The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	148924	157300	5427594		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|148924_150232_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|150320_151040_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|151032_151287_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666785.1|151283_151967_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055559.1|151950_154170_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879026.1|154154_155570_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|155675_156716_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|156712_157300_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 2
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	499061	507221	5427594		Bacillus_phage(66.67%)	8	NA	NA
WP_000030268.1|499061_500015_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	4.1e-17
WP_003273797.1|500202_500643_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822580.1|500808_502200_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.1e-34
WP_000565468.1|502211_502889_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.1e-32
WP_000738870.1|503064_504312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277054.1|504445_504976_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.5	2.5e-16
WP_000831286.1|504988_505333_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000487919.1|505769_507221_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.4	5.8e-140
>prophage 3
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	529087	559143	5427594	capsid,terminase,integrase	Bacillus_phage(64.29%)	44	528333:528348	552188:552203
528333:528348	attL	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000645827.1|529087_530140_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948241.1|530258_530603_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|530856_531708_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676798.1|531784_532831_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.3	8.2e-88
WP_000262043.1|532769_533870_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	96.7	1.4e-199
WP_000009558.1|534696_535899_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	43.3	8.0e-87
WP_000511081.1|536241_536586_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_000813894.1|536734_536971_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000277640.1|537003_537192_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
WP_000187072.1|537212_537860_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	86.0	1.9e-98
WP_000788396.1|537919_538075_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	88.2	4.1e-20
WP_000167564.1|538137_538431_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	63.0	1.5e-26
WP_000102854.1|538452_538713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061882.1|538784_539213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000892407.1|539320_539515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148168.1|539593_540529_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.5	5.8e-101
WP_000224586.1|540550_541357_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	66.8	3.1e-95
WP_000040570.1|541528_542332_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	42.8	2.7e-38
WP_003269479.1|542429_543173_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	49.8	1.5e-59
WP_001045406.1|543196_543706_+	YpiB family protein	NA	NA	NA	NA	NA
WP_000049838.1|543718_544144_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	4.1e-30
WP_000323349.1|544159_544828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762586.1|544817_545540_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000778925.1|545549_545972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973815.1|545955_546690_+	sigma-70 family RNA polymerase sigma factor	NA	C7DTL2	Bacillus_phage	51.2	2.1e-58
WP_000433162.1|546922_547087_+	hypothetical protein	NA	W8CYP0	Bacillus_phage	66.7	1.1e-12
WP_000520931.1|547265_547448_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	58.5	2.9e-09
WP_000164425.1|547482_548280_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.7	3.3e-73
WP_001072816.1|548949_549324_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	40.7	6.0e-17
WP_000876114.1|549685_549901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248554.1|550185_550341_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_003269487.1|550426_550609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576172.1|550761_551334_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	2.2e-42
WP_000515245.1|551376_551913_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	56.3	9.5e-40
WP_003311458.1|551878_553342_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	68.9	7.5e-196
552188:552203	attR	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000222862.1|553338_553569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124815.1|553582_553783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467413.1|553840_555964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366284.1|555964_556240_+	DUF2829 domain-containing protein	NA	A0A0A7AQX0	Bacillus_phage	59.0	1.4e-23
WP_003269488.1|556239_556491_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.2	3.3e-19
WP_000668389.1|556490_556751_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.6	4.3e-30
WP_000791085.1|556750_557005_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	85.4	1.4e-38
WP_000917220.1|557088_557937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000501401.1|557952_559143_+|capsid	phage major capsid protein	capsid	A0A1B1IV93	uncultured_Mediterranean_phage	28.2	1.0e-33
>prophage 4
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	563550	573808	5427594	bacteriocin	Bacillus_phage(100.0%)	10	NA	NA
WP_001137510.1|563550_567819_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	36.3	3.2e-138
WP_000392441.1|567870_568101_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_003269494.1|568100_568805_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	84.0	3.8e-113
WP_000494384.1|568931_569330_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000264500.1|570127_570352_-	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_127057661.1|570675_570807_+	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000495115.1|570826_571147_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	98.1	2.1e-50
WP_000511372.1|571157_572324_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	98.5	1.4e-221
WP_000842170.1|572313_572922_+	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	98.5	2.4e-111
WP_000730126.1|572926_573808_-	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	97.3	2.3e-155
>prophage 5
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	1686206	1743630	5427594	terminase,tail,transposase,portal,holin,integrase	Bacillus_phage(69.44%)	75	1681732:1681750	1748517:1748535
1681732:1681750	attL	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
WP_000499525.1|1686206_1687403_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_001190219.1|1687699_1687861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015055111.1|1687844_1689401_+	AAA family ATPase	NA	A7KV18	Bacillus_phage	31.8	2.4e-22
WP_000567354.1|1689414_1689717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421152.1|1689716_1689950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273133.1|1689963_1690599_+	hypothetical protein	NA	A7KV15	Bacillus_phage	34.8	3.2e-26
WP_000334956.1|1690615_1690981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000546453.1|1690980_1692039_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000636793.1|1692035_1692338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137796.1|1692330_1692882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371314.1|1692891_1693410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271401.1|1693493_1695071_+	DEAD/DEAH box helicase family protein	NA	A0A1B0Z0P8	Vibrio_phage	24.2	1.7e-15
WP_000523223.1|1695160_1695403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000191310.1|1695402_1696146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001074794.1|1696165_1699252_+	hypothetical protein	NA	A0A1L4BKL0	Thermus_phage	28.6	8.0e-14
WP_000147936.1|1699275_1701702_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	F8WQ35	Bacillus_phage	23.9	5.1e-32
WP_000532406.1|1701705_1701978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993003.1|1701940_1702198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509446.1|1702223_1702589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001249533.1|1702731_1703055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021290.1|1703051_1703591_+	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	34.2	5.8e-21
WP_000521061.1|1703605_1704382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693593.1|1704551_1704923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391475.1|1704970_1705279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422433.1|1705316_1706297_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.2	5.5e-118
WP_000404006.1|1706538_1707036_+	hypothetical protein	NA	A0A288WFR1	Bacillus_phage	67.4	1.7e-27
WP_000539655.1|1707087_1707255_+	hypothetical protein	NA	A0A0M4RER6	Bacillus_phage	87.3	2.0e-20
WP_000053745.1|1708382_1708793_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	54.2	2.2e-12
WP_001043868.1|1708789_1709443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805617.1|1709564_1709882_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	34.7	1.0e-04
WP_000154978.1|1709898_1710816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790088.1|1710818_1710965_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_001202995.1|1711090_1711312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843025.1|1711308_1711590_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_001294615.1|1711591_1711789_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	44.8	9.5e-06
WP_080546110.1|1711815_1711983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410292.1|1711985_1712510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106358.1|1712506_1712689_+	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	68.0	3.3e-13
WP_000200015.1|1712678_1713005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196741.1|1713265_1713646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873650.1|1714052_1714616_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.3	9.0e-41
WP_001086032.1|1714813_1715242_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_000323341.1|1715258_1716974_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.1	8.0e-149
WP_001265883.1|1716990_1718508_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.5	1.1e-67
WP_003271428.1|1718566_1719346_+	phage scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_001145075.1|1719406_1720531_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027969.1|1720580_1720805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868477.1|1720834_1721176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285263.1|1721180_1721987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954643.1|1721990_1722365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222696.1|1722364_1722724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000930921.1|1722726_1723134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852562.1|1723147_1723654_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000443956.1|1723677_1724037_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	82.9	5.4e-39
WP_000762691.1|1724023_1724239_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	2.3e-29
WP_000818630.1|1724306_1724684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931847.1|1724773_1725028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271441.1|1725064_1728961_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	4.2e-12
WP_000959919.1|1728975_1730472_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	80.4	4.0e-221
WP_001260209.1|1730468_1735448_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	65.6	0.0e+00
WP_000342975.1|1735459_1735840_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_000822841.1|1735939_1736899_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	2.1e-175
WP_000373895.1|1736914_1737340_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	7.0e-70
WP_001216050.1|1737339_1738173_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	88.1	1.9e-148
WP_000370580.1|1738227_1738494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000727572.1|1738603_1738747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230989.1|1738773_1739376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578036.1|1739474_1739711_-	helix-turn-helix transcriptional regulator	NA	Q2I8D9	Bacillus_phage	57.9	9.0e-19
WP_000854597.1|1739867_1739990_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	4.8e-08
WP_000669093.1|1740631_1740832_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	1.1e-12
WP_001247349.1|1741017_1741284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001267622.1|1741283_1741586_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	58.2	8.0e-28
WP_000176361.1|1741582_1741765_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	81.7	1.1e-19
WP_000891521.1|1741880_1743065_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	62.9	2.1e-140
WP_001025807.1|1743006_1743630_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	80.1	2.3e-93
1748517:1748535	attR	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
>prophage 6
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	1780510	1789809	5427594		Bacillus_phage(71.43%)	8	NA	NA
WP_000755523.1|1780510_1781803_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	5.0e-10
WP_000453879.1|1782907_1784668_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.8e-273
WP_015055113.1|1784708_1785386_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.5e-122
WP_001231619.1|1785382_1786456_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	8.8e-186
WP_003270270.1|1786480_1787074_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1787264_1787984_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|1788131_1788803_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_001258527.1|1788936_1789809_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 7
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	2210678	2217759	5427594		Bacillus_phage(50.0%)	9	NA	NA
WP_015055127.1|2210678_2211008_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	45.7	2.6e-16
WP_003269337.1|2211067_2211313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015466.1|2211721_2212219_+	helix-turn-helix domain-containing protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000461733.1|2212924_2213164_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	92.4	1.0e-30
WP_000753400.1|2213160_2214210_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.0	2.4e-188
WP_000384715.1|2214268_2214610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249917.1|2214635_2216126_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	46.7	5.0e-22
WP_001281134.1|2216353_2216590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598277.1|2216976_2217759_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.6	2.2e-21
>prophage 8
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	2443403	2522914	5427594	capsid,terminase,bacteriocin,tail,portal,transposase,protease,integrase	Bacillus_phage(63.64%)	92	2461749:2461784	2523186:2523221
WP_001071355.1|2443403_2443733_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003270601.1|2444216_2444702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736205.1|2445013_2445715_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675858.1|2445753_2446863_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	1.1e-146
WP_000732892.1|2447094_2447568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734558.1|2447801_2448263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197708.1|2448924_2450133_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.2	2.3e-81
WP_000791664.1|2450159_2450315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425257.1|2450575_2450926_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	9.6e-17
WP_001180927.1|2451109_2451406_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	8.2e-09
WP_000522023.1|2451621_2451888_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.0e-35
WP_000390298.1|2451887_2452052_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	1.5e-20
WP_001241129.1|2452081_2452258_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	93.1	6.3e-25
WP_000190250.1|2452262_2452997_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	83.9	1.1e-89
WP_014482038.1|2452965_2453769_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	7.3e-145
WP_000332458.1|2453783_2453978_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	87.5	2.2e-26
WP_000792379.1|2453994_2454405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312979.1|2454437_2454692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482039.1|2454779_2454923_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.3	9.6e-08
WP_001053955.1|2455034_2456471_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_001125966.1|2456717_2457077_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.6e-30
WP_000717823.1|2457094_2457262_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.1e-13
WP_000109538.1|2457287_2457539_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	36.1	6.5e-07
WP_140340092.1|2457651_2458440_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	9.4e-20
WP_000185202.1|2458655_2459444_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	72.3	3.0e-106
WP_000527470.1|2460352_2460712_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_000506751.1|2460859_2461063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133487.1|2461156_2461321_-	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	51.9	2.2e-08
WP_000183173.1|2461423_2461546_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013579.1|2461566_2461755_+	hypothetical protein	NA	NA	NA	NA	NA
2461749:2461784	attL	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
WP_000677277.1|2461853_2462024_+	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	87.5	5.1e-08
WP_001041413.1|2462044_2462515_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	91.0	7.2e-76
WP_001028517.1|2462511_2463054_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	97.2	1.0e-94
WP_000351128.1|2463178_2463835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538961.1|2463818_2464979_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	34.5	1.1e-56
WP_000440224.1|2465411_2466341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453364.1|2466721_2466943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615852.1|2466939_2467269_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	50.0	6.1e-21
WP_000377853.1|2467271_2467580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015467.1|2467887_2468385_+	helix-turn-helix domain-containing protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000988815.1|2468359_2470036_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	7.8e-181
WP_000512879.1|2470052_2471297_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	37.5	6.8e-73
WP_003272656.1|2471313_2471946_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	45.5	1.9e-34
WP_000588590.1|2471959_2473084_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.0	7.2e-98
WP_001282872.1|2473097_2473421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963758.1|2473410_2473767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174092.1|2473753_2474134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111193.1|2474123_2474534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145608.1|2474535_2475105_+	hypothetical protein	NA	Q858W9	Listeria_phage	45.4	3.5e-40
WP_000159510.1|2475166_2475517_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	36.5	1.5e-09
WP_000235149.1|2475699_2479530_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	30.2	5.8e-46
WP_000227695.1|2479522_2480209_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	63.7	2.4e-80
WP_000631955.1|2480205_2482935_+|tail	phage tail protein	tail	A0A1B1P770	Bacillus_phage	50.2	3.6e-236
WP_000387824.1|2482973_2483207_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	95.9	2.7e-15
WP_000499523.1|2483301_2484495_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000461714.1|2484792_2485032_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	1.5e-32
WP_000753418.1|2485028_2486093_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.1	4.2e-196
WP_000459800.1|2486134_2487043_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000998176.1|2487307_2487607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249915.1|2487625_2489035_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	45.8	6.2e-22
WP_000626125.1|2489340_2491023_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_000732186.1|2491229_2491994_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905570.1|2492138_2492555_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878371.1|2492675_2492879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362069.1|2493208_2493421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565693.1|2493630_2494638_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282689.1|2494780_2495185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062121.1|2495344_2496580_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000426103.1|2496991_2498134_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069254.1|2498123_2498756_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2498826_2498982_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2499084_2499582_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168009.1|2499722_2500937_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954443.1|2501046_2501625_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_000766393.1|2501800_2502652_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088549.1|2503074_2504862_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743772.1|2505096_2507223_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000932141.1|2508087_2509266_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	28.3	6.8e-06
WP_000864376.1|2509365_2510046_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038210.1|2510456_2511005_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001182519.1|2511015_2512716_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	6.1e-16
WP_000556364.1|2512708_2513509_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2513645_2513753_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000348328.1|2513854_2515114_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_003270646.1|2515238_2515451_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	71.4	2.0e-17
WP_001109244.1|2516787_2517252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796391.1|2517543_2518008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453678.1|2518589_2518850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453746.1|2518882_2519116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450251.1|2520087_2520468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|2520876_2521629_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|2521618_2522914_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
2523186:2523221	attR	AATATAGTCCGGCTAGAAAACTAGAGGACACCAATT	NA	NA	NA	NA
>prophage 9
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	3570332	3689707	5427594	capsid,portal,bacteriocin,terminase,coat,tail,tRNA,transposase,protease,head,holin,integrase	Bacillus_phage(54.55%)	116	3646447:3646464	3662794:3662811
WP_000878380.1|3570332_3570689_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454956.1|3570722_3572156_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006458.1|3572342_3572534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274919.1|3572754_3573462_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671631.1|3573492_3574902_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.0	7.8e-57
WP_000066296.1|3575093_3576083_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689202.1|3576262_3578104_-	peptidase	NA	NA	NA	NA	NA
WP_000771003.1|3578396_3579194_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	38.6	2.8e-35
WP_000272398.1|3579459_3580797_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791042.1|3581298_3583218_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.3	2.7e-97
WP_001235332.1|3583267_3586051_-	dynamin family protein	NA	NA	NA	NA	NA
WP_000461138.1|3586555_3586741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516464.1|3587019_3588963_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.5e-63
WP_000195993.1|3588971_3591644_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.2	2.3e-33
WP_001288799.1|3591824_3592367_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3592494_3592926_-	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_001005391.1|3592929_3594459_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190159.1|3594887_3595754_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3595740_3597498_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688049.1|3597725_3598649_-	dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3598708_3598969_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3599118_3599913_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099769.1|3600075_3601641_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283854.1|3602123_3603155_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.8	1.9e-137
WP_000990687.1|3603299_3604538_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3604558_3605137_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137473.1|3605201_3606113_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3606134_3606920_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3607058_3607307_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759628.1|3607382_3608096_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411974.1|3608196_3609483_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.0e-10
WP_000772415.1|3609483_3610758_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	3.5e-56
WP_000008857.1|3610966_3611926_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3611926_3612985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456926.1|3612977_3614510_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	6.3e-12
WP_000725769.1|3614628_3615714_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3615806_3616532_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118792.1|3617070_3619452_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3619664_3619868_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_000139807.1|3619864_3620614_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823071.1|3620717_3622388_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3623313_3624192_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3624203_3625436_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3625459_3626506_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001238645.1|3626656_3626833_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000459793.1|3626947_3627892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249941.1|3628377_3629295_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.2	7.1e-19
WP_000069067.1|3629317_3629818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014482108.1|3629796_3629949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022083.1|3630083_3630473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540624.1|3630600_3631410_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	82.9	9.1e-135
WP_001261076.1|3631409_3631646_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_000499523.1|3631933_3633127_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000342979.1|3633259_3633628_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.7e-32
WP_001260192.1|3633639_3638025_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	53.6	0.0e+00
WP_000094125.1|3638021_3639479_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.9	2.3e-173
WP_000897025.1|3639520_3643147_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.5	1.9e-184
WP_000415912.1|3643379_3643742_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_001004907.1|3643746_3644334_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3644334_3644670_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_001279008.1|3644666_3645011_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	7.0e-44
WP_001247272.1|3645012_3645363_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	1.3e-53
WP_001243203.1|3645364_3645661_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.5	9.5e-42
WP_000234856.1|3645673_3646837_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	5.5e-210
3646447:3646464	attL	AAATAAACTTCGTAACTG	NA	NA	NA	NA
WP_000216400.1|3646856_3647633_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	1.5e-57
WP_015406504.1|3647616_3648723_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	9.0e-186
WP_000615661.1|3648788_3650447_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	1.1e-256
WP_000124844.1|3650443_3650779_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	1.7e-07
WP_001258474.1|3650931_3651273_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.6	1.1e-54
WP_000049336.1|3651253_3651667_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	52.5	1.1e-30
WP_000196709.1|3651680_3651902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000333210.1|3651894_3652062_-	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	67.3	8.1e-14
WP_015055180.1|3652156_3652351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482109.1|3652518_3652686_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	76.4	1.7e-19
WP_000930972.1|3653164_3653383_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_001170299.1|3653805_3654756_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001012136.1|3654969_3655512_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.1e-87
WP_000166167.1|3655511_3655994_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.6	2.1e-70
WP_000866139.1|3656021_3656192_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	73.2	6.1e-09
WP_001061238.1|3656296_3656428_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	83.7	4.5e-12
WP_001141572.1|3656664_3656880_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.3	7.7e-25
WP_000032817.1|3657141_3658233_+	hypothetical protein	NA	A0A285PWR0	Cedratvirus	62.6	3.7e-38
WP_001151791.1|3658989_3659211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000512858.1|3659246_3659438_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	65.1	8.3e-15
WP_001126000.1|3659511_3659874_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	2.4e-55
WP_000926801.1|3659848_3660037_-	hypothetical protein	NA	D2XR45	Bacillus_phage	80.0	5.3e-14
WP_000063842.1|3660039_3661362_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	94.8	1.9e-235
WP_000312138.1|3661358_3662306_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.9	1.2e-74
WP_000998232.1|3662585_3662870_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	2.5e-23
3662794:3662811	attR	CAGTTACGAAGTTTATTT	NA	NA	NA	NA
WP_000215311.1|3663050_3663272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537278.1|3663285_3663873_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	8.4e-74
WP_001141264.1|3663963_3664212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001036233.1|3664244_3664436_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000900759.1|3664608_3665046_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	7.0e-33
WP_000403118.1|3665058_3665487_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	80.3	7.1e-62
WP_000202384.1|3665570_3666383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661246.1|3666440_3667436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949469.1|3667419_3667587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844785.1|3667757_3669305_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	1.0e-142
WP_000954735.1|3669759_3670662_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3670831_3671083_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593001.1|3671218_3672460_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868222.1|3672547_3673447_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076745.1|3673599_3675738_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3675898_3676168_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3676268_3677240_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399362.1|3677283_3678207_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3678293_3678650_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000634350.1|3678665_3678947_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036347.1|3678943_3681010_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	1.9e-19
WP_001286522.1|3681014_3681326_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071125.1|3681326_3681599_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102598.1|3681610_3682717_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359095.1|3682734_3683205_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060002.1|3683538_3687840_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814316.1|3688006_3689707_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	4376504	4384187	5427594		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221100.1|4376504_4377428_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4377554_4378490_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4378491_4379184_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001293585.1|4379352_4379526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4379526_4379721_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255968.1|4379761_4380961_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	5.6e-72
WP_000587824.1|4381255_4381579_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4381647_4382412_-	class B sortase	NA	NA	NA	NA	NA
WP_000403738.1|4382443_4383214_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.3e-13
WP_001036824.1|4383203_4384187_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 11
NZ_CP021061	Bacillus thuringiensis strain ATCC 10792 chromosome, complete genome	5427594	4732357	4820904	5427594	tRNA,capsid,portal,plate,terminase,coat,tail,transposase,protease,head,holin,integrase	Bacillus_phage(67.86%)	98	4726917:4726940	4822918:4822941
4726917:4726940	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|4732357_4733734_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140612.1|4733773_4734157_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|4734252_4734996_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|4735046_4735640_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757822.1|4735685_4736573_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	1.2e-79
WP_001104228.1|4736680_4738405_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	3.5e-176
WP_000545250.1|4738548_4739154_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_001028674.1|4739567_4740821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537660.1|4740836_4741259_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|4741270_4741615_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001206693.1|4741717_4742605_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000487953.1|4742779_4744264_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.9e-58
WP_002094181.1|4744409_4745036_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|4745121_4745439_-	YuiB family protein	NA	NA	NA	NA	NA
WP_000517993.1|4745435_4745942_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856603.1|4746259_4747468_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829790.1|4747930_4748920_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000815781.1|4749033_4759221_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000606660.1|4759685_4760165_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|4760383_4761631_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535246.1|4761648_4762530_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000635489.1|4762610_4763072_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710531.1|4763394_4764222_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4764231_4764852_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891536.1|4764793_4765975_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000170777.1|4766090_4766273_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4766269_4766587_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4766769_4766967_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4766975_4767155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043397.1|4767160_4767739_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_000119483.1|4767792_4768131_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000405778.1|4768676_4769378_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000373913.1|4769377_4769803_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|4769878_4770103_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_001243323.1|4770253_4771429_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	80.4	4.6e-172
WP_000631942.1|4771443_4773786_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	95.3	0.0e+00
WP_000884123.1|4773782_4774466_-|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_001119327.1|4774466_4777859_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.1	0.0e+00
WP_000113340.1|4778102_4778489_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000151366.1|4778500_4779136_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|4779147_4779525_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|4779524_4779854_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126092.1|4779843_4780176_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	96.4	1.6e-53
WP_000342229.1|4780153_4780414_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
WP_001049344.1|4780415_4781720_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000687903.1|4781721_4782303_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_000603760.1|4782373_4782631_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000524246.1|4782799_4783972_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000587611.1|4783987_4785712_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_000113444.1|4785708_4786134_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000872554.1|4786216_4786609_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.9e-72
WP_000627440.1|4786605_4786920_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	1.4e-46
WP_000074276.1|4786916_4787135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052395.1|4787181_4787379_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.3e-23
WP_000930965.1|4787436_4787661_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|4787945_4788335_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_102981940.1|4788352_4788451_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|4788618_4788804_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_001092478.1|4788851_4789139_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000726820.1|4789364_4789763_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_000159772.1|4789847_4790594_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000002743.1|4790590_4790815_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_000532218.1|4790814_4791696_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000040038.1|4791707_4792481_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000525424.1|4792613_4793495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372558.1|4793518_4794193_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000277642.1|4794406_4794595_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000368215.1|4794739_4794985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|4795366_4796596_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000004989.1|4796965_4797295_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_001233256.1|4797569_4797719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466634.1|4797715_4798969_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000237488.1|4800310_4801372_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833148.1|4801461_4801815_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|4801921_4802107_-	methyltransferase	NA	NA	NA	NA	NA
WP_000834607.1|4802510_4803281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068189.1|4804193_4804757_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573830.1|4804862_4805216_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|4805257_4806124_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4806370_4806610_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|4806962_4808033_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|4808266_4808440_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470295.1|4808495_4809155_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	2.9e-22
WP_000679257.1|4809138_4809936_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212735.1|4810177_4810519_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_024927875.1|4810678_4810960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272364.1|4811029_4811827_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_001019404.1|4812153_4812831_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003272363.1|4812929_4813724_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4813776_4814085_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4814280_4814517_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4814836_4815052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|4815113_4816115_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4816235_4816727_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351152.1|4816750_4817230_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106075.1|4817391_4818495_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856291.1|4818439_4819786_+	phosphoribosyltransferase family protein	NA	NA	NA	NA	NA
WP_000241506.1|4819791_4820904_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
4822918:4822941	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	0	4801	584623		Bacillus_phage(100.0%)	6	NA	NA
WP_001031160.1|362_518_-	type A lantibiotic	NA	NA	NA	NA	NA
WP_001031160.1|879_1035_-	type A lantibiotic	NA	NA	NA	NA	NA
WP_000356689.1|1406_1562_-	type A lantibiotic	NA	NA	NA	NA	NA
WP_001031158.1|1841_1997_-	type A lantibiotic	NA	NA	NA	NA	NA
WP_001031159.1|2392_2548_-	type A lantibiotic	NA	NA	NA	NA	NA
WP_000688777.1|3151_4801_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	25.3	6.0e-08
>prophage 2
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	20809	22606	584623		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003275463.1|20809_22606_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
>prophage 3
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	26419	27799	584623		Erwinia_phage(100.0%)	1	NA	NA
WP_000586226.1|26419_27799_-	SPASM domain-containing protein	NA	A0A1B2IA90	Erwinia_phage	25.7	9.4e-07
>prophage 4
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	34408	39439	584623		Pseudomonas_phage(100.0%)	2	NA	NA
WP_001220498.1|34408_36283_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.9	4.1e-37
WP_001245659.1|37615_39439_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.4	1.7e-24
>prophage 5
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	49165	51203	584623	transposase	Lactococcus_phage(100.0%)	2	NA	NA
WP_000798699.1|49165_49918_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|49907_51203_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 6
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	71161	77544	584623		Lactobacillus_phage(25.0%)	6	NA	NA
WP_000523816.1|71161_72463_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	54.9	9.9e-91
WP_000682212.1|73901_74201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522796.1|74332_74962_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	58.9	1.9e-47
WP_000441087.1|75102_75489_+	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	43.2	3.8e-22
WP_000218075.1|75548_75887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003273897.1|77001_77544_+	DUF2321 domain-containing protein	NA	U3PDZ3	Staphylococcus_phage	36.7	3.0e-25
>prophage 7
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	84205	84724	584623		Bacillus_phage(100.0%)	1	NA	NA
WP_000516002.1|84205_84724_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	78.6	1.3e-49
>prophage 8
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	94676	96509	584623		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000914973.1|94676_96509_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.3	5.4e-34
>prophage 9
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	103394	111740	584623		Pseudomonas_phage(75.0%)	5	NA	NA
WP_000108316.1|103394_105200_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_003275463.1|106255_108052_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
WP_021036198.1|108120_108312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149932.1|108887_110711_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.3	5.6e-23
WP_080546731.1|110843_111740_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	2.7e-15
>prophage 10
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	130455	131838	584623		Streptococcus_phage(100.0%)	1	NA	NA
WP_000789406.1|130455_131838_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	2.0e-20
>prophage 11
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	141790	143056	584623		Bacillus_phage(100.0%)	1	NA	NA
WP_000272579.1|141790_143056_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.5	5.4e-102
>prophage 12
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	150230	151400	584623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003291652.1|150230_151400_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.7	2.5e-24
>prophage 13
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	155407	156715	584623		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000169374.1|155407_156715_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
>prophage 14
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	161398	162553	584623		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000957741.1|161398_162553_+	serine hydrolase	NA	A0A0B5A4V6	Mycobacterium_phage	28.4	6.7e-06
>prophage 15
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	169215	170052	584623		Bacillus_phage(50.0%)	2	NA	NA
WP_001043937.1|169215_169380_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.9	3.0e-05
WP_000843063.1|169773_170052_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	1.1e-12
>prophage 16
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	173312	264408	584623	integrase,coat,transposase	Bacillus_phage(33.33%)	63	244827:244886	264403:266585
WP_000499523.1|173312_174506_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000425967.1|175362_175515_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_015406689.1|175560_176682_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	3.1e-173
WP_003275049.1|176885_177881_-	EamA family transporter	NA	NA	NA	NA	NA
WP_024927975.1|178400_179078_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000739341.1|179155_180127_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003275044.1|180314_181259_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001031866.1|181251_182487_+	MFS transporter	NA	NA	NA	NA	NA
WP_000965796.1|182721_185247_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_021036244.1|185243_193844_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	1.6e-152
WP_015406688.1|193926_197283_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	1.4e-109
WP_087976703.1|197349_201480_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.4	3.2e-119
WP_001060110.1|201500_202265_+	thioesterase	NA	NA	NA	NA	NA
WP_003275505.1|202320_202527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033795061.1|202495_202753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080546721.1|202777_203038_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_000930878.1|203069_203831_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000580988.1|203909_204893_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	35.9	3.9e-47
WP_000923754.1|204926_205946_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_000262414.1|206109_206835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349521.1|207335_207854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043948.1|208420_208693_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.7	4.1e-23
WP_000843062.1|210188_210314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024927939.1|210408_211512_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_000684272.1|211665_212802_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000393191.1|212826_213885_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_000093657.1|213886_214303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087976704.1|214392_215115_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000686380.1|215579_216770_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000699352.1|216773_217727_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	33.0	3.9e-36
WP_000686565.1|217723_219013_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	1.1e-76
WP_000591180.1|219210_220032_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.0	1.2e-54
WP_000411727.1|220656_222150_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.5	8.7e-83
WP_015406684.1|222376_223363_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000661234.1|223570_224962_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.5	5.3e-26
WP_000151801.1|225072_225978_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001037515.1|226832_227597_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	5.2e-23
WP_000919892.1|227914_228343_+	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_000805584.1|228964_229459_-	DUF3902 family protein	NA	NA	NA	NA	NA
WP_015406683.1|230410_231532_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	3.1e-173
WP_000221984.1|232412_233486_+	patatin-like phospholipase family protein	NA	A0A1X7C039	Faustovirus	28.0	1.6e-30
WP_000815612.1|233652_233805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003275351.1|234615_236478_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000390343.1|238701_239256_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	29.6	3.2e-06
WP_000914416.1|239688_239982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000888608.1|240906_241074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003275360.1|241708_243274_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	4.4e-37
244827:244886	attL	GTGTAAATGTCAAGATAAACATGTACATTTTCGCTTGTTTAAGCATGTACAAAATCAATC	NA	NA	NA	NA
WP_000798699.1|244880_245633_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|245622_246918_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000189815.1|247258_248275_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001060959.1|248678_249851_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	5.2e-06
WP_003275498.1|251499_253242_+	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	28.4	1.2e-11
WP_000358798.1|253920_254064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015406678.1|254454_254856_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.2	5.8e-50
WP_015406677.1|254861_255941_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.3	4.2e-18
WP_000531388.1|256364_257330_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	57.8	3.1e-89
WP_001099187.1|257634_257805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573035.1|257938_258172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089897.1|258361_259729_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	26.0	4.8e-19
WP_000233374.1|260210_260564_+	DUF4360 domain-containing protein	NA	NA	NA	NA	NA
WP_000505353.1|260837_261680_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000275580.1|262370_263666_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|263655_264408_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
264403:266585	attR	GATTGATTTTGTACATGCTTAAACAAGCGAAAATGTACATGTTTATCTTGACATTTACACTAGTTTTAATCCAATTATAAACAGTAGTCTGGAGAATATGATGGAAAACGGTTGTATTCCAGGATGGATTAGAGGAGATGGTACTAGTTGAAGTTCTAACGGCTTATGAATGAAGGGTTTACGGGCTATTCTTCGCTTGTATTAGAACATAGTCAATAATGGTGGTACAGAAGTTGGATGTTACACTTTAATTTGTAAATGAAAATAAAATATAGACTATGCCCCGAAATTACATGTATCTCGGCTGAACTTCATTGAAGGGGTGAGAGATTTATCTGTAAAAAATCTACAAAACAGAAACCTCTCAAAAATGAGAGGTTTCTGTTTGTTAATTTTAATATCACGCCCTAATCTTTTACATCTTCTCTAAATCCTCTCGAGTTATAAAGCTACCAATACTTACTTTCTTTTCTGTAGTAATGTCTGTATTGAATGCGTGCATCAAAATTTCAGACAGAGGTGTTGAATCTGTATCATACGCATAGCCAAGACTATGATGGTTAAGTACACTATTGGGAGTAACACTGTTCCCCCAAGGTTTCATTGGATCATTTAAATTATGACCTGTTGGCCCTACTTCACTACCAGTTCCAGTAGGATGATACCCTTCATTTGGATTAGCAACCTGCCATTGAGCCCATAGACGATCAACATTTGCATGATGTAAGAAAAAGACAGGATCATTCGGTGAGCTCATCCAATACATAGACCCTTGTGTAGCACCAGCTATCCATAAATGTACCTGATTATGAATTCTGCCATCTCCATACCAACCTTCAAGTCGGTTACAAAAACTTGGTTTCGTTACAGTCATACTTGAAGGATTGTTTAAATCCTGGAATGCACGCCAAGGAGAAACATAATATGGTGTTTCTAATAAGCAATTTTGCACCTCTGAATTTGTTGGAAGATTAATCAAAATAGTAGCTCCCGAGCTATTTTTTAAAGTCCCAAACTGACGGCGTAATCGAATATCTTGAGGCTCGTCTGAATGGTGGTCATCAAAAAGAGTTAGTTTCCAATTATCACCTGTGAATGGGCCTGTTGTGACAGCATAACCTTGATTAGGATCACCATCACCTCCCATAAAATCATTAGTCCATGGACTCCCTGGAACTGACGGATCAGTAGAGTTATTAACTGTCCAATCCCAATAGGGAAGTGTGACAGTAGAATCGATTTGTTGCAAATCTAATTCCAATTGATTTATAAAATATCGATGCCAAGGTAAAAATGCAGGACCTCCATGAGCAGATCCTGGTTTAGTTGATGTTTGATCCATCATTGACATCAAATGCCAATAAACATAATCATCATAGCGACTTGTACTCCCCAAAGAGCTTGGTAAACGACTTGGTCTACGCTTTAATTCTAATAATGCATTAGTAAATGCTAACCTTTCATTATGTGTTAGATTAGCTTGATTTTTTCTAATTCTCATAAATATACCTCTTTTAATTATAATATTTTATAATTTTAGAGTTTCCATTGTACAATTGTTTATCCTCAATTGTTTATTATCAATAAGAATATTTAAATTTCCTTATCAAGACTAATAAAATATGACACCAATGGTTCATGTATTTTTTTGATATGATTAATTTTTACGATTTTAGCTATATCAAAAAGTATAAATATCGACAAAATTAAAAAGAATTTTATAGATAAAGAAAAAGAGTTTAATGATAATAAACTGGTATTTAACACTTCGGTTTACATTTTAAGGTGCGAGATGCTGCAGCTTAAACTACCATATAAATTTAGAAGAAGTTGAACAAGAAGTATTAGAAATTCGTTCATTCATATTACTCATAAATGAAGCAAGTACTGAAATATTTATACGTATAATTCATCTAATCTTCAAAAATAAAAATTTGAGGGATTTTTATTTAAAGGTTTTTCTTCTTTCAAATGTATTTATTTGATTTAACATAAAATTAAACGGGTACAAATCTGTAGCTATAAAAAAATTACAGTTTAGACTTTCATGTCCGTGTACACCACAAGATAGGAGGGGAGTTAACTATGTATTTTTTTATATGGATTAGTGCTATATGCCAATCAAATTAAGATATTATAATACTCACATAACGAAAATTAATTGCATGATGTTCCATTTAAAG	NA	NA	NA	NA
>prophage 17
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	275122	276850	584623		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000422018.1|275122_276850_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	83.3	1.1e-07
>prophage 18
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	283946	284150	584623		Lactococcus_phage(100.0%)	1	NA	NA
WP_000410775.1|283946_284150_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	1.5e-17
>prophage 19
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	297900	307593	584623		Staphylococcus_phage(20.0%)	7	NA	NA
WP_000681839.1|297900_298986_+	phosphodiester glycosidase family protein	NA	A0A1X9I9K5	Staphylococcus_phage	27.6	3.9e-08
WP_000793516.1|299426_300260_-	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	47.8	1.4e-29
WP_000283089.1|300806_302576_+	peptidoglycan-binding protein	NA	A0A2L0HNW5	Microbacterium_phage	27.0	1.2e-06
WP_000568374.1|302644_303691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164948.1|303984_304926_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	31.6	5.4e-14
WP_001144501.1|305436_306084_-	YukJ family protein	NA	NA	NA	NA	NA
WP_000081358.1|306639_307593_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	57.0	4.0e-89
>prophage 20
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	315871	321238	584623		Bacillus_phage(50.0%)	4	NA	NA
WP_000193668.1|315871_316852_-	alpha/beta hydrolase	NA	A0A1M7XTX4	Cedratvirus	33.3	2.7e-08
WP_000621314.1|317033_318401_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	44.2	7.0e-63
WP_001142153.1|318397_319072_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	57.8	2.1e-68
WP_000687288.1|320293_321238_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	30.2	1.6e-26
>prophage 21
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	344136	344904	584623		Planktothrix_phage(100.0%)	1	NA	NA
WP_001244395.1|344136_344904_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	4.2e-33
>prophage 22
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	354547	366264	584623	coat	Moumouvirus(33.33%)	12	NA	NA
WP_003275331.1|354547_355192_+	hypothetical protein	NA	G3MAY5	Bacillus_virus	54.3	2.8e-06
WP_000448094.1|355359_355689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404020.1|355802_356099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073379.1|356941_357991_-	pseudaminic acid synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	32.4	3.1e-26
WP_000884110.1|357983_358544_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000890386.1|358545_359646_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_003275690.1|359685_360681_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_000251476.1|360681_361887_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2P1ELT3	Moumouvirus	34.5	4.8e-47
WP_000699374.1|361886_362849_-	GDP-mannose 4,6-dehydratase	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	31.8	4.5e-32
WP_000465157.1|362845_363871_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELS8	Moumouvirus	34.8	2.6e-38
WP_001280555.1|364088_365492_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_001124404.1|365496_366264_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.8	1.1e-07
>prophage 23
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	369692	373039	584623		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000116946.1|369692_370808_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.5	1.6e-110
WP_000724104.1|370807_370969_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_000932070.1|371056_373039_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	2.7e-15
>prophage 24
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	376973	444943	584623	integrase,transposase	Clostridioides_phage(20.0%)	52	396360:396391	452542:452573
WP_000798699.1|376973_377726_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|377715_379011_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_003275931.1|379140_379761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956286.1|380545_380839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829076.1|381538_381922_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	A0A1C3S7I8	Escherichia_phage	45.6	4.2e-05
WP_000958630.1|382442_382736_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003275937.1|383496_383799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071024.1|383995_385102_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	27.1	7.5e-07
WP_000647563.1|385597_386044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875422.1|386808_387903_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_001183710.1|389469_389850_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_003275940.1|389855_390704_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000728362.1|391471_394099_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	32.1	1.7e-97
WP_000253777.1|394112_395468_-	hypothetical protein	NA	NA	NA	NA	NA
396360:396391	attL	GAGGAAGGAGTCTTCTGTCGGAAAACGATAAA	NA	NA	NA	NA
WP_033795741.1|396753_397779_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001042200.1|398491_399331_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000411818.1|399733_400498_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000412278.1|401454_402912_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_015406656.1|402893_403205_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003275555.1|403201_403672_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.3	3.4e-09
WP_001100372.1|404076_405135_+	AEC family transporter	NA	NA	NA	NA	NA
WP_000598509.1|406495_407224_-	response regulator	NA	NA	NA	NA	NA
WP_003275546.1|407216_408779_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000357138.1|410367_411789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000890101.1|412692_412905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000728363.1|414084_416439_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	34.9	5.2e-90
WP_001017356.1|417039_418131_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.0	4.6e-89
WP_000210395.1|418320_418614_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000022641.1|418700_419129_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001004889.1|419302_419503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275532.1|420019_420148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001150990.1|420724_420883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153596502.1|421034_421745_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000866019.1|422076_422715_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.1	1.8e-21
WP_015406650.1|422731_423115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817900.1|423411_424047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582598.1|424043_424676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167030.1|426120_427152_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_015406647.1|427943_429023_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.8	3.8e-19
WP_015406646.1|429028_429430_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	72.0	8.9e-51
WP_001208319.1|429885_430452_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000336576.1|430716_431775_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_000850409.1|432342_433077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024927889.1|433366_433657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865438.1|434088_435306_-	DUF3994 domain-containing protein	NA	NA	NA	NA	NA
WP_003275900.1|435805_437074_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.1	1.8e-105
WP_000477499.1|437254_438352_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_001028064.1|438348_440358_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|440350_440755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|440823_441615_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000914670.1|442224_443637_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_000794364.1|444154_444943_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
452542:452573	attR	TTTATCGTTTTCCGACAGAAGACTCCTTCCTC	NA	NA	NA	NA
>prophage 25
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	453984	457402	584623	transposase	Lactococcus_phage(66.67%)	3	NA	NA
WP_000275580.1|453984_455280_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|455269_456022_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000217996.1|456301_457402_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.3	2.9e-83
>prophage 26
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	460538	463619	584623		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000761418.1|460538_461444_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	5.3e-43
WP_000944711.1|461516_463619_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	23.4	3.5e-13
>prophage 27
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	470305	473035	584623	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_015413272.1|470305_471427_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.2	5.8e-172
WP_001007714.1|472102_473035_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.8	2.1e-18
>prophage 28
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	476632	506606	584623		Tupanvirus(66.67%)	11	NA	NA
WP_000855160.1|476632_477958_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.0	4.0e-31
WP_000256366.1|478055_479045_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001028927.1|479178_479877_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_000884576.1|480061_486598_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.2	4.4e-179
WP_003275135.1|486842_487562_-	thioesterase	NA	NA	NA	NA	NA
WP_001187886.1|487617_492114_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.6	5.5e-80
WP_000031545.1|492095_493175_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_000773405.1|493171_496255_-	cyclic peptide export ABC transporter	NA	A0A2P1JQM9	Mycobacterium_phage	28.1	2.8e-11
WP_000608545.1|496270_497347_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001224112.1|497365_505054_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	26.3	3.5e-95
WP_015413273.1|505028_506606_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	32.1	5.8e-69
>prophage 29
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	515733	537174	584623	transposase	Bacillus_phage(40.0%)	6	NA	NA
WP_003275112.1|515733_521457_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	3.6e-169
WP_000682573.1|521483_531494_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	35.2	7.9e-63
WP_175055085.1|532987_534106_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	1.3e-171
WP_003275052.1|534297_534675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087976643.1|534853_536020_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	37.0	5.1e-14
WP_087976644.1|536064_537174_-	cell surface protein	NA	A0A143FNS3	Bacillus_phage	68.0	2.9e-30
>prophage 30
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	540696	551771	584623	transposase	Bacillus_phage(91.67%)	13	NA	NA
WP_087976705.1|540696_541815_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	5.8e-172
WP_001127274.1|542964_543540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000731447.1|543860_544916_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	71.2	2.0e-150
WP_000570185.1|544912_545152_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_000377827.1|545151_545388_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	84.6	3.0e-14
WP_000405795.1|545578_546463_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.2e-77
WP_000159989.1|546736_547558_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	1.5e-28
WP_000025079.1|547699_548668_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	1.7e-31
WP_000460736.1|548905_549292_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	7.5e-47
WP_000510871.1|549395_550292_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	1.1e-77
WP_000527099.1|550518_550755_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	3.7e-12
WP_000579787.1|550891_551320_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	50.7	2.1e-29
WP_000673773.1|551342_551771_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	54.4	3.1e-33
>prophage 31
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	555106	556072	584623	protease	Tupanvirus(100.0%)	1	NA	NA
WP_000181487.1|555106_556072_+|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	32.1	8.0e-21
>prophage 32
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	561586	566131	584623		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_000805387.1|561586_562336_-	zeta toxin family protein	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	41.2	2.6e-35
WP_000823376.1|562801_563185_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001104487.1|563485_564412_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_015413275.1|564522_564738_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_001100596.1|565036_566131_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.6	6.8e-93
>prophage 33
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	570643	570859	584623		Bacillus_phage(100.0%)	1	NA	NA
WP_001167046.1|570643_570859_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	4.8e-19
>prophage 34
NZ_CP021062	Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence	584623	577198	583875	584623		Staphylococcus_phage(66.67%)	4	NA	NA
WP_000794843.1|577198_578905_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.4	4.8e-101
WP_000570018.1|578894_579446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000152960.1|579481_580792_-	lanthionine synthetase C family protein	NA	A0A2H4PQH9	Staphylococcus_phage	29.2	3.8e-34
WP_000682666.1|580803_583875_-	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	25.2	1.2e-65
>prophage 1
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	0	8277	113294		Bacillus_phage(100.0%)	7	NA	NA
WP_000572917.1|3185_4223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495110.1|4239_4464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480048.1|4968_5439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273458.1|5504_5675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000809080.1|5721_5991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334981.1|6025_6328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005319.1|7056_8277_-	hypothetical protein	NA	A0A1B1P784	Bacillus_phage	46.0	2.2e-28
>prophage 2
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	16752	23316	113294		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000914977.1|16752_18585_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	7.8e-33
WP_003286265.1|20651_21083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542404.1|21162_23316_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	40.0	5.3e-89
>prophage 3
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	33793	34711	113294		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000502628.1|33793_34711_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	44.0	5.1e-17
>prophage 4
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	41671	42772	113294		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000027439.1|41671_42772_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.2	3.1e-85
>prophage 5
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	56023	56266	113294		Caldibacillus_phage(100.0%)	1	NA	NA
WP_001104068.1|56023_56266_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	47.5	2.4e-11
>prophage 6
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	61312	104238	113294	integrase,transposase	Bacillus_phage(44.44%)	39	57593:57609	109848:109864
57593:57609	attL	TTGAAAAAGAAATTAAA	NA	NA	NA	NA
WP_000382147.1|61312_62167_+	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000538377.1|62185_65149_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_003274340.1|66430_66889_+	hypothetical protein	NA	W5QUC5	Bacillus_phage	28.1	1.3e-08
WP_001003822.1|67330_68251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000400311.1|68471_69095_+	recombinase family protein	NA	B8Q5B2	Abalone_shriveling_syndrome-associated_virus	26.6	2.7e-06
WP_000992280.1|69190_69550_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	52.4	1.7e-05
WP_000548492.1|69690_69867_+	hypothetical protein	NA	A0A1D6X868	Bacillus_phage	42.9	2.0e-07
WP_001048636.1|69903_70083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073190.1|70168_70408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872547.1|70487_71015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701129.1|71064_71340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991079.1|71564_71978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240401.1|72172_72391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116413.1|72503_73925_+|transposase	IS4-like element ISBth4 family transposase	transposase	NA	NA	NA	NA
WP_000203376.1|74280_77967_-	pesticidal crystal protein cry1Ba	NA	NA	NA	NA	NA
WP_014481837.1|78536_78983_-	hypothetical protein	NA	A0A1B1P878	Bacillus_phage	42.2	1.6e-16
WP_000681129.1|78969_79350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272683.1|79346_81260_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000861877.1|81352_82471_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.0	3.2e-05
WP_001043946.1|82953_83226_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.8e-23
WP_015413263.1|83676_84075_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	3.1e-51
WP_000595411.1|84086_85193_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	1.3e-78
WP_001058764.1|85659_85869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167374445.1|86159_86513_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000021282.1|86537_86768_+	hypothetical protein	NA	A0A217ERD4	Bacillus_phage	51.8	2.2e-06
WP_000700965.1|87094_87865_-	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_000644939.1|87861_88722_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000660942.1|88718_89585_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000554005.1|89792_90815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028781.1|90798_92040_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_000412005.1|92020_93031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000560325.1|93027_94155_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003275306.1|94482_95730_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	25.1	9.4e-06
WP_014481840.1|95726_98744_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	4.1e-39
WP_000704745.1|99026_100193_+	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	52.1	1.4e-107
WP_001021537.1|100575_101619_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.4	5.8e-09
WP_000149391.1|101850_102114_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000275580.1|102200_103496_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|103485_104238_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
109848:109864	attR	TTTAATTTCTTTTTCAA	NA	NA	NA	NA
>prophage 7
NZ_CP021063	Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence	113294	110857	111895	113294		Clostridium_phage(100.0%)	1	NA	NA
WP_001088573.1|110857_111895_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	30.7	7.3e-28
>prophage 1
NZ_CP021064	Bacillus thuringiensis strain ATCC 10792 plasmid poh3, complete sequence	92949	7530	31262	92949	transposase	Bacillus_phage(76.92%)	37	NA	NA
WP_000264171.1|7530_9267_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	43.6	4.8e-125
WP_000332096.1|9281_10631_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	34.0	1.1e-73
WP_000006647.1|10644_11022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464284.1|11034_11409_-	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	38.5	1.1e-15
WP_087976709.1|11453_11723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538377.1|11773_14737_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_000382147.1|14755_15610_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_001053969.1|15982_17419_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000438377.1|17625_17964_-	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	47.2	1.3e-21
WP_000540408.1|17963_18494_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	81.8	1.8e-78
WP_000775717.1|18530_18941_-	hypothetical protein	NA	D2XR50	Bacillus_phage	42.2	1.6e-10
WP_000857766.1|18978_19263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025589.1|19345_19552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275270.1|19582_19909_-	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	70.8	2.3e-36
WP_000421737.1|19975_20203_-	hypothetical protein	NA	U5PVK0	Bacillus_phage	58.8	4.0e-16
WP_000124018.1|20224_20593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000283199.1|20612_20804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993190.1|20839_21058_-	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	42.9	6.2e-06
WP_000662331.1|21054_21393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287939.1|21421_21583_-	hypothetical protein	NA	A0A1B1P7B0	Bacillus_phage	56.2	4.1e-07
WP_001216607.1|21584_22166_-	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	82.9	1.2e-93
WP_000843530.1|22162_22612_-	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	77.9	1.2e-67
WP_014481904.1|22608_22875_-	hypothetical protein	NA	A0A0A7AR58	Bacillus_phage	53.1	2.5e-17
WP_000706146.1|23081_23549_-	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	49.7	3.8e-37
WP_000139419.1|23551_23968_-	hypothetical protein	NA	A0A0A7AQI1	Bacillus_phage	65.0	2.6e-45
WP_000998881.1|23936_24437_-	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	68.7	2.0e-60
WP_000521758.1|24622_24970_-	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	33.3	6.2e-08
WP_000588731.1|25033_25741_-	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	67.7	1.1e-88
WP_001017952.1|25765_26194_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	47.1	3.2e-30
WP_000016917.1|26216_26912_-	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	43.8	4.8e-44
WP_000786982.1|26916_27102_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	59.0	1.0e-09
WP_000028578.1|27375_27813_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	56.2	9.8e-35
WP_000542658.1|27833_28292_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	47.8	5.8e-30
WP_000586229.1|28359_28548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505894.1|28672_29269_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000377657.1|29532_29694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071639.1|30203_31262_+	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	52.1	4.5e-09
>prophage 2
NZ_CP021064	Bacillus thuringiensis strain ATCC 10792 plasmid poh3, complete sequence	92949	35308	86784	92949	holin,tail,transposase	Bacillus_phage(62.86%)	61	NA	NA
WP_000365196.1|35308_36292_+	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	38.0	1.8e-52
WP_000664560.1|36288_36654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072432.1|36748_36985_+	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	50.6	2.2e-17
WP_000734385.1|37038_37284_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	75.4	6.7e-17
WP_000558422.1|37283_38399_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.1	1.2e-105
WP_003275239.1|38906_39629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276342.1|39644_39857_-	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	94.3	4.3e-28
WP_002175753.1|39849_40077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383999.1|40103_40256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000742982.1|40405_41464_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	75.4	2.0e-150
WP_000439587.1|41543_42041_-|holin	phage holin family protein	holin	A0A0M4R5G6	Bacillus_phage	42.8	1.2e-25
WP_000499525.1|42336_43533_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000152790.1|43786_44035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182359.1|44048_44999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537585.1|45014_45395_-	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.3	5.9e-12
WP_000013278.1|45407_47408_-	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	33.5	4.0e-14
WP_001291956.1|47423_49937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264171.1|49958_51695_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	43.6	4.8e-125
WP_000332096.1|51709_53059_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	34.0	1.1e-73
WP_000006647.1|53072_53450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464284.1|53462_53837_-	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	38.5	1.1e-15
WP_000605842.1|53881_54265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206677.1|54275_55823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025600.1|55819_56503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947773.1|56499_59523_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	56.7	4.3e-89
WP_014481902.1|59557_59989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200742.1|59952_60471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118571.1|60530_61133_-	hypothetical protein	NA	D3W0E4	Lactococcus_phage	27.6	1.2e-14
WP_000063397.1|61145_61568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024034.1|61571_61982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099511.1|61988_62357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355580.1|62353_62890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869746.1|62889_63054_-	YqbF domain-containing protein	NA	NA	NA	NA	NA
WP_001064747.1|63224_64202_-	hypothetical protein	NA	H7BVA6	unidentified_phage	45.1	1.1e-70
WP_000540218.1|64222_65425_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	39.9	2.1e-55
WP_000116413.1|65856_67278_-|transposase	IS4-like element ISBth4 family transposase	transposase	NA	NA	NA	NA
WP_000240401.1|67390_67609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|67853_69290_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000538377.1|69482_72446_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
WP_000382147.1|72464_73319_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000169374.1|74227_75535_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_000438377.1|77304_77643_-	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	47.2	1.3e-21
WP_000540408.1|77642_78173_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	81.8	1.8e-78
WP_000775717.1|78209_78620_-	hypothetical protein	NA	D2XR50	Bacillus_phage	42.2	1.6e-10
WP_000857766.1|78657_78942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025589.1|79024_79231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003275270.1|79261_79588_-	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	70.8	2.3e-36
WP_000421737.1|79654_79882_-	hypothetical protein	NA	U5PVK0	Bacillus_phage	58.8	4.0e-16
WP_000124018.1|79903_80272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000283199.1|80291_80483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087976711.1|80518_80734_-	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	41.3	1.4e-05
WP_000662331.1|80734_81073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287939.1|81101_81263_-	hypothetical protein	NA	A0A1B1P7B0	Bacillus_phage	56.2	4.1e-07
WP_001216607.1|81264_81846_-	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	82.9	1.2e-93
WP_000843530.1|81842_82292_-	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	77.9	1.2e-67
WP_014481904.1|82288_82555_-	hypothetical protein	NA	A0A0A7AR58	Bacillus_phage	53.1	2.5e-17
WP_000706146.1|82761_83229_-	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	49.7	3.8e-37
WP_000139419.1|83231_83648_-	hypothetical protein	NA	A0A0A7AQI1	Bacillus_phage	65.0	2.6e-45
WP_000998881.1|83616_84117_-	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	68.7	2.0e-60
WP_000521758.1|84302_84650_-	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	33.3	6.2e-08
WP_000786982.1|86598_86784_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	59.0	1.0e-09
>prophage 1
NZ_CP021065	Bacillus thuringiensis strain ATCC 10792 plasmid poh4, complete sequence	86488	13452	43673	86488	integrase,transposase	Brevibacillus_phage(28.57%)	25	12315:12331	18259:18275
12315:12331	attL	AATCAAAAATATATATT	NA	NA	NA	NA
WP_000432941.1|13452_14379_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.9e-36
WP_000520758.1|14930_17585_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_000946495.1|17632_18007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001063951.1|18021_18714_+	hypothetical protein	NA	NA	NA	NA	NA
18259:18275	attR	AATCAAAAATATATATT	NA	NA	NA	NA
WP_000287771.1|18931_20044_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	47.8	1.5e-92
WP_000751811.1|20040_20175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651963.1|20848_21034_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001004370.1|21266_21599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003272610.1|21636_21912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071855.1|21978_22554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000713590.1|22600_22975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233378.1|23057_23429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003272604.1|23589_23913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357794.1|23971_24265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000912542.1|24777_25209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116413.1|25259_26681_-|transposase	IS4-like element ISBth4 family transposase	transposase	NA	NA	NA	NA
WP_000240401.1|26793_27012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798699.1|27557_28310_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|28299_29595_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_001053956.1|29802_31239_-|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
WP_000215667.1|33030_33987_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	6.9e-49
WP_000369819.1|34276_37744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|38027_39464_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000382147.1|39836_40691_+	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000538377.1|40709_43673_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	7.0e-201
