The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015612	Stenotrophomonas maltophilia strain OUC_Est10, complete genome	4668743	575867	588375	4668743		Enterobacteria_phage(42.86%)	11	NA	NA
WP_088024053.1|575867_577226_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.8	2.4e-31
WP_088024056.1|577360_578302_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_057500379.1|578301_579048_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_088024058.1|579306_580362_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.6	9.2e-79
WP_088024061.1|580376_581264_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.2	3.7e-97
WP_088024064.1|581260_581818_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	9.9e-48
WP_088024067.1|581814_582720_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.6	8.8e-30
WP_088024070.1|582889_586216_-	DEAD/DEAH box helicase	NA	Q9YNZ9	Choristoneura_fumiferana_nuclear_polyhedrosis_virus	29.9	1.3e-46
WP_012509993.1|586376_587108_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_088024075.1|587109_587742_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_088024080.1|587787_588375_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.3	2.8e-24
>prophage 2
NZ_CP015612	Stenotrophomonas maltophilia strain OUC_Est10, complete genome	4668743	974741	1064461	4668743	plate,integrase,tail	Escherichia_phage(18.52%)	79	956609:956637	1037565:1037593
956609:956637	attL	CATCAGTAGATCCACGCCATGCGTGGATG	NA	NA	NA	NA
WP_088024699.1|974741_975980_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	37.2	1.6e-53
WP_088028257.1|976203_977103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664567.1|977987_978161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083298676.1|978631_979690_+	catalase family protein	NA	NA	NA	NA	NA
WP_049452914.1|979714_980410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049452916.1|980411_981788_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_088024700.1|981743_982460_-	conjugal transfer protein traA	NA	NA	NA	NA	NA
WP_070470389.1|982843_983209_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_083298674.1|983413_984760_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043033702.1|985234_986473_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	37.0	6.6e-52
WP_088028259.1|986711_987623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024702.1|987719_995411_+	AAA family ATPase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	31.2	5.4e-27
WP_088024704.1|995519_996803_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_046429154.1|996965_997271_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088024705.1|998063_999020_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.9	6.0e-61
WP_046429159.1|999016_999394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024707.1|999465_1000452_+	endonuclease	NA	A0A139ZPJ9	Marinitoga_camini_virus	46.7	9.3e-49
WP_088024709.1|1000463_1001360_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_088024711.1|1001458_1001956_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_088028261.1|1002139_1003552_-	ADP-ribosylglycohydrolase family protein	NA	A0A1V0SCE0	Indivirus	38.2	1.3e-08
WP_088024713.1|1004176_1005088_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_088024715.1|1005084_1008012_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	50.5	2.1e-266
WP_088024717.1|1008047_1011167_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	25.4	9.5e-15
WP_088024719.1|1011166_1014562_+	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_088024721.1|1014614_1016450_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_088024722.1|1016539_1018006_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_088028263.1|1018002_1018341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024724.1|1018938_1020993_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
WP_005408298.1|1020999_1021320_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_088024726.1|1021431_1022031_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_014036181.1|1022098_1022458_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_088024728.1|1022546_1023074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024730.1|1023070_1025020_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_088024732.1|1025012_1025957_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_088024734.1|1025959_1026913_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_088024736.1|1026955_1028791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024738.1|1028887_1029457_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_088024741.1|1029570_1030080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004154640.1|1030187_1030382_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_014646186.1|1030473_1031451_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_088024743.1|1031528_1032311_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_088024746.1|1032471_1033416_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_088024747.1|1033498_1034242_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	6.2e-13
WP_005408313.1|1034394_1034634_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_004146925.1|1034777_1036040_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_088024749.1|1036132_1037497_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_088024751.1|1037716_1038778_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
1037565:1037593	attR	CATCCACGCATGGCGTGGATCTACTGATG	NA	NA	NA	NA
WP_088024753.1|1038774_1039440_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	7.2e-21
WP_088024755.1|1039436_1040393_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_004146965.1|1040389_1040743_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_088024757.1|1041036_1041255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024759.1|1041518_1043990_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088024761.1|1044212_1044461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024763.1|1044512_1044920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065722614.1|1045438_1045819_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_088024764.1|1045866_1046289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024766.1|1046356_1047430_-|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	50.4	1.1e-92
WP_088024768.1|1047420_1047636_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	48.6	7.0e-10
WP_088024770.1|1047619_1048087_-|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	30.4	2.6e-09
WP_088024773.1|1048089_1050561_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	23.5	1.3e-19
WP_088024775.1|1050681_1050972_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	57.3	2.5e-18
WP_088024779.1|1051052_1051556_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	51.2	1.4e-40
WP_088024781.1|1051558_1052758_-|tail	phage tail protein	tail	D5LGY7	Escherichia_phage	53.2	4.8e-124
WP_088024784.1|1052865_1053450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024786.1|1053454_1054954_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	57.3	2.6e-71
WP_088024787.1|1054961_1055741_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	50.0	1.9e-44
WP_088024789.1|1055733_1056630_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	55.8	2.4e-80
WP_049444104.1|1056632_1056971_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	61.3	1.0e-31
WP_088024790.1|1057023_1057614_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	38.7	4.3e-25
WP_088024792.1|1057610_1058165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156476665.1|1058281_1058629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664568.1|1058627_1058828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088024795.1|1058908_1059394_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	55.0	2.7e-41
WP_057501923.1|1059390_1059741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061479755.1|1059737_1060187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061479756.1|1060522_1060906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024797.1|1061060_1061699_-	hypothetical protein	NA	A0A1V0DYI4	Shewanella_phage	41.8	4.5e-20
WP_088024799.1|1061739_1061967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088024800.1|1062124_1064461_-	toprim domain-containing protein	NA	A0A088FVF8	Escherichia_phage	43.4	1.1e-135
>prophage 3
NZ_CP015612	Stenotrophomonas maltophilia strain OUC_Est10, complete genome	4668743	2833935	2869723	4668743	terminase,protease,integrase,head,capsid,portal,tail	uncultured_Caudovirales_phage(19.05%)	40	2824050:2824067	2847619:2847636
2824050:2824067	attL	CCAGCAGCGACCCGAAGC	NA	NA	NA	NA
WP_088026397.1|2833935_2835120_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	50.6	5.6e-101
WP_088026398.1|2835193_2836393_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_088026399.1|2836392_2837004_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_088028399.1|2837051_2837405_-	hypothetical protein	NA	B7SYF7	Stenotrophomonas_phage	84.1	4.2e-44
WP_088026401.1|2838062_2838491_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_088026402.1|2838667_2839282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026403.1|2839343_2839616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088026405.1|2840673_2840880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664590.1|2840956_2848417_-|tail	phage tail protein	tail	I7HDJ4	Xanthomonas_virus	47.3	0.0e+00
2847619:2847636	attR	GCTTCGGGTCGCTGCTGG	NA	NA	NA	NA
WP_088026406.1|2848407_2848803_-	hypothetical protein	NA	Q52PK9	Xanthomonas_phage	47.2	4.9e-25
WP_088026407.1|2848802_2849264_-	DUF1833 domain-containing protein	NA	I7GYA2	Xanthomonas_virus	52.0	9.4e-36
WP_088026408.1|2849260_2849617_-	hypothetical protein	NA	C4ML17	Xanthomonas_virus	42.4	1.3e-21
WP_088026409.1|2849680_2853028_-|tail	phage tail tape measure protein	tail	A0A2R3UAA7	Siphoviridae_environmental_samples	35.6	1.5e-29
WP_088028401.1|2853536_2853755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008265925.1|2853859_2854207_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	52.2	3.4e-22
WP_088026411.1|2854210_2854663_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088026412.1|2854730_2855069_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_088026413.1|2855065_2855467_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	32.2	3.6e-07
WP_088026414.1|2855459_2855807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026415.1|2855806_2856115_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	51.0	7.1e-24
WP_088026416.1|2856670_2857882_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	63.4	9.7e-141
WP_088026417.1|2857878_2858526_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	72.8	1.9e-79
WP_088026418.1|2858518_2859778_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	71.4	2.1e-162
WP_088028402.1|2859774_2861541_-|terminase	terminase	terminase	A0A0U2C138	Paracoccus_phage	51.1	1.1e-148
WP_088028404.1|2861614_2861893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026419.1|2862189_2862516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026420.1|2862679_2863039_-	DUF1064 domain-containing protein	NA	Q3HQZ9	Burkholderia_phage	65.2	1.4e-39
WP_088026421.1|2863144_2863741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088028406.1|2863901_2864309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026422.1|2864356_2864671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026423.1|2864667_2865156_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	78.9	8.9e-69
WP_088026424.1|2865253_2865958_-	hypothetical protein	NA	C8CLH7	Xylella_phage	46.5	1.1e-46
WP_088026425.1|2866028_2866232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026426.1|2866228_2866597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026427.1|2866596_2866791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088026428.1|2866787_2867459_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	36.3	9.2e-24
WP_088026429.1|2867448_2868342_-	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	40.8	5.5e-32
WP_088026430.1|2868343_2868655_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088026431.1|2868651_2869182_-	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	48.0	9.4e-40
WP_088028408.1|2869291_2869723_-	hypothetical protein	NA	W6MWX8	Pseudomonas_phage	50.0	9.4e-06
