The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	1119772	1186596	4679401	terminase,lysis,integrase,capsid,plate,tail,transposase,portal,head,tRNA	Salmonella_phage(91.11%)	63	1120056:1120070	1156019:1156033
WP_089113803.1|1119772_1120883_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1120056:1120070	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1121679_1122483_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1122881_1123475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1123736_1124399_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1124951_1125968_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1125970_1126603_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1126724_1126967_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1127000_1127510_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1127517_1127718_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1127681_1128023_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1128090_1128324_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1128323_1128551_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1128547_1129405_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1129401_1131816_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1131968_1132157_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217571.1|1132167_1132401_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1132514_1133192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1133505_1135170_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1135273_1136314_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1136313_1138080_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1138222_1139056_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730760.1|1139072_1140134_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000059173.1|1140137_1140788_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1140881_1141346_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1141345_1141549_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1141552_1141768_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1141748_1142264_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1142260_1142689_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1142784_1143216_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1143208_1143655_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1143656_1144508_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1144585_1145164_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1145160_1145520_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1145506_1146415_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1146407_1147013_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1147009_1148863_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1148862_1149438_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1150307_1150532_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_001207651.1|1151815_1152331_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1152385_1152688_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1152702_1152822_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1152814_1155622_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1155618_1156104_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1156019:1156033	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1156100_1157201_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1157269_1157488_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1158039_1159203_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1159210_1161391_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1161387_1162797_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1162861_1174336_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1174950_1175433_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1175582_1176059_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1176048_1176339_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1176504_1176843_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1176991_1178653_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1178738_1179617_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1179740_1180331_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1180365_1180971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1181091_1182378_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1182397_1183189_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1183354_1184716_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1184968_1185217_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1185235_1185784_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469801.1|1185828_1186596_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	1691596	1700767	4679401	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1691596_1692544_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1692527_1693259_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1693239_1693347_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1693406_1694138_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1694360_1696046_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1696042_1696762_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1696808_1697276_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1697332_1697863_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1698034_1698493_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1698733_1700767_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	1767964	1778471	4679401		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1767964_1769368_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1769545_1770439_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_086148743.1|1770815_1771901_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023658.1|1771900_1772800_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1772847_1773726_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1773726_1774278_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1774283_1775258_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1775273_1776047_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1776051_1777131_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1777157_1778471_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	2430476	2446420	4679401	tRNA,holin	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2430476_2430911_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2430960_2431299_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2431938_2432112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2432144_2432690_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2432686_2432968_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2432957_2433146_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2433067_2433463_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2435633_2436170_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2436166_2436457_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436456_2437056_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2437118_2437289_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2437579_2437792_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2438161_2439094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2439090_2439645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2439806_2440136_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2440408_2440876_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2441260_2441416_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441523_2442045_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2442482_2442704_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2442788_2443106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2443133_2443751_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2444067_2445003_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2445046_2446420_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	2637257	2686507	4679401	lysis,integrase,holin,tail,protease	Salmonella_phage(27.27%)	48	2667022:2667051	2686643:2686672
WP_000984498.1|2637257_2638139_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2638332_2640381_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2640400_2641087_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2641184_2641682_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2641810_2643094_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2643062_2645696_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2645773_2647213_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2647330_2647567_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2647677_2647869_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2647887_2648538_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2648761_2648926_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2649210_2649933_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2650616_2651012_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2651341_2651818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2652190_2652610_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2652982_2653252_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2653417_2653558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2656696_2657611_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2657743_2657902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2657911_2658526_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2659013_2659160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2659660_2659786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2660355_2660556_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2660652_2661153_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348542.1|2663257_2663749_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.6e-41
WP_001576014.1|2663803_2663992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2664056_2664224_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2664480_2665014_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2665067_2665298_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2665487_2665982_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2666625_2666895_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2667022:2667051	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2667839_2668640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2669119_2669842_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2673896_2674592_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2674681_2675215_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2676109_2676589_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2676606_2677059_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2677042_2677372_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2677647_2678334_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2678694_2679144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2679517_2680042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2680138_2680828_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2680957_2681185_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2681181_2681781_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2681844_2682093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2682781_2684761_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2685174_2685453_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2685427_2686507_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2686643:2686672	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	2858899	2899166	4679401	protease,tail	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2858899_2859580_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2860198_2860858_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2860944_2861274_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2861270_2861552_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2861600_2862380_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862405_2862954_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2863168_2864380_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864437_2864755_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2864799_2865213_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2865386_2866049_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2866143_2866602_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866637_2868692_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868815_2869262_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2869280_2871434_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2871420_2872026_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2872242_2872752_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2873108_2874161_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2874232_2874685_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2874870_2876631_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876699_2877218_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2877317_2877485_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877740_2878304_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2878300_2879941_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2879945_2881199_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2881213_2883121_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2883133_2885242_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2885340_2886450_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2886446_2886989_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2887154_2888165_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2888372_2890985_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2891411_2891603_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891873_2892560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892919_2893546_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2894193_2895162_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2895387_2895636_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2895639_2896221_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2896220_2897930_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2897926_2898553_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2898536_2899166_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 7
NZ_CP020825	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 chromosome, complete genome	4679401	2970875	2978188	4679401	integrase,protease	Ralstonia_phage(16.67%)	7	2965673:2965687	2976924:2976938
2965673:2965687	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2970875_2971253_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971414_2971612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934059.1|2971824_2974101_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
WP_000520789.1|2974131_2974452_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974775_2974997_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2975126_2977073_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2976924:2976938	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2977069_2978188_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	0	5433	59363	integrase	Macacine_betaherpesvirus(100.0%)	7	2441:2452	9148:9159
WP_001057493.1|1720_1951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077681952.1|2084_2606_-	hypothetical protein	NA	NA	NA	NA	NA
2441:2452	attL	TATTTACCATCA	NA	NA	NA	NA
WP_000813641.1|3280_3499_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159863.1|3500_3806_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001266176.1|3807_4098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198608.1|4094_4616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082169.1|4650_5433_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
9148:9159	attR	TGATGGTAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	8493	9326	59363	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001541541.1|8493_8844_-	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_000064919.1|8900_9326_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
>prophage 3
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	14268	14433	59363		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|14268_14433_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 4
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	19939	20500	59363		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|19939_20500_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 5
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	24048	30956	59363	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|24048_24465_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|24648_24984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|25040_25646_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|25642_26584_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|26998_28204_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064277.1|28203_29178_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000457542.1|29259_30534_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|30533_30956_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
>prophage 6
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	48132	48690	59363		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|48132_48690_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 7
NZ_CP020826	Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence	59363	58258	58645	59363		Stx_converting_phage(100.0%)	1	NA	NA
WP_000751876.1|58258_58645_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
