The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021110	Bordetella genomosp. 9 strain AU14267 chromosome, complete genome	4497105	1174311	1215129	4497105	terminase,capsid,head,tail,portal,protease,integrase	Pseudomonas_phage(19.35%)	64	1174151:1174171	1216064:1216084
1174151:1174171	attL	CGAGTCTCGCCGTCGGCACCA	NA	NA	NA	NA
WP_086059280.1|1174311_1175295_+|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	35.2	4.6e-48
WP_086059281.1|1175268_1175505_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086056552.1|1175809_1176142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664402.1|1176128_1176299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056553.1|1176291_1177146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664403.1|1177142_1177322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056554.1|1177318_1178233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056555.1|1178237_1178507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664404.1|1178503_1178734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664405.1|1178730_1178985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086059282.1|1178968_1179478_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	65.5	4.0e-56
WP_157664406.1|1179474_1179957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056559.1|1179953_1180241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664407.1|1180326_1180473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056560.1|1180483_1180750_-	hypothetical protein	NA	A0A2H5BHK6	Acinetobacter_phage	44.2	1.1e-15
WP_086056561.1|1180758_1181367_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	54.5	1.7e-53
WP_086056562.1|1181347_1182145_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	33.2	6.4e-16
WP_086056563.1|1182287_1182560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664408.1|1182549_1182711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056564.1|1182707_1182980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056565.1|1182976_1183891_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	45.6	4.3e-56
WP_086056566.1|1183883_1184105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056567.1|1184114_1184711_-	hypothetical protein	NA	A0A0F6SIL9	Sinorhizobium_phage	61.7	2.6e-62
WP_157664409.1|1184743_1184914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056568.1|1185127_1186171_-	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	48.9	2.5e-28
WP_086056570.1|1186968_1187205_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_157664410.1|1187271_1187949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056572.1|1188000_1188231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086056574.1|1188986_1189967_-	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	33.3	3.8e-10
WP_086056575.1|1190049_1190310_+	hypothetical protein	NA	D0UIL8	Aggregatibacter_phage	50.0	9.3e-09
WP_086056576.1|1190402_1190846_+	hypothetical protein	NA	Q3HQZ3	Burkholderia_phage	46.3	5.3e-28
WP_086056577.1|1190845_1191259_+	hypothetical protein	NA	F1C5C7	Cronobacter_phage	46.2	1.9e-19
WP_086059283.1|1191258_1191600_+	DUF968 domain-containing protein	NA	NA	NA	NA	NA
WP_157664411.1|1191620_1192442_+	hypothetical protein	NA	A0A2I7RQ47	Vibrio_phage	38.6	7.1e-10
WP_086056579.1|1192438_1193827_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	42.3	6.6e-93
WP_086056580.1|1193829_1194240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056581.1|1194275_1194575_+	DUF1064 domain-containing protein	NA	Q3HQZ9	Burkholderia_phage	69.7	7.1e-37
WP_086056582.1|1194726_1195302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056583.1|1195332_1195665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056584.1|1196110_1196395_+	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	64.0	2.1e-22
WP_086059284.1|1196403_1196982_+	hypothetical protein	NA	A0A0F6WE48	Mycobacterium_phage	35.6	2.1e-08
WP_086056585.1|1197018_1197465_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	60.0	2.1e-40
WP_086056586.1|1197443_1198967_+|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	79.2	2.7e-225
WP_086056587.1|1198972_1200262_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	50.1	4.7e-117
WP_086056588.1|1200251_1200938_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	64.0	1.7e-70
WP_086056589.1|1200949_1202191_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	50.6	1.5e-99
WP_086056590.1|1202240_1202444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056591.1|1202440_1202773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JX27	Pseudomonas_phage	56.4	3.6e-21
WP_086056592.1|1202772_1203129_+|head,tail	head-tail adaptor protein	head,tail	Q9XJT0	Pseudomonas_phage	55.8	1.7e-32
WP_086056593.1|1203125_1203614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056594.1|1203613_1203976_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_086056595.1|1204032_1204500_+	hypothetical protein	NA	Q9MCA5	Pseudomonas_phage	38.5	4.7e-19
WP_157664412.1|1204503_1204890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056597.1|1204907_1205129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056598.1|1205132_1207283_+	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	31.9	2.5e-22
WP_086056599.1|1207282_1207633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056600.1|1207629_1208106_+	DUF1833 domain-containing protein	NA	I7GYA2	Xanthomonas_virus	30.1	1.8e-10
WP_086056601.1|1208139_1208520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086056602.1|1208690_1209074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086059285.1|1209079_1213006_+	hypothetical protein	NA	Q52PQ3	Xanthomonas_phage	26.4	1.1e-49
WP_086056603.1|1213606_1214152_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_086056604.1|1214193_1214460_+	hypothetical protein	NA	A5A3W1	Burkholderia_phage	40.7	1.9e-09
WP_086056605.1|1214456_1214717_+	hypothetical protein	NA	I6NSG3	Burkholderia_phage	46.2	6.7e-15
WP_086056606.1|1214703_1215129_+	glycoside hydrolase family protein	NA	A0A223LHH7	Pseudoalteromonas_phage	53.8	1.2e-29
1216064:1216084	attR	CGAGTCTCGCCGTCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP021110	Bordetella genomosp. 9 strain AU14267 chromosome, complete genome	4497105	1784769	1791742	4497105	integrase	Acinetobacter_phage(28.57%)	11	1781435:1781450	1790995:1791010
1781435:1781450	attL	CGCCAGGAAGCGGCCG	NA	NA	NA	NA
WP_086057042.1|1784769_1785759_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	47.3	1.3e-79
WP_086059344.1|1785742_1785952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086057044.1|1786252_1786588_-	hypothetical protein	NA	A0A2H4JCF4	uncultured_Caudovirales_phage	59.6	2.2e-10
WP_086057045.1|1786584_1787187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086057046.1|1787191_1787662_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	66.2	2.3e-61
WP_086057047.1|1787658_1787979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086057048.1|1787981_1788506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086057049.1|1788592_1789222_-	exonuclease	NA	F8TUK8	EBPR_podovirus	39.2	1.6e-38
WP_086057050.1|1789218_1789710_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	48.4	6.0e-33
WP_086057051.1|1789709_1790651_-	recombinase RecT	NA	E5AGD9	Erwinia_phage	47.9	1.5e-51
WP_086057052.1|1790695_1791742_-	hypothetical protein	NA	K7ZPX9	Xanthomonas_citri_phage	36.6	5.1e-13
1790995:1791010	attR	CGGCCGCTTCCTGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP021110	Bordetella genomosp. 9 strain AU14267 chromosome, complete genome	4497105	1804649	1829145	4497105		Burkholderia_phage(44.83%)	35	NA	NA
WP_086057075.1|1804649_1805312_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	41.6	8.4e-30
WP_086057076.1|1805311_1805815_+	hypothetical protein	NA	A0A142IF90	Pseudomonas_phage	46.8	1.1e-32
WP_086057077.1|1805815_1807411_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	77.9	1.4e-251
WP_086057078.1|1807419_1808871_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	63.1	9.5e-159
WP_086057079.1|1808761_1809601_+	hypothetical protein	NA	A9YWZ8	Burkholderia_phage	51.6	2.8e-62
WP_086057080.1|1809597_1810086_+	HNH endonuclease	NA	C4ML07	Xanthomonas_virus	41.9	8.7e-24
WP_086059347.1|1810122_1811370_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	44.9	1.4e-73
WP_086057081.1|1811386_1811872_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	51.9	3.2e-34
WP_086057082.1|1811935_1812958_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	68.5	6.5e-130
WP_086057083.1|1812968_1813328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086057084.1|1813337_1813721_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	56.7	1.7e-35
WP_086057085.1|1813723_1814197_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	55.2	3.5e-38
WP_086057086.1|1814205_1814586_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	53.7	3.5e-28
WP_086057087.1|1814578_1815160_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	52.4	1.5e-46
WP_086057088.1|1815224_1816706_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	55.1	7.4e-143
WP_086057089.1|1816760_1817204_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.9	1.2e-43
WP_086057090.1|1817203_1817602_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	34.6	3.1e-11
WP_086057091.1|1817613_1817814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086057092.1|1817797_1819639_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	44.6	5.9e-81
WP_086057093.1|1819635_1820208_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	39.9	1.3e-31
WP_086057094.1|1820204_1820513_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	43.0	7.7e-18
WP_086057095.1|1820516_1821440_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.6	7.1e-67
WP_086057096.1|1821432_1822179_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	59.9	3.2e-78
WP_086057097.1|1822187_1822664_+	hypothetical protein	NA	A0A220GJG3	Streptococcus_phage	40.4	3.7e-19
WP_086057098.1|1822668_1823022_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	60.7	1.1e-31
WP_086057099.1|1823018_1824200_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	68.8	4.9e-137
WP_086057100.1|1824201_1824870_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	65.0	9.3e-77
WP_157664432.1|1824881_1826048_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	38.0	1.0e-17
WP_157664433.1|1826040_1826442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086057103.1|1826497_1826764_+	hypothetical protein	NA	A5A3W1	Burkholderia_phage	43.2	5.1e-10
WP_086057104.1|1826760_1827021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086057105.1|1827007_1827433_+	glycoside hydrolase family protein	NA	A0A1J0GVQ7	Pseudoalteromonas_phage	53.8	1.1e-30
WP_157664434.1|1827429_1827813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086057107.1|1828243_1828459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086057108.1|1828461_1829145_-	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	40.6	1.7e-33
>prophage 4
NZ_CP021110	Bordetella genomosp. 9 strain AU14267 chromosome, complete genome	4497105	4306906	4315321	4497105		Enterobacteria_phage(50.0%)	9	NA	NA
WP_086058988.1|4306906_4307647_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	2.6e-11
WP_086058989.1|4307652_4308453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086058990.1|4308515_4308854_-	EamA family transporter	NA	NA	NA	NA	NA
WP_086058991.1|4308850_4309858_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_086058992.1|4309880_4311902_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	38.3	2.1e-07
WP_086058993.1|4311904_4312462_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.9	1.4e-49
WP_086058994.1|4312458_4313349_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.3	2.0e-98
WP_086058995.1|4313357_4314254_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	31.1	1.4e-22
WP_086058996.1|4314250_4315321_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.0	9.0e-90
