|2135633_2136071_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	39.8	5.6e-14
WP_003904723.1|2136143_2136830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899059.1|2136840_2137284_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003910872.1|2137289_2137502_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003409398.1|2137799_2138279_+	bacterioferritin BfrA	NA	NA	NA	NA	NA
WP_003899060.1|2138363_2140427_+	MFS-type transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.5	3.2e-19
>prophage 157
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2146205	2148342	4441591		Macacine_betaherpesvirus(100.0%)	3	NA	NA
WP_003409420.1|2146205_2146736_-	resuscitation-promoting factor RpfC	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	2.7e-95
WP_003899064.1|2146747_2147347_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003409456.1|2147364_2148342_-	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	99.7	1.1e-190
>prophage 158
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2157698	2162804	4441591		Scale_drop_disease_virus(33.33%)	4	NA	NA
WP_003899068.1|2157698_2158775_-	hypothetical protein	NA	A0A0K1L687	Scale_drop_disease_virus	32.5	3.9e-08
WP_003409539.1|2158774_2160163_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_003900426.1|2160191_2161484_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	9.7e-14
WP_031709290.1|2161535_2162804_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	1.8e-12
>prophage 159
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2179333	2180595	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2179333_2180595_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 160
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2189009	2190125	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003409667.1|2189009_2190125_+	lipoprotein	NA	S5Z991	Mycobacterium_phage	29.7	1.9e-18
>prophage 161
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2195392	2196160	4441591		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003409686.1|2195392_2196160_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.9	1.9e-17
>prophage 162
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2203438	2208610	4441591		Synechococcus_phage(50.0%)	4	NA	NA
WP_003409714.1|2203438_2205958_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	34.9	7.7e-07
WP_003902252.1|2205969_2207040_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003409718.1|2207036_2207552_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003899092.1|2207548_2208610_+	riboflavin biosynthesis protein RibA	NA	A0A2H4PQS2	Staphylococcus_phage	33.9	3.1e-34
>prophage 163
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2243657	2244626	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899116.1|2243657_2244626_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.2	2.2e-127
>prophage 164
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2254428	2256744	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899120.1|2254428_2256744_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
>prophage 165
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2267096	2267879	4441591		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003410047.1|2267096_2267879_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
>prophage 166
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2283106	2285833	4441591	transposase	Burkholderia_virus(50.0%)	3	NA	NA
WP_087902221.1|2283106_2284368_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003918359.1|2284445_2284796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410103.1|2284792_2285833_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
>prophage 167
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2290134	2296035	4441591		Gordonia_phage(50.0%)	2	NA	NA
WP_003410136.1|2290134_2291031_-	hypothetical protein	NA	A0A1B3AYM4	Gordonia_phage	34.7	1.8e-35
WP_003900451.1|2291214_2296035_-	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	23.0	6.4e-34
>prophage 168
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2302234	2304726	4441591		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003410178.1|2302234_2304280_-	hypothetical protein	NA	A0A1B1ISB2	uncultured_Mediterranean_phage	26.5	3.7e-07
WP_003410189.1|2304291_2304726_-	Hsp20 family protein	NA	A0A1B2LRT2	Wolbachia_phage	35.0	3.3e-06
>prophage 169
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2308540	2310590	4441591		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003410214.1|2308540_2309515_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	26.5	6.6e-15
WP_003410218.1|2309516_2310590_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.5e-23
>prophage 170
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2315478	2317014	4441591		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_003899145.1|2315478_2317014_-	carboxylesterase/lipase family protein	NA	A0A1S5V000	Saudi_moumouvirus	31.9	3.6e-15
>prophage 171
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2333924	2336549	4441591		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_003902238.1|2333924_2336549_-	apolipoprotein N-acyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.3	1.0e-25
>prophage 172
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2351679	2352603	4441591		Salmonella_phage(100.0%)	1	NA	NA
WP_003410677.1|2351679_2352603_-	class A beta-lactamase BlaA	NA	A0A1B0VBP7	Salmonella_phage	42.2	2.7e-50
>prophage 173
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2359116	2360088	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899159.1|2359116_2360088_-	hypothetical protein	NA	G8I4U5	Mycobacterium_phage	34.9	1.3e-15
>prophage 174
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2370218	2377748	4441591		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003905749.1|2370218_2371988_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.4	6.4e-16
WP_003905750.1|2372004_2373132_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011799244.1|2373180_2374248_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.8	6.1e-14
WP_003410762.1|2374251_2374986_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_003899167.1|2375027_2377748_-	RNA helicase	NA	M1HCW4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.3e-71
>prophage 175
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2385999	2392608	4441591	transposase	Yellowstone_lake_phycodnavirus(50.0%)	6	NA	NA
WP_003899171.1|2385999_2389041_+	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	30.3	1.0e-37
WP_003899172.1|2389033_2389867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003905754.1|2389845_2390280_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003410814.1|2390286_2390541_-	antitoxin	NA	NA	NA	NA	NA
WP_003410816.1|2390556_2390814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2391347_2392608_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 176
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2400276	2402106	4441591		Lymphocystis_disease_virus(100.0%)	1	NA	NA
WP_003411035.1|2400276_2402106_-	proteasome ATPase	NA	Q677Q6	Lymphocystis_disease_virus	39.1	3.5e-33
>prophage 177
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2417029	2418274	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003411091.1|2417029_2418274_-	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	35.5	1.1e-30
>prophage 178
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2462401	2466778	4441591	transposase	Pandoravirus(50.0%)	5	NA	NA
WP_003899202.1|2462401_2463601_+	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	30.0	8.7e-17
WP_003899203.1|2463742_2464408_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003905774.1|2464341_2464524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411323.1|2464792_2466181_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_003411331.1|2466271_2466778_-	polyadenylate-specific 3'-exoribonuclease AS	NA	A0A142UMD2	Mycobacterium_phage	44.0	1.9e-26
>prophage 179
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2472620	2481204	4441591		Catovirus(25.0%)	7	NA	NA
WP_003901348.1|2472620_2474423_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.1e-50
WP_003411369.1|2474453_2475611_-	GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase	NA	NA	NA	NA	NA
WP_003411371.1|2475707_2476481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003411373.1|2476575_2477733_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.6	2.0e-18
WP_003411376.1|2477918_2478170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901350.1|2478279_2480217_+	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	33.9	9.4e-13
WP_003411387.1|2480091_2481204_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	8.6e-43
>prophage 180
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2489400	2491359	4441591		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003411413.1|2489400_2491359_+	asparagine synthase (glutamine-hydrolyzing)	NA	I3UKG6	Ostreococcus_lucimarinus_virus	28.2	7.3e-21
>prophage 181
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2502741	2506105	4441591		Mycoplasma_phage(50.0%)	2	NA	NA
WP_003899220.1|2502741_2504289_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	8.6e-33
WP_003411445.1|2504326_2506105_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	25.9	1.4e-07
>prophage 182
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2526047	2527142	4441591		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003899226.1|2526047_2527142_-	bifunctional RNase H/acid phosphatase	NA	A0A2L0V0T1	Agrobacterium_phage	33.3	1.1e-05
>prophage 183
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2556597	2557683	4441591		Synechococcus_phage(100.0%)	1	NA	NA
WP_003899236.1|2556597_2557683_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.2	2.5e-31
>prophage 184
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2570524	2571394	4441591	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003411681.1|2570524_2571394_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	26.1	2.4e-08
>prophage 185
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2575456	2577115	4441591		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_045245504.1|2575456_2577115_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.5	2.1e-37
>prophage 186
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2592344	2594288	4441591		Catovirus(100.0%)	1	NA	NA
WP_003411855.1|2592344_2594288_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.2	1.0e-107
>prophage 187
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2601789	2606065	4441591	integrase	Mycobacterium_phage(66.67%)	7	2596175:2596188	2607494:2607507
2596175:2596188	attL	TCGAGGTGCGCTCC	NA	NA	NA	NA
WP_003899265.1|2601789_2602221_-	hypothetical protein	NA	A0A076GDT8	Mycobacterium_phage	47.1	2.0e-16
WP_003902166.1|2602313_2602496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902167.1|2602704_2603421_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_003411888.1|2603430_2603763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899267.1|2604128_2604584_-|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	47.2	3.6e-24
WP_003902168.1|2605330_2605618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411901.1|2605720_2606065_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	44.3	7.3e-09
2607494:2607507	attR	GGAGCGCACCTCGA	NA	NA	NA	NA
>prophage 188
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2621091	2623185	4441591		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003411969.1|2621091_2623185_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	1.6e-05
>prophage 189
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2632033	2632966	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003899275.1|2632033_2632966_+	O-acetylserine sulfhydrylase	NA	A0A1X9I5K7	Streptococcus_phage	53.4	2.4e-83
>prophage 190
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2643769	2645689	4441591		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_003412049.1|2643769_2645689_-	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	30.3	1.4e-32
>prophage 191
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2657337	2658598	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|2657337_2658598_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 192
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2663737	2667533	4441591	tRNA	Orpheovirus(50.0%)	5	NA	NA
WP_003412200.1|2663737_2665129_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.4	7.7e-49
WP_003412205.1|2665310_2665718_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003899290.1|2665714_2666107_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003412208.1|2666214_2666643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003412212.1|2666642_2667533_-	decaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	38.3	1.0e-17
>prophage 193
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2672980	2678052	4441591		Pseudomonas_phage(50.0%)	6	NA	NA
WP_003412235.1|2672980_2674039_-	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.1e-47
WP_003902257.1|2674010_2674313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899293.1|2674309_2675623_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003901386.1|2675715_2676003_+	PE family protein	NA	NA	NA	NA	NA
WP_003900509.1|2676101_2676890_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003899294.1|2676903_2678052_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	1.0e-22
>prophage 194
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2681764	2691327	4441591		Tupanvirus(100.0%)	2	NA	NA
WP_003412267.1|2681764_2686150_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	1.8e-51
WP_003899297.1|2686131_2691327_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-82
>prophage 195
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2695657	2699902	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003902259.1|2695657_2699902_-	phenyloxazoline synthase MbtB	NA	A0A2K9KZV5	Tupanvirus	26.1	2.3e-43
>prophage 196
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2707312	2707777	4441591		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003412293.1|2707312_2707777_-	resuscitation-promoting factor RpfD	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	100.0	1.6e-83
>prophage 197
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2717973	2719029	4441591		Bacillus_virus(100.0%)	1	NA	NA
WP_003412325.1|2717973_2719029_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	1.3e-29
>prophage 198
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2725351	2727313	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003900516.1|2725351_2727313_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	8.6e-22
>prophage 199
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2748294	2749542	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412516.1|2748294_2749542_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.7	3.3e-91
>prophage 200
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2760966	2762097	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003412568.1|2760966_2762097_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.0	1.8e-51
>prophage 201
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2769163	2776030	4441591	tRNA	Anguillid_herpesvirus(33.33%)	6	NA	NA
WP_003412592.1|2769163_2769574_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	2.6e-29
WP_003412596.1|2769616_2769988_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_003899324.1|2769984_2771448_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003899325.1|2771444_2774075_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	7.0e-144
WP_003412609.1|2774162_2775422_-	enoyl reductase	NA	NA	NA	NA	NA
WP_003905853.1|2775511_2776030_-	resuscitation-promoting factor rpfE	NA	A0A1J0GVU2	Streptomyces_phage	82.9	2.5e-29
>prophage 202
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2782057	2783338	4441591	protease	Bacillus_virus(100.0%)	1	NA	NA
WP_003412634.1|2782057_2783338_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	4.2e-142
>prophage 203
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2786380	2787624	4441591	protease	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003412648.1|2786380_2787025_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	31.4	5.2e-08
WP_003412650.1|2787021_2787624_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	1.2e-38
>prophage 204
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2790708	2796885	4441591		Bacillus_phage(33.33%)	7	NA	NA
WP_003412657.1|2790708_2791515_-	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	28.9	6.5e-08
WP_003899332.1|2791520_2792009_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_003412664.1|2792110_2792734_-	Rv2466c family mycothiol-dependent reductase	NA	NA	NA	NA	NA
WP_003412666.1|2792835_2795421_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	32.2	3.6e-44
WP_003412669.1|2795493_2795997_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_003412671.1|2795947_2796181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899334.1|2796216_2796885_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.2	1.2e-18
>prophage 205
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2806215	2808479	4441591		Tupanvirus(50.0%)	2	NA	NA
WP_003412708.1|2806215_2807892_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.4e-44
WP_003900529.1|2807972_2808479_-	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	31.2	1.4e-08
>prophage 206
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2815214	2816480	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003902276.1|2815214_2816480_-	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	38.8	2.0e-35
>prophage 207
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2839374	2844086	4441591		Pike_perch_iridovirus(50.0%)	4	NA	NA
WP_003905871.1|2839374_2840964_-	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	1.2e-18
WP_003412782.1|2840960_2841617_-	succinyl-CoA--3-ketoacid CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003412786.1|2841613_2842360_-	succinyl-CoA--3-ketoacid CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003899357.1|2842442_2844086_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	2.1e-29
>prophage 208
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2847977	2852293	4441591	transposase	Klebsiella_phage(33.33%)	3	NA	NA
WP_003412803.1|2847977_2849579_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	38.9	9.7e-64
WP_003899361.1|2849646_2850294_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	40.3	1.0e-24
WP_003901078.1|2851045_2852293_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
>prophage 209
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2872341	2873064	4441591		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003412957.1|2872341_2873064_-	DUF1906 domain-containing protein	NA	A0A2P1JXS5	Rhodococcus_phage	50.7	4.1e-54
>prophage 210
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2885691	2886897	4441591		Pandoravirus(100.0%)	1	NA	NA
WP_003413027.1|2885691_2886897_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.9	1.6e-47
>prophage 211
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2896255	2902414	4441591	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_003902305.1|2896255_2898970_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	34.5	4.8e-63
WP_003413208.1|2899060_2899450_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_003899374.1|2899556_2900231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413213.1|2900315_2901026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899376.1|2901055_2902414_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	2.8e-80
>prophage 212
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2905825	2906818	4441591		Planktothrix_phage(100.0%)	1	NA	NA
WP_003901426.1|2905825_2906818_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	9.4e-33
>prophage 213
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2921822	2922704	4441591		Rhodococcus_phage(100.0%)	1	NA	NA
WP_003899384.1|2921822_2922704_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	48.0	3.2e-53
>prophage 214
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2926122	2946717	4441591	tRNA	Klosneuvirus(22.22%)	14	NA	NA
WP_003413363.1|2926122_2927025_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.0	4.2e-56
WP_003413365.1|2927304_2928576_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	23.1	4.0e-12
WP_003413366.1|2928572_2929247_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.3	6.8e-19
WP_003413367.1|2929297_2930224_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	34.2	2.3e-09
WP_003413368.1|2930309_2932682_-	RelA/SpoT family protein	NA	NA	NA	NA	NA
WP_003413369.1|2932712_2933384_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	32.2	3.1e-11
WP_003413373.1|2933487_2935161_-	lipoprotein	NA	NA	NA	NA	NA
WP_003899387.1|2935166_2936495_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.7	2.9e-21
WP_003413385.1|2936498_2938220_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003413391.1|2938329_2938677_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003413395.1|2938843_2940193_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	5.0e-21
WP_003413409.1|2940354_2943861_+	carboxylic acid reductase	NA	A0A1V0SBX8	Catovirus	21.6	3.9e-17
WP_009940036.1|2944034_2945666_+	PE family protein	NA	NA	NA	NA	NA
WP_003413416.1|2945682_2946717_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	7.0e-07
>prophage 215
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2950871	2952443	4441591		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003899392.1|2950871_2952443_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.2	5.1e-09
>prophage 216
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	2963672	3001946	4441591	terminase,protease,capsid,integrase,head,tRNA	Mycobacterium_phage(30.0%)	47	2992475:2992502	3002099:3002126
WP_003413486.1|2963672_2965751_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2965859_2966087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2966083_2967469_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2967813_2968314_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2968330_2968771_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2968917_2969595_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2969579_2969933_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2969945_2970371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2970367_2971042_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2971119_2971941_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2972076_2972970_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2972972_2973791_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2973805_2974987_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2975045_2975477_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2975990_2977232_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2977541_2977904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2978250_2979375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2979376_2979916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2980055_2981354_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2981392_2981674_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2981818_2982304_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2982330_2982588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2984955_2985198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2985198_2985876_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2986071_2986728_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2986890_2987337_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2987511_2987844_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2987963_2988323_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2988424_2988883_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2989018_2989399_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2989395_2990892_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2991081_2991318_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2991390_2991564_+	hypothetical protein	NA	NA	NA	NA	NA
2992475:2992502	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2992608_2993040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2993036_2994035_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2994048_2994513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2994500_2994752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2994922_2996362_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2996369_2996903_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2997055_2997682_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2997713_2998037_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2998116_2998362_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2998358_2999786_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2999787_3000180_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|3000176_3000437_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|3000453_3000816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|3000818_3001946_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
3002099:3002126	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 217
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3005023	3005782	4441591	protease	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003413845.1|3005023_3005782_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
>prophage 218
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3013816	3015175	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003413871.1|3013816_3015175_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	37.4	2.4e-07
>prophage 219
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3026131	3027037	4441591		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003413913.1|3026131_3027037_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	1.2e-13
>prophage 220
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3034959	3035424	4441591		Streptomyces_phage(100.0%)	1	NA	NA
WP_003413930.1|3034959_3035424_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	47.6	9.4e-28
>prophage 221
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3039111	3057370	4441591		Cyanophage(28.57%)	21	NA	NA
WP_003413944.1|3039111_3040698_+	RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	34.6	4.6e-42
WP_003899440.1|3040734_3041163_+	RidA family protein	NA	NA	NA	NA	NA
WP_003413947.1|3041090_3041480_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_003902340.1|3041476_3041734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413953.1|3041849_3042824_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003899441.1|3042824_3043073_-	DUF3039 domain-containing protein	NA	A0A059VGG3	Mycobacterium_phage	47.5	8.3e-15
WP_003910933.1|3043115_3043553_+	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_003413958.1|3043728_3044700_+	RNA polymerase sigma factor SigB	NA	M4SMP8	Cyanophage	35.7	6.6e-39
WP_003413962.1|3044832_3045525_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003905914.1|3045537_3046596_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_003900556.1|3046708_3048115_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.4e-42
WP_003901455.1|3048332_3049307_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_003900558.1|3049365_3050391_+	alpha/beta hydrolase	NA	G1DAB1	Mycobacterium_virus	30.0	9.7e-17
WP_003413971.1|3050439_3051126_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003900559.1|3051134_3051629_-	FABP family protein	NA	NA	NA	NA	NA
WP_003413973.1|3051680_3052145_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003413974.1|3052307_3052805_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899448.1|3053055_3053766_+	repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	49.2	8.0e-10
WP_003900560.1|3053787_3055887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902343.1|3055902_3056151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413979.1|3056176_3057370_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A1D7XFL1	Escherichia_phage	33.3	8.4e-28
>prophage 222
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3068088	3072692	4441591		Mycobacterium_phage(66.67%)	4	NA	NA
WP_003899455.1|3068088_3068943_+	DUF5131 family protein	NA	A0A088F7U1	Mycobacterium_phage	48.6	1.8e-64
WP_003899456.1|3068827_3069820_-	three-Cys-motif partner protein TcmP	NA	A0A142KCL9	Gordonia_phage	60.3	3.0e-108
WP_003905919.1|3069829_3070354_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003414006.1|3070319_3072692_-	intein-containing recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	50.0	5.2e-21
>prophage 223
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3081122	3083774	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414040.1|3081122_3083774_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	57.9	4.2e-112
>prophage 224
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3088460	3091351	4441591		Rhodococcus_phage(50.0%)	3	NA	NA
WP_003899465.1|3088460_3089213_-	FAD-dependent thymidylate synthase	NA	M9MU99	Rhodococcus_phage	47.4	4.9e-50
WP_003414055.1|3089456_3089732_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003414057.1|3089728_3091351_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	5.9e-08
>prophage 225
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3094397	3095748	4441591		Ralstonia_phage(50.0%)	2	NA	NA
WP_003414073.1|3094397_3094877_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	38.6	6.8e-21
WP_003911953.1|3094947_3095748_-	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	70.5	2.2e-109
>prophage 226
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3110312	3111629	4441591		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_003414119.1|3110312_3111629_-	insulinase family protein	NA	J3IZ03	Acanthamoeba_polyphaga_lentillevirus	24.4	5.4e-28
>prophage 227
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3121469	3123430	4441591	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003899482.1|3121469_3122849_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
WP_003414146.1|3122848_3123430_-|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
>prophage 228
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3141557	3142818	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3141557_3142818_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 229
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3153037	3154120	4441591		Bacillus_virus(100.0%)	1	NA	NA
WP_003414499.1|3153037_3154120_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
>prophage 230
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3160109	3162812	4441591		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003899505.1|3160109_3162812_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
>prophage 231
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3167977	3169570	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003414532.1|3167977_3169570_-	multidrug efflux MFS transporter EfpA	NA	A0A0M3UL24	Mycobacterium_phage	33.0	7.7e-45
>prophage 232
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3180144	3186586	4441591		Erysipelothrix_phage(33.33%)	8	NA	NA
WP_003414557.1|3180144_3181524_+	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.1e-34
WP_003414559.1|3181623_3182742_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003414562.1|3182807_3183140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414566.1|3183151_3183367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099171521.1|3183287_3183470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414570.1|3183522_3184299_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	4.0e-15
WP_003900585.1|3184295_3185663_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003900586.1|3185659_3186586_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	32.5	4.2e-11
>prophage 233
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3209220	3211424	4441591	transposase	Microcystis_virus(50.0%)	2	NA	NA
WP_003901487.1|3209220_3210540_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	29.4	4.1e-28
WP_003899526.1|3210536_3211424_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	27.3	2.6e-10
>prophage 234
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3218385	3219282	4441591		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003414689.1|3218385_3219282_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.9	3.1e-19
>prophage 235
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3227153	3227948	4441591		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003414713.1|3227153_3227948_-	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	26.9	7.1e-07
>prophage 236
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3233329	3249578	4441591		Erythrobacter_phage(20.0%)	11	NA	NA
WP_023644660.1|3233329_3234205_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.9	4.4e-10
WP_003414739.1|3234264_3234852_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899536.1|3234853_3236689_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003900593.1|3236757_3238515_-	serine/threonine protein kinase	NA	A0A0M3SGV8	Mollivirus	23.4	1.3e-05
WP_003899537.1|3238558_3239671_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003414748.1|3239698_3241276_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003414750.1|3241353_3243234_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	41.0	3.9e-88
WP_003899539.1|3243244_3245671_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003414756.1|3245728_3246067_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003899540.1|3246063_3247497_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.8	1.4e-40
WP_003899541.1|3248309_3249578_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.5	1.5e-11
>prophage 237
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3254036	3255987	4441591		Bacillus_phage(50.0%)	2	NA	NA
WP_003414814.1|3254036_3254906_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	25.1	1.1e-13
WP_003414820.1|3255264_3255987_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.4	1.9e-22
>prophage 238
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3266505	3271122	4441591		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003899547.1|3266505_3271122_+	phthiocerol type I polyketide synthase PpsB	NA	D0R7J2	Paenibacillus_phage	36.3	1.1e-32
>prophage 239
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3277685	3283169	4441591		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003899549.1|3277685_3283169_+	phthiocerol type I polyketide synthase PpsD	NA	D0R7J2	Paenibacillus_phage	31.6	3.7e-30
>prophage 240
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3287651	3288647	4441591		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003901496.1|3287651_3288647_+	daunorubicin ABC transporter permease DrrB	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	1.5e-22
>prophage 241
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3291817	3298153	4441591		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003901497.1|3291817_3298153_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.3	9.9e-27
>prophage 242
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3323024	3324844	4441591		uncultured_virus(50.0%)	2	NA	NA
WP_003414906.1|3323024_3323990_-	[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha- L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L- rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase	NA	A0A218MM68	uncultured_virus	25.5	1.5e-06
WP_003899556.1|3324112_3324844_+	[alpha-L-fucopyranosyl-(1->3)-alpha-L- rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase	NA	Q58M88	Prochlorococcus_phage	33.3	1.3e-07
>prophage 243
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3331973	3334260	4441591		Synechococcus_phage(50.0%)	3	NA	NA
WP_003901503.1|3331973_3332906_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	2.1e-10
WP_003414994.1|3333545_3333731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414998.1|3333774_3334260_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	9.3e-18
>prophage 244
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3340017	3342394	4441591		Moumouvirus(50.0%)	2	NA	NA
WP_003415015.1|3340017_3341148_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	34.3	5.0e-30
WP_003415022.1|3341545_3342394_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.6	1.0e-56
>prophage 245
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3347513	3351191	4441591	transposase	Pandoravirus(33.33%)	4	NA	NA
WP_003899565.1|3347513_3348197_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	40.7	3.8e-33
WP_003415034.1|3348229_3349231_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_003415037.1|3349227_3350607_-	resolvase	NA	I4AZM3	Saccharomonospora_phage	32.9	2.3e-21
WP_003415039.1|3350606_3351191_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	29.9	1.1e-17
>prophage 246
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3358733	3359378	4441591		Streptomyces_phage(100.0%)	1	NA	NA
WP_003415107.1|3358733_3359378_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	45.4	2.8e-14
>prophage 247
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3369040	3370627	4441591		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003899578.1|3369040_3370627_-	D-3-phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.5	1.2e-34
>prophage 248
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3374169	3378544	4441591		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_003415160.1|3374169_3374829_+	ABC transporter permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.2	6.9e-08
WP_003899581.1|3375142_3376144_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003415167.1|3376181_3376688_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003415168.1|3376687_3378544_-	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	29.3	9.6e-55
>prophage 249
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3384380	3390178	4441591	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_003415251.1|3384380_3385412_-	ATP-dependent 6-phosphofructokinase	NA	E5EQL4	Micromonas_sp._RCC1109_virus	24.2	2.3e-13
WP_003900613.1|3385507_3386992_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003415256.1|3386988_3387288_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003901515.1|3387372_3388029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003415263.1|3388102_3390178_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	8.3e-108
>prophage 250
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3394162	3401509	4441591	transposase,tRNA	Burkholderia_virus(33.33%)	7	NA	NA
WP_087902221.1|3394162_3395423_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003415342.1|3395477_3395771_-	type VII secretion system protein EsxS	NA	NA	NA	NA	NA
WP_003910692.1|3395817_3397125_-	PPE family protein	NA	NA	NA	NA	NA
WP_003415766.1|3397121_3397436_-	PE family protein	NA	NA	NA	NA	NA
WP_003901078.1|3397817_3399065_-|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003415909.1|3399227_3400331_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003415911.1|3400327_3401509_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.6	1.4e-30
>prophage 251
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3417497	3418361	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003415944.1|3417497_3418361_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.7e-07
>prophage 252
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3422727	3435091	4441591		Mycobacterium_phage(28.57%)	13	NA	NA
WP_003415965.1|3422727_3423768_+	NADP-dependent alcohol dehydrogenase C	NA	A0A2K9L7I1	Tupanvirus	41.2	3.7e-72
WP_003415968.1|3423756_3424131_-	DUF3349 domain-containing protein	NA	NA	NA	NA	NA
WP_003902400.1|3424464_3424749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003415973.1|3424846_3425821_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	85.3	8.0e-154
WP_003899895.1|3425951_3427526_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003415979.1|3427659_3428400_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078387223.1|3428527_3430705_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	8.8e-209
WP_003415981.1|3430674_3431127_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003415982.1|3431161_3431401_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	68.0	3.4e-21
WP_003415983.1|3431863_3432418_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	4.0e-09
WP_003415984.1|3432509_3433124_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899898.1|3433133_3434174_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	31.8	7.1e-15
WP_003415986.1|3434227_3435091_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.2	2.2e-06
>prophage 253
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3456037	3462485	4441591		Tupanvirus(50.0%)	4	NA	NA
WP_003901535.1|3456037_3457849_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	34.8	9.6e-84
WP_003416059.1|3457849_3458251_+	hydrogenase	NA	NA	NA	NA	NA
WP_003416061.1|3458266_3459094_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003899905.1|3459152_3462485_-	serine/threonine-protein kinase PknK	NA	A0A1M7XTW9	Cedratvirus	28.0	3.0e-14
>prophage 254
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3468277	3475595	4441591		Synechococcus_phage(33.33%)	5	NA	NA
WP_003416075.1|3468277_3469384_+	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	2.3e-27
WP_003416076.1|3469421_3470840_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416079.1|3470836_3472261_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003416081.1|3472257_3473769_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.3	5.6e-45
WP_003416086.1|3474707_3475595_+	SPFH domain-containing protein	NA	A0A0M4RAA7	Mycobacterium_phage	50.5	2.8e-68
>prophage 255
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3485797	3487866	4441591		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003416113.1|3485797_3486280_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	1.5e-31
WP_003416117.1|3486282_3487176_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003416120.1|3487176_3487866_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.7	2.5e-32
>prophage 256
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3497256	3500443	4441591	transposase	Vibrio_phage(33.33%)	4	NA	NA
WP_003901545.1|3497256_3497787_+	nucleoside deaminase	NA	A0A2I7QX61	Vibrio_phage	39.0	5.8e-05
WP_003904994.1|3497805_3497949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901078.1|3497948_3499196_+|transposase	IS256-like element IS1081 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
WP_003899922.1|3499273_3500443_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.1	1.6e-10
>prophage 257
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3510450	3511712	4441591	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_087902221.1|3510450_3511712_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 258
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3560237	3561137	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003416610.1|3560237_3561137_-	alpha/beta hydrolase	NA	A0A1C9LZ53	Mycobacterium_phage	31.1	9.8e-05
>prophage 259
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3565838	3570895	4441591	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_003416628.1|3565838_3566699_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	28.6	7.4e-10
WP_071854247.1|3566793_3567189_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003416635.1|3567428_3567722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416640.1|3568009_3569299_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087902221.1|3569633_3570895_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 260
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3576344	3577379	4441591	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003416786.1|3576344_3577379_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.3	7.0e-31
>prophage 261
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3588142	3596070	4441591		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_003416822.1|3588142_3590245_-	ATP-dependent DNA helicase UvrD2	NA	A0A2H4UW05	Bodo_saltans_virus	24.2	4.9e-15
WP_003416827.1|3590368_3590623_+	mycoredoxin Mrx1	NA	NA	NA	NA	NA
WP_003906027.1|3590635_3591577_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003899966.1|3591635_3592703_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_003910809.1|3592764_3596070_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	20.8	1.8e-08
>prophage 262
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3606830	3610526	4441591		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
WP_003416875.1|3606830_3608414_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.9e-46
WP_003416876.1|3608426_3609650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901572.1|3609725_3610526_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.8	1.3e-16
>prophage 263
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3614746	3618585	4441591		Mycobacterium_phage(50.0%)	7	NA	NA
WP_003416884.1|3614746_3615001_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	43.9	8.8e-12
WP_003901574.1|3615062_3616568_-	ATPase	NA	NA	NA	NA	NA
WP_003416887.1|3616584_3616800_-	biotin/lipoyl-binding carrier protein	NA	NA	NA	NA	NA
WP_003416889.1|3617000_3617075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003416891.1|3617084_3617390_-	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_003899976.1|3617386_3617938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003416897.1|3617934_3618585_-	ECF RNA polymerase sigma factor SigH	NA	A0A076YQ50	Rhizobium_phage	26.5	6.8e-08
>prophage 264
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3621597	3622356	4441591		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003416907.1|3621597_3622356_-	SOS response-associated peptidase	NA	B7SYF4	Stenotrophomonas_phage	37.6	1.5e-27
>prophage 265
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3643944	3648682	4441591		Bacillus_phage(66.67%)	4	NA	NA
WP_003906038.1|3643944_3645648_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	2.3e-18
WP_003899985.1|3645697_3646384_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.6e-39
WP_003417036.1|3646453_3647098_-	dTMP kinase	NA	NA	NA	NA	NA
WP_003417039.1|3647194_3648682_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	29.2	1.4e-43
>prophage 266
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3658906	3659176	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003417079.1|3658906_3659176_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	81.2	6.4e-29
>prophage 267
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3663932	3671717	4441591		Sphingomonas_phage(33.33%)	7	NA	NA
WP_003417097.1|3663932_3665012_-	NDP-sugar synthase	NA	H9NC64	Sphingomonas_phage	32.6	2.1e-17
WP_003901582.1|3665013_3665919_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003899993.1|3665929_3666844_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	8.4e-28
WP_003417107.1|3666919_3668416_+	LCP family protein	NA	NA	NA	NA	NA
WP_003417112.1|3668454_3669144_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_003417115.1|3669268_3669550_+	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003899995.1|3669560_3671717_+	manganese-exporting P-type ATPase CtpC	NA	E4ZFI9	Streptococcus_phage	33.5	6.2e-82
>prophage 268
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3677148	3677673	4441591		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003899997.1|3677148_3677673_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	1.1e-21
>prophage 269
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3687068	3690694	4441591		Bacillus_phage(50.0%)	5	NA	NA
WP_003417158.1|3687068_3687854_-	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	33.2	3.6e-19
WP_003417160.1|3687850_3688288_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_003417162.1|3688485_3688899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417165.1|3688933_3689311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900004.1|3689344_3690694_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	45.5	1.1e-111
>prophage 270
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3695674	3700216	4441591		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003901592.1|3695674_3700216_+	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	37.5	2.6e-05
>prophage 271
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3713821	3715426	4441591		Streptococcus_phage(100.0%)	1	NA	NA
WP_003900011.1|3713821_3715426_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	30.1	3.4e-48
>prophage 272
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3721141	3722425	4441591		Geobacillus_virus(100.0%)	1	NA	NA
WP_003900016.1|3721141_3722425_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	43.3	3.8e-79
>prophage 273
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3732953	3824197	4441591	transposase,tRNA	Burkholderia_virus(28.57%)	56	NA	NA
WP_087902221.1|3732953_3734215_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3734508_3734670_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3734691_3736221_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3736153_3737092_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3737100_3738468_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3738536_3739754_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3739849_3741358_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3741354_3742506_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3742696_3743542_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3744016_3744457_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3744490_3745360_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3745380_3746391_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3746675_3747308_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3747374_3748604_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3748886_3750236_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3750247_3751387_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3751383_3752115_+	methyltransferase	NA	NA	NA	NA	NA
WP_085649412.1|3752123_3763193_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3769609_3769867_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3770122_3779596_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3780221_3780668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3780704_3781523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3781739_3782027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3793756_3794551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3794632_3795004_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3794901_3795312_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3795146_3795407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3795521_3795911_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3795924_3796218_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3796214_3797060_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3797183_3797459_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3797455_3797713_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3797754_3798945_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3799061_3799430_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3799426_3799978_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3799984_3800566_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3800546_3800915_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3800892_3801285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3801281_3803912_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3804147_3804612_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3804978_3806754_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3806754_3807399_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3807397_3807832_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3807920_3811160_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_031709368.1|3811351_3812686_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3812727_3813903_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3813956_3814061_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3814139_3814781_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3814781_3815030_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3815034_3816462_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3816569_3817223_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3817261_3818767_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3818771_3819662_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003918607.1|3819670_3821509_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417912.1|3821505_3822495_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_087902221.1|3822936_3824197_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 274
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3833971	3834835	4441591		Tupanvirus(100.0%)	1	NA	NA
WP_003900041.1|3833971_3834835_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
>prophage 275
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3847746	3848985	4441591		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_003902474.1|3847746_3848985_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
>prophage 276
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3853345	3853645	4441591		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_003911013.1|3853345_3853645_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	99.0	1.6e-44
>prophage 277
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3857023	3858613	4441591		Klosneuvirus(100.0%)	1	NA	NA
WP_003901630.1|3857023_3858613_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	6.2e-87
>prophage 278
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3861985	3865683	4441591	tRNA	uncultured_virus(50.0%)	4	NA	NA
WP_003418017.1|3861985_3862294_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
WP_003418021.1|3862365_3863985_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
WP_003418028.1|3864079_3864382_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
WP_003900052.1|3864648_3865683_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
>prophage 279
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3870976	3872826	4441591	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_003418125.1|3870976_3871732_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	30.3	1.5e-22
WP_104591446.1|3871815_3872826_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	7.7e-83
>prophage 280
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3885888	3887763	4441591		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003418289.1|3885888_3887763_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
>prophage 281
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3895400	3899111	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418326.1|3895400_3899111_-	type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
>prophage 282
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3912767	3918017	4441591		Enterobacteria_phage(50.0%)	5	NA	NA
WP_003418607.1|3912767_3913763_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	3.1e-76
WP_003906113.1|3913764_3914373_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	37.8	7.5e-25
WP_003911061.1|3914894_3915851_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003900066.1|3915908_3917003_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	28.0	1.8e-05
WP_003900067.1|3917006_3918017_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.6e-27
>prophage 283
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3930899	3931682	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003418925.1|3930899_3931682_-	DUF2510 domain-containing protein	NA	A0A088F7R2	Mycobacterium_phage	63.2	7.0e-07
>prophage 284
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3965614	3967162	4441591		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003900872.1|3965614_3967162_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	33.3	3.9e-09
>prophage 285
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3974991	3975648	4441591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003902513.1|3974991_3975648_-	fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	1.6e-09
>prophage 286
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	3980945	3982592	4441591		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003911024.1|3980945_3982592_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.6	2.0e-16
>prophage 287
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4003710	4004622	4441591		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_003419251.1|4003710_4004622_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.5	1.7e-36
>prophage 288
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4008180	4009620	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003900090.1|4008180_4009620_+	PPE family protein	NA	A0A222ZKN7	Mycobacterium_phage	31.4	1.5e-23
>prophage 289
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4017502	4018417	4441591		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_003900711.1|4017502_4018417_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.4e-11
>prophage 290
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4022805	4024863	4441591		Synechococcus_phage(100.0%)	1	NA	NA
WP_003901670.1|4022805_4024863_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	C7BUZ5	Synechococcus_phage	36.8	6.3e-07
>prophage 291
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4031757	4033281	4441591		Hepacivirus(100.0%)	1	NA	NA
WP_003900098.1|4031757_4033281_+	3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase	NA	Q75ZG1	Hepacivirus	27.4	3.9e-38
>prophage 292
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4052514	4053924	4441591	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003900108.1|4052514_4053924_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	7.8e-41
>prophage 293
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4065977	4073061	4441591	protease,tRNA	Mycobacterium_virus(25.0%)	5	NA	NA
WP_003419504.1|4065977_4066805_+	hypothetical protein	NA	G8I9P6	Mycobacterium_virus	63.9	2.9e-96
WP_003911027.1|4066851_4068171_-	PE family protein	NA	NA	NA	NA	NA
WP_003419511.1|4068278_4070825_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.7	1.8e-128
WP_003419513.1|4071101_4071440_-	nucleoid-associated protein	NA	A0A2D1GPL8	Mycobacterium_phage	42.4	4.6e-16
WP_003901683.1|4071543_4073061_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	34.5	1.1e-69
>prophage 295
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4147743	4148199	4441591		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003419733.1|4147743_4148199_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	39.6	4.9e-21
>prophage 296
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4151224	4151581	4441591		Tsukamurella_phage(100.0%)	1	NA	NA
WP_003419743.1|4151224_4151581_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	50.0	1.8e-10
>prophage 297
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4157319	4158750	4441591		Mollivirus(100.0%)	1	NA	NA
WP_003419754.1|4157319_4158750_-	cytochrome P450	NA	A0A0M4JJK6	Mollivirus	31.6	2.6e-23
>prophage 298
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4180054	4181065	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003419818.1|4180054_4181065_-	DUF4185 domain-containing protein	NA	B5LJL4	Mycobacterium_phage	31.5	7.9e-11
>prophage 299
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4193760	4196756	4441591		Tupanvirus(50.0%)	2	NA	NA
WP_003420415.1|4193760_4195023_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	34.0	1.4e-36
WP_003420417.1|4195019_4196756_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	1.7e-42
>prophage 300
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4200238	4201240	4441591		Vaccinia_virus(100.0%)	1	NA	NA
WP_003911033.1|4200238_4201240_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q1M1E9	Vaccinia_virus	34.4	1.2e-08
>prophage 301
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4211783	4212860	4441591		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003420435.1|4211783_4212860_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	28.2	2.7e-17
>prophage 302
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4223416	4229731	4441591	integrase	Acidithiobacillus_phage(40.0%)	10	4223433:4223447	4229305:4229319
WP_003899665.1|4223416_4225399_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	8.8e-91
4223433:4223447	attL	CCAGCGGCGCGGCGC	NA	NA	NA	NA
WP_003901716.1|4225465_4225828_+	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR	NA	NA	NA	NA	NA
WP_003899668.1|4225911_4226124_-	DUF2237 family protein	NA	NA	NA	NA	NA
WP_003899670.1|4226196_4226532_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003899671.1|4226749_4227133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899672.1|4227262_4227622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899673.1|4227654_4228164_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	42.6	4.0e-11
WP_003420504.1|4228231_4228624_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	47.0	4.8e-17
WP_071854238.1|4228887_4229115_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	72.4	1.5e-15
WP_003420508.1|4229272_4229731_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.1	2.2e-05
4229305:4229319	attR	CCAGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 303
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4233312	4243005	4441591		Planktothrix_phage(20.0%)	9	NA	NA
WP_003906205.1|4233312_4234443_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.9e-20
WP_003901718.1|4234451_4235399_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003420534.1|4235563_4235866_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003420539.1|4235887_4236943_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003900750.1|4237021_4238902_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.6	7.5e-140
WP_003420544.1|4239072_4239552_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_003906207.1|4239607_4241035_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.3e-06
WP_003420552.1|4241105_4241810_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.9e-35
WP_003901719.1|4242318_4243005_+	hypothetical protein	NA	A0A2P1CG82	Mycobacterium_phage	54.1	4.6e-55
>prophage 304
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4247156	4248218	4441591		Pacmanvirus(100.0%)	1	NA	NA
WP_003420576.1|4247156_4248218_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	4.7e-14
>prophage 305
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4257550	4263530	4441591		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_003420603.1|4257550_4258372_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	5.4e-10
WP_003906213.1|4258368_4259283_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003420610.1|4259279_4260122_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003420612.1|4260277_4261258_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.5	1.2e-32
WP_003420618.1|4262306_4263530_-	peptidoglycan DD-metalloendopeptidase family protein	NA	W8ED04	Mycobacterium_phage	31.4	3.4e-08
>prophage 306
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4293287	4296592	4441591		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_003420779.1|4293287_4294298_-	cutinase family protein	NA	A0A2K9VEH2	Gordonia_phage	28.6	6.9e-07
WP_003420783.1|4294496_4295396_-	MPT51/MPB51 antigen	NA	A0A2I6AZH7	Macacine_betaherpesvirus	38.4	5.1e-46
WP_003900759.1|4295575_4296592_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	1.3e-178
>prophage 307
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4302209	4306351	4441591		Streptococcus_phage(50.0%)	3	NA	NA
WP_003420798.1|4302209_4303409_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.5	8.8e-86
WP_003420801.1|4303672_4304527_+	exported repetitive protein	NA	NA	NA	NA	NA
WP_003420805.1|4304731_4306351_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	39.4	1.1e-06
>prophage 308
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4316654	4317869	4441591		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003899709.1|4316654_4317869_+	PE-PPE domain-containing protein	NA	A0A222ZKN7	Mycobacterium_phage	35.6	3.7e-23
>prophage 309
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4323158	4329539	4441591		Paenibacillus_phage(100.0%)	1	NA	NA
WP_085649413.1|4323158_4329539_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	30.1	4.6e-24
>prophage 310
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4337590	4338850	4441591	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003420889.1|4337590_4338850_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	33.8	7.7e-56
>prophage 311
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4350639	4351263	4441591		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003399735.1|4350639_4351263_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	41.1	1.2e-33
>prophage 312
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4373247	4384997	4441591		Mycobacterium_phage(40.0%)	9	NA	NA
WP_003399850.1|4373247_4374969_+	type VII secretion system ESX-1 AAA family ATPase EccA1	NA	V5UQM2	Mycobacterium_phage	33.2	8.6e-58
WP_003399854.1|4374972_4376415_+	type VII secretion system ESX-1 subunit EccB1	NA	NA	NA	NA	NA
WP_003899738.1|4376414_4378658_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1	NA	A0A142F150	Bacillus_phage	28.6	7.6e-14
WP_003399865.1|4378813_4380589_+	type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1	NA	A0A1P8DJB2	Virus_Rctr71	26.7	1.4e-07
WP_003399870.1|4380731_4381028_+	type VII secretion system ESX-1 target PE35	NA	NA	NA	NA	NA
WP_003399879.1|4381061_4382168_+	type VII secretion system ESX-1 target PPE68	NA	NA	NA	NA	NA
WP_003399940.1|4382260_4382563_+	type VII secretion system ESX-1 WXG100 family target CFP-10	NA	NA	NA	NA	NA
WP_003399963.1|4382595_4382883_+	type VII secretion system ESX-1 WXG100 family target ESAT-6	NA	A0A2I6AZH7	Macacine_betaherpesvirus	100.0	1.4e-45
WP_003909105.1|4382996_4384997_+	type VII secretion system ESX-1 associated protein EspI	NA	V5UPR8	Mycobacterium_phage	28.8	4.4e-21
>prophage 313
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4393439	4400193	4441591	protease	Mycobacterium_phage(100.0%)	4	NA	NA
WP_003400004.1|4393439_4394780_-|protease	type VII secretion system ESX-1 serine protease mycosin MycP1	protease	V5UPA7	Mycobacterium_phage	41.0	1.4e-79
WP_003400005.1|4395001_4396861_-	type VII secretion system ESX-2 AAA family ATPase EccA2	NA	V5UQM2	Mycobacterium_phage	29.3	2.5e-47
WP_031709332.1|4396930_4398544_-	type VII secretion system ESX-2 subunit EccE2	NA	NA	NA	NA	NA
WP_003400012.1|4398540_4400193_-|protease	type VII secretion system ESX-2 serine protease mycosin MycP2	protease	V5UPA7	Mycobacterium_phage	36.6	1.1e-67
>prophage 314
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4410474	4412873	4441591		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031709335.1|4410474_4411962_-	type VII secretion system ESX-2 subunit EccB2	NA	V5UN45	Mycobacterium_phage	37.2	7.6e-71
WP_003899753.1|4411964_4412873_-	transglycosylase	NA	A0A2H4PIU8	Corynebacterium_phage	46.1	2.4e-11
>prophage 315
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4421657	4423100	4441591	tRNA	Mycobacterium_phage(100.0%)	1	NA	NA
WP_003400120.1|4421657_4423100_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	37.3	7.7e-60
>prophage 316
NZ_CP017594	Mycobacterium tuberculosis strain Beijing-like/36918 chromosome, complete genome	4441591	4431753	4437557	4441591		Orpheovirus(25.0%)	6	NA	NA
WP_003900782.1|4431753_4432761_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.2	1.1e-68
WP_003400164.1|4432757_4433108_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.8	3.9e-26
WP_003400168.1|4433217_4434438_+	hydrolase	NA	Q0H257	Geobacillus_phage	29.2	2.6e-08
WP_003400171.1|4434458_4435193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400175.1|4435482_4436517_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_078387225.1|4436513_4437557_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.3	1.4e-23
