The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017354	Lactiplantibacillus plantarum strain TMW 1.25 chromosome, complete genome	3144834	318986	373928	3144834	protease,bacteriocin	Bacillus_virus(50.0%)	56	NA	NA
WP_003643762.1|318986_319550_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003641929.1|319743_320412_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_085764293.1|320569_322075_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|322339_322708_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|322820_323330_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643764.1|323360_324557_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|324666_325137_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|325155_325611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|325714_326287_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_085764294.1|326452_327373_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_047672629.1|327509_328421_+	oxidoreductase	NA	NA	NA	NA	NA
WP_085764295.1|329310_329757_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|329994_331521_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|331521_332493_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_024971425.1|332570_333902_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|334367_335885_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003641944.1|335899_337729_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|337743_338466_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_085764296.1|339052_342736_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_085764297.1|342737_344429_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_063484811.1|344425_345343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|345386_345650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072540096.1|345761_346040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339238.1|346178_346424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151502030.1|346465_346690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339239.1|346818_347211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053339240.1|348838_349102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|349218_349422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646452.1|349546_349786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|349803_350190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157113079.1|351032_351179_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_047672648.1|351255_351663_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_003641957.1|352204_352342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076655685.1|353248_353665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764299.1|353727_353991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057136835.1|354382_354628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|355202_355622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033608295.1|355913_356378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764300.1|356656_357274_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_085764301.1|357277_358432_-	MFS transporter	NA	NA	NA	NA	NA
WP_053566434.1|358435_359227_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_085764302.1|359297_360170_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085764303.1|360329_361145_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_027821507.1|361670_363047_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|363091_364276_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_072533003.1|364616_364817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157113081.1|365006_365180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072533006.1|365773_366442_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_063487606.1|367633_367834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641975.1|367961_368129_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_063487605.1|369475_370222_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643807.1|370353_370503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643808.1|370516_371857_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_085764305.1|371857_372601_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085764306.1|372894_373668_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|373769_373928_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP017354	Lactiplantibacillus plantarum strain TMW 1.25 chromosome, complete genome	3144834	1227784	1235051	3144834		Lactobacillus_phage(100.0%)	7	NA	NA
WP_003643099.1|1227784_1228732_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1229075_1229690_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_063720948.1|1229692_1232131_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_003643095.1|1232218_1232779_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_003643094.1|1232849_1233290_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_052098033.1|1233634_1234102_+	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	99.4	6.1e-83
WP_053566592.1|1234076_1235051_+	hypothetical protein	NA	A0A2P0ZL95	Lactobacillus_phage	90.7	5.0e-31
>prophage 3
NZ_CP017354	Lactiplantibacillus plantarum strain TMW 1.25 chromosome, complete genome	3144834	1735241	1797523	3144834	tRNA,integrase,protease,transposase	Lactobacillus_phage(17.65%)	60	1777731:1777748	1804346:1804363
WP_085764514.1|1735241_1736951_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	1.3e-93
WP_003640703.1|1737118_1738954_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.5e-23
WP_085764515.1|1739117_1740395_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003640705.1|1740391_1740634_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003640706.1|1740657_1741872_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	1.9e-27
WP_085764516.1|1741868_1743395_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.6	7.6e-42
WP_003640708.1|1743437_1743587_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003640709.1|1743618_1744812_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003640710.1|1745227_1746370_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
WP_003640711.1|1746471_1748340_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	7.7e-137
WP_003645970.1|1748383_1748983_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003640713.1|1749003_1750047_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003640714.1|1750437_1751148_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003640715.1|1751148_1752150_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003640716.1|1752162_1753086_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_085764517.1|1753570_1754092_-	shikimate kinase	NA	NA	NA	NA	NA
WP_085764518.1|1754094_1755192_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003640719.1|1755194_1756493_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_024971663.1|1756506_1757034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640721.1|1757042_1758212_-	chorismate synthase	NA	NA	NA	NA	NA
WP_003640722.1|1758204_1759659_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1760306_1760660_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_046947639.1|1760682_1763247_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1763261_1763567_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1763556_1763856_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1763900_1765118_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1765138_1765615_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1765910_1770224_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|1770717_1772427_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|1772466_1773744_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1773781_1774567_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1774582_1775362_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1775481_1776045_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1776046_1776769_-	UMP kinase	NA	NA	NA	NA	NA
WP_003640738.1|1776968_1777847_-	elongation factor Ts	NA	NA	NA	NA	NA
1777731:1777748	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_085764519.1|1777949_1778753_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1778977_1779700_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1779988_1780987_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640742.1|1781071_1781377_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015825656.1|1781360_1782119_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1782230_1782866_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1782923_1783160_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1783257_1783497_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1783648_1784281_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089197934.1|1784370_1784601_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640748.1|1784904_1785534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640749.1|1785583_1786753_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|1786788_1787181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640751.1|1787344_1787737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640752.1|1788182_1789124_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_003640753.1|1789593_1789812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640754.1|1789882_1790134_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_003640755.1|1790355_1790739_+	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	27.4	4.7e-09
WP_085764520.1|1790883_1793010_+	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	25.7	2.2e-15
WP_158070696.1|1793074_1793629_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_003640758.1|1794023_1794245_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.5	1.6e-09
WP_015825666.1|1794412_1794829_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	35.0	9.1e-06
WP_033607682.1|1794888_1795356_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077726998.1|1795603_1795993_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085764521.1|1796359_1797523_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	38.4	1.1e-61
1804346:1804363	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP017354	Lactiplantibacillus plantarum strain TMW 1.25 chromosome, complete genome	3144834	2097747	2158314	3144834	integrase,protease,terminase,transposase,capsid,portal,tail,head	Lactobacillus_phage(34.88%)	76	2141886:2141907	2155657:2155678
WP_024002521.1|2097747_2098131_-	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	62.5	7.6e-15
WP_003641414.1|2098117_2098414_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	4.9e-38
WP_187337988.1|2098414_2099530_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	77.4	2.3e-32
WP_003642832.1|2099708_2100143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642831.1|2100145_2100595_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
WP_085764563.1|2100601_2105830_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	1.8e-143
WP_033608823.1|2105844_2106207_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	71.2	3.3e-44
WP_085764564.1|2106220_2112052_-|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.0	1.0e-219
WP_031275283.1|2112067_2112331_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_033608825.1|2112438_2112837_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.0	6.6e-46
WP_099447638.1|2112936_2113320_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_033608826.1|2113421_2113787_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	54.2	1.8e-29
WP_060417584.1|2113786_2114338_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	6.7e-65
WP_003642822.1|2114339_2114687_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355731.1|2114686_2115019_-|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2115030_2115207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2115219_2116242_-|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_013355732.1|2116261_2116609_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_013355733.1|2116623_2117301_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355734.1|2117473_2117680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2117731_2118010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355736.1|2117984_2119670_-|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_024971552.1|2119816_2120113_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_085764565.1|2120042_2121551_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.8	6.9e-136
WP_033098955.1|2121562_2122801_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	1.9e-139
WP_085764566.1|2122790_2123318_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.1	1.7e-57
WP_085764567.1|2123551_2123767_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	61.2	1.5e-07
WP_085764568.1|2123969_2124581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764569.1|2124552_2125449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096770.1|2126321_2126783_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	6.3e-40
WP_021356389.1|2126860_2127001_-	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	96.3	3.4e-05
WP_071665406.1|2126993_2127374_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_057138635.1|2127370_2127889_-	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	2.9e-54
WP_022638119.1|2127885_2128173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598975.1|2128169_2129078_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_052748123.1|2129157_2130123_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
WP_080392647.1|2130134_2130665_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	58.6	2.3e-54
WP_187337990.1|2130685_2130850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060598973.1|2131169_2131682_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	3.6e-28
WP_003642793.1|2131749_2132055_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|2132066_2132237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101086.1|2132395_2132596_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2132742_2132979_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_013355753.1|2133016_2133331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060598972.1|2133387_2133615_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|2133743_2134106_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_003644968.1|2134117_2134531_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_060598971.1|2134553_2135345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642782.1|2135354_2135609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642781.1|2135688_2136057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642780.1|2136660_2137380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642779.1|2137601_2137883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642778.1|2138157_2138334_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_003642777.1|2138538_2138976_+	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	37.0	7.8e-16
WP_003642776.1|2139023_2139797_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003642775.1|2139899_2141021_+|integrase	tyrosine-type recombinase/integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	1.7e-46
WP_003642774.1|2141372_2141579_-	hypothetical protein	NA	NA	NA	NA	NA
2141886:2141907	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_063487358.1|2141998_2142304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_178138091.1|2142386_2142758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063487356.1|2142915_2143185_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_085764570.1|2144838_2145939_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.9	1.2e-49
WP_061468352.1|2145939_2146140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764571.1|2146093_2147797_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	2.2e-122
WP_062690051.1|2147793_2148267_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_085764572.1|2149041_2149431_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.7	8.8e-19
WP_072535850.1|2149423_2149762_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	7.1e-09
WP_027823040.1|2149748_2149940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072534928.1|2149955_2150435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764573.1|2150580_2151975_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	39.4	4.3e-68
WP_072534925.1|2152772_2152991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640734.1|2153271_2153451_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_072534924.1|2153598_2154243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076633652.1|2154321_2155479_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.3	2.5e-53
WP_003642773.1|2155969_2156203_+	hypothetical protein	NA	NA	NA	NA	NA
2155657:2155678	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_003642772.1|2156227_2156500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764574.1|2156658_2158314_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	3.5e-93
>prophage 5
NZ_CP017354	Lactiplantibacillus plantarum strain TMW 1.25 chromosome, complete genome	3144834	2355182	2363693	3144834		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642593.1|2355182_2355761_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
WP_003642592.1|2355753_2356779_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642591.1|2356775_2358230_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642590.1|2358214_2360434_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	7.7e-144
WP_003644726.1|2360426_2361107_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2361106_2361361_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2361362_2362094_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003644727.1|2362096_2363227_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2363210_2363693_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP017355	Lactiplantibacillus plantarum strain TMW 1.25 plasmid pL125-1, complete sequence	64303	18115	58526	64303	transposase,protease	Streptococcus_phage(25.0%)	41	NA	NA
WP_012695418.1|18115_19141_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.7e-41
WP_012695419.1|19340_19739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042751061.1|19735_20596_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	35.1	2.7e-36
WP_085768500.1|21413_22934_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012695422.1|23696_24689_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	46.9	6.9e-36
WP_042751055.1|24878_25166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042751053.1|25162_25357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042751051.1|25356_25785_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012695424.1|25777_26701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695425.1|26925_27222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039107367.1|27232_27688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039107365.1|27707_28193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695426.1|28182_30168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042751048.1|30222_30447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337992.1|30430_32137_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_012695428.1|32294_33596_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.1	4.6e-80
WP_085764790.1|33588_33783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695429.1|33906_34302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695430.1|34351_34534_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	58.3	3.2e-16
WP_012695431.1|34563_34962_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	47.0	4.6e-23
WP_012695432.1|35117_36353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764789.1|36463_38581_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	25.8	4.6e-29
WP_012695387.1|38582_39365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764788.1|39385_41179_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	35.9	2.9e-93
WP_012695389.1|41244_41568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764787.1|41692_43810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764786.1|43812_44133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042751037.1|44152_44602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176552752.1|44623_45442_+	class A sortase	NA	NA	NA	NA	NA
WP_012695392.1|45467_46361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695393.1|46409_48761_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_042751027.1|49224_50151_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	27.9	6.3e-23
WP_012695396.1|50446_51130_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.6	7.3e-61
WP_012695397.1|51368_52070_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_085764784.1|52073_52574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695398.1|52627_53062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695399.1|54241_55225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695400.1|55540_56158_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.5	1.1e-18
WP_139592727.1|56427_56721_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_157113110.1|56699_57484_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012695406.1|57596_58526_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	1.8e-25
>prophage 1
NZ_CP017356	Lactiplantibacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence	47816	0	13098	47816	transposase	Bacillus_phage(50.0%)	14	NA	NA
WP_085764804.1|577_1996_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_085764805.1|1988_4007_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_085764806.1|4018_4678_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_014216295.1|4646_5009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764807.1|5029_5365_-	CagC family type IV secretion system protein	NA	NA	NA	NA	NA
WP_085764808.1|5366_5972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057138751.1|6007_6319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764809.1|6402_8463_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_021816943.1|8733_8943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764810.1|8962_9247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033609827.1|9262_10153_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.1	9.2e-48
WP_056988825.1|10887_11565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511700.1|11635_11875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764811.1|12168_13098_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	5.2e-25
>prophage 2
NZ_CP017356	Lactiplantibacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence	47816	17125	19265	47816	transposase	Enterococcus_phage(50.0%)	3	NA	NA
WP_013356270.1|17125_17986_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	1.7e-43
WP_048481076.1|17987_18287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085764813.1|18335_19265_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	5.2e-25
>prophage 3
NZ_CP017356	Lactiplantibacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence	47816	30759	34367	47816	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_085764817.1|30759_31347_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	41.1	2.3e-18
WP_076640220.1|31458_31752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016378676.1|32722_32827_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_057800958.1|33065_34367_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.4	1.6e-80
>prophage 4
NZ_CP017356	Lactiplantibacillus plantarum strain TMW 1.25 plasmid pL125-2, complete sequence	47816	37904	42572	47816	holin	Planktothrix_phage(50.0%)	5	NA	NA
WP_057800962.1|37904_38549_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.5e-20
WP_021353390.1|38726_38816_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_076640217.1|38971_40096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564417.1|40099_40315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085764818.1|40436_42572_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.2	8.6e-108
