The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	1205261	1273681	5177498	tRNA,protease,holin,transposase	uncultured_Caudovirales_phage(17.65%)	55	NA	NA
WP_001162173.1|1205261_1206614_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|1206797_1207184_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|1207375_1207618_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|1207607_1207898_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|1207898_1208363_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|1208547_1210686_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_021523332.1|1211079_1212735_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_021523333.1|1212784_1214206_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|1214324_1215272_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1215456_1215510_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471850.1|1215650_1218347_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000047539.1|1218552_1218939_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1219011_1219473_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1219485_1220421_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|1220424_1220559_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|1220839_1221235_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|1221365_1222079_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|1222149_1222743_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326836.1|1222887_1223340_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000036448.1|1223462_1225058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|1225113_1226118_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1226279_1226696_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|1226741_1227245_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016245205.1|1227437_1228634_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416387.1|1228689_1231545_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|1231544_1231988_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1232341_1233853_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|1234119_1235220_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1235219_1236302_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021523335.1|1236462_1237965_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001309159.1|1238042_1239041_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|1239107_1240427_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|1240489_1241254_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|1241277_1242309_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|1242525_1243089_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|1243092_1244112_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_024166525.1|1248669_1250016_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000611568.1|1251852_1252971_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|1253013_1253139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|1253191_1253449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|1253762_1254929_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|1254864_1255278_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|1255340_1257338_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|1257491_1258648_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|1259581_1259839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|1260395_1261163_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684855.1|1261163_1262120_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000125187.1|1262116_1263115_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|1263111_1264014_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|1264058_1266383_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068913.1|1266469_1267423_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|1267419_1267941_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|1269690_1269948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|1270698_1272057_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_086352845.1|1272295_1273681_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	5.0e-258
>prophage 2
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	2634719	2712035	5177498	tRNA,terminase,lysis,holin,tail,transposase,portal,head,integrase,capsid	Escherichia_phage(33.9%)	91	2631896:2631910	2651133:2651147
2631896:2631910	attL	AACGTATTTTGCCTG	NA	NA	NA	NA
WP_000526135.1|2634719_2635178_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001300895.1|2635299_2636262_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_024166502.1|2636405_2639852_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|2639979_2641053_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|2641313_2642513_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|2642505_2643207_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|2643206_2644451_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|2644479_2645391_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2645406_2646228_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|2646364_2647150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|2647146_2647608_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|2647665_2648712_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2648708_2649503_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|2649669_2650788_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|2650756_2651026_-	excisionase	NA	NA	NA	NA	NA
WP_000102155.1|2651087_2653544_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
2651133:2651147	attR	AACGTATTTTGCCTG	NA	NA	NA	NA
WP_001093951.1|2653621_2653825_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|2653821_2654010_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|2654020_2654875_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|2655405_2655780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|2655791_2655944_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|2656150_2656558_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|2656634_2656862_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|2656845_2657397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|2657368_2658409_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|2658320_2658863_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|2658896_2659667_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|2659682_2660075_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2660071_2660368_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|2660364_2660826_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|2660803_2661160_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137947.1|2661255_2661663_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_001229301.1|2661664_2662030_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|2662026_2663013_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|2663571_2663727_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980989.1|2663943_2664195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|2664261_2664540_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|2664541_2665600_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|2665600_2665969_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|2665961_2666651_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|2666863_2667061_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|2667036_2667150_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|2667430_2667766_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|2668011_2668215_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|2668211_2668373_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|2668522_2668738_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037013.1|2668742_2669633_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.2e-108
WP_001092864.1|2669669_2670203_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_000459345.1|2670362_2670500_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082562.1|2670501_2670969_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
WP_000867489.1|2671410_2671956_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_016248238.1|2671930_2673856_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000198149.1|2673852_2674059_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_016248239.1|2674055_2675657_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
WP_016248240.1|2675637_2676957_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_001299443.1|2676966_2677299_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063261.1|2677355_2678381_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_000158858.1|2678422_2678809_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.2	1.2e-52
WP_000752997.1|2678820_2679174_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_000975010.1|2679189_2679765_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000683079.1|2679761_2680157_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2680164_2680917_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_001542190.1|2680930_2681362_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	4.8e-42
WP_000533402.1|2681388_2681802_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001542191.1|2681782_2684356_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000847298.1|2684352_2684682_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|2684681_2685380_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001542192.1|2685390_2686134_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_125075486.1|2686079_2686712_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.3	1.6e-102
WP_086352851.1|2687055_2690529_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001228316.1|2690596_2691196_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_086352852.1|2691347_2694374_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.5	4.1e-55
WP_000885577.1|2694373_2694958_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|2695012_2695681_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|2695737_2696004_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|2696235_2697099_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2697082_2698219_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|2698468_2699695_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2699743_2700865_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2700940_2702401_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2702400_2703072_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2703241_2704612_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2704615_2705257_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|2705292_2706399_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001522894.1|2706452_2706914_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|2706923_2707562_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_012602377.1|2707894_2708245_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|2708229_2708679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|2709261_2710512_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_020232865.1|2710614_2710938_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
WP_000526135.1|2711576_2712035_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	2928994	3037755	5177498	tRNA,terminase,lysis,holin,tail,transposase	Escherichia_phage(48.28%)	107	NA	NA
WP_020233353.1|2928994_2929927_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.3e-17
WP_000387388.1|2931258_2932242_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|2932718_2934092_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|2934220_2935156_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2935207_2936443_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2936444_2936660_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2936759_2936948_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2936985_2937135_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2937190_2938000_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2937992_2940593_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2940694_2940970_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2941044_2941215_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2941214_2941436_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2941877_2942366_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2942362_2942518_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2942528_2942708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2942950_2943370_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2943449_2943704_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2943700_2944123_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|2944200_2944989_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|2944995_2945742_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|2945764_2946526_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|2946541_2946964_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|2947125_2947629_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|2947749_2948523_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|2949045_2949171_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|2949253_2949595_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|2950462_2951062_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|2951061_2951352_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|2951348_2951891_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|2952112_2952682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|2952650_2952953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|2953029_2953371_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|2953374_2953851_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|2954067_2954253_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2954449_2955907_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|2956044_2956836_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|2956828_2957761_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000613571.1|2957696_2957948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|2957951_2959046_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|2959026_2960328_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|2960330_2961737_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|2961720_2962833_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|2962937_2963702_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_020233804.1|2963800_2964940_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000908084.1|2964982_2965159_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_057950804.1|2965162_2965558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2965557_2965941_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_042002565.1|2965941_2966322_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.5e-18
WP_000673077.1|2966318_2966711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|2966737_2967700_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|2967850_2968210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|2968317_2968518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|2968681_2971915_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|2971907_2972246_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|2972245_2972944_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|2972949_2973693_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_049286672.1|2973629_2974232_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|2974292_2977772_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|2977839_2978439_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_000526135.1|2978635_2979094_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_042099016.1|2979214_2981590_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_000654155.1|2981589_2981871_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_001314683.1|2981880_2982921_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_001405873.1|2982963_2983257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354607.1|2983802_2984597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000968125.1|2985069_2985927_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|2985923_2986781_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983718.1|2986777_2987605_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000286865.1|2987604_2988519_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_057950810.1|2989103_2989538_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	3.0e-28
WP_000837924.1|2989678_2990812_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_021517097.1|2991178_2994703_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2994976_2995243_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001523197.1|2995239_2995662_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|2995772_2996762_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_023153685.1|2996969_2999609_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2999605_2999791_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001523200.1|2999798_3000122_+	YdbL family protein	NA	NA	NA	NA	NA
WP_059321765.1|3004195_3006604_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_021523074.1|3006811_3007672_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001523206.1|3007735_3010042_+	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000177498.1|3010212_3010818_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_021523075.1|3011729_3013487_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020233384.1|3013476_3014793_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048963.1|3014846_3015452_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_021517100.1|3015652_3019555_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001523214.1|3019839_3020178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|3020164_3020614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343026.1|3020733_3021111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027943.1|3021226_3022027_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115969.1|3022223_3023663_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048645.1|3023704_3024706_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001390056.1|3024894_3025425_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731851.1|3025669_3025843_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001309484.1|3025914_3026064_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001523216.1|3026462_3028103_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414564.1|3028140_3029064_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523218.1|3029280_3030624_+	VOC family protein	NA	NA	NA	NA	NA
WP_048265110.1|3030848_3032504_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|3032643_3032868_+	YdcH family protein	NA	NA	NA	NA	NA
WP_057950846.1|3032930_3033470_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_042002675.1|3033461_3034442_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001296725.1|3034565_3035558_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586719.1|3035554_3036148_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261003.1|3036450_3037119_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000526135.1|3037296_3037755_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	3186356	3246215	5177498	terminase,lysis,tail,head,portal,transposase,capsid	Enterobacteria_phage(45.1%)	77	NA	NA
WP_000527786.1|3186356_3187817_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_001523332.1|3187905_3189189_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3189792_3189906_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3189974_3190208_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|3190524_3191115_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|3191342_3191636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|3191646_3192351_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|3192360_3192642_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_032152843.1|3192638_3195038_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001542091.1|3195102_3195702_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|3195769_3199249_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|3199309_3199912_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|3199848_3200592_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_001551186.1|3200597_3201296_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|3201295_3201625_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|3201621_3204183_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|3204175_3204610_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3204591_3205014_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3205029_3205770_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|3205777_3206173_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000752979.1|3206760_3207114_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|3207125_3207524_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|3207565_3208591_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|3208645_3208978_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|3208987_3210307_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|3210287_3211889_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|3211885_3212092_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|3212088_3214014_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|3213988_3214534_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|3214922_3215156_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|3215213_3215624_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|3215775_3215949_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3216120_3216276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3216355_3216421_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3216423_3216612_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3216622_3216835_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3217197_3217695_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|3217691_3218225_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|3218221_3218533_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3218537_3218753_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|3219506_3219722_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|3220022_3220235_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3220289_3220379_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|3220656_3221409_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|3221422_3222472_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|3222473_3222752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3222818_3223070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3223286_3223442_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3223513_3223801_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3223800_3224040_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3224064_3224370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|3224572_3224905_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|3225341_3226655_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000915483.1|3227138_3228161_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|3228163_3228778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|3228986_3229652_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|3229854_3230253_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|3230293_3231259_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|3231239_3231761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|3231744_3231972_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|3232052_3232460_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|3232628_3232784_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|3232785_3233361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3233847_3234036_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|3234032_3234224_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|3234317_3236789_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_000005552.1|3236861_3237113_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021523105.1|3237147_3238428_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|3238429_3238558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|3238615_3239635_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|3239646_3240861_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|3241066_3241393_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|3241527_3241869_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|3241903_3242464_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|3242466_3243177_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3243284_3243590_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|3243788_3246215_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 5
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	3732751	3740269	5177498		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|3732751_3733300_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|3733304_3734183_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|3734240_3735140_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|3735139_3736225_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|3736596_3737490_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|3737721_3738717_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|3738874_3740269_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 6
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	3787674	3839662	5177498	tRNA,terminase,holin,lysis,integrase,tail,head,portal,transposase,plate,capsid	Escherichia_phage(33.33%)	63	3791963:3791989	3824861:3824887
WP_000675148.1|3787674_3789078_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|3789074_3789797_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|3789976_3790309_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|3790456_3791818_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
3791963:3791989	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|3792090_3792309_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_042002646.1|3792390_3793554_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.0e-203
WP_000978914.1|3793553_3794033_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
WP_000785970.1|3796487_3796607_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|3796639_3796915_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001554312.1|3796971_3797490_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_042002647.1|3797502_3798693_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
WP_042002648.1|3798952_3799645_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	98.3	1.4e-123
WP_001406733.1|3800136_3800316_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_000002748.1|3800368_3800647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695638.1|3800850_3801378_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.2e-90
WP_060578154.1|3801381_3803700_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	68.1	6.3e-213
WP_028985810.1|3803710_3804241_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
WP_001121497.1|3804233_3805142_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127164.1|3805146_3805494_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_021525814.1|3805490_3806126_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
WP_042002650.1|3806209_3806995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042002651.1|3807066_3807519_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.7e-74
WP_021517192.1|3807511_3807979_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001695628.1|3808086_3808512_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.0e-65
WP_021548484.1|3808499_3808925_-	hypothetical protein	NA	Q858W1	Yersinia_virus	89.4	1.5e-59
WP_042002652.1|3808939_3809437_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|3809436_3809718_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|3809721_3809925_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|3809924_3810434_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021548483.1|3810533_3811277_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
WP_042002653.1|3811280_3812354_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
WP_001607695.1|3812412_3813267_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_000156844.1|3813440_3815213_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000038161.1|3815212_3816247_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_042002654.1|3816564_3817221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042002655.1|3817304_3818036_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.6	1.0e-108
WP_042002656.1|3818187_3818400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042002657.1|3818471_3818924_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_042002658.1|3818923_3821209_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.3	0.0e+00
WP_000027664.1|3821198_3821474_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3821470_3821695_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_042002659.1|3821697_3821997_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	3.5e-44
WP_000557698.1|3821996_3822221_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217677.1|3822284_3822785_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|3822781_3822952_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|3822962_3823238_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|3823352_3823652_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985262.1|3823767_3824781_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_001303579.1|3825057_3825375_-	hypothetical protein	NA	NA	NA	NA	NA
3824861:3824887	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807371.1|3825789_3826689_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_000178552.1|3826770_3827550_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|3827649_3828690_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001352368.1|3829067_3830276_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|3830641_3831847_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3832290_3832611_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|3832603_3832990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3832997_3833684_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3833661_3834285_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|3834366_3835572_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3835684_3836278_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000422741.1|3837245_3837671_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3837667_3838018_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3838048_3839662_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 7
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	3875204	3884647	5177498		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|3875204_3876341_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|3876337_3878338_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3878462_3878924_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3878965_3879436_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3879482_3880202_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3880198_3881884_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3882105_3882837_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3882896_3883004_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|3882984_3883716_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|3883720_3884647_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 8
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	4286552	4331771	5177498	integrase,terminase,holin	Escherichia_phage(56.86%)	56	4288391:4288407	4328657:4328673
WP_000017552.1|4286552_4286705_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|4286722_4286914_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_014639259.1|4287224_4287743_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001521044.1|4287758_4288298_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
4288391:4288407	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_021523198.1|4288494_4288992_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	66.5	6.7e-48
WP_021523199.1|4288988_4289618_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	2.9e-112
WP_000256098.1|4289607_4289916_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	100.0	1.3e-49
WP_021523200.1|4289902_4290307_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.8	2.3e-62
WP_021523201.1|4290482_4293089_-	SGNH/GDSL hydrolase family protein	NA	G9L6E4	Escherichia_phage	65.2	2.7e-79
WP_001546908.1|4293284_4293542_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_001546909.1|4293679_4293811_+	ash family protein	NA	NA	NA	NA	NA
WP_001546910.1|4293856_4294549_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	2.2e-97
WP_000163644.1|4294678_4295005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000479990.1|4294991_4295504_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000708858.1|4295585_4295747_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147904.1|4295778_4296075_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_021523202.1|4296270_4298745_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
WP_021523203.1|4298750_4300553_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
WP_021523204.1|4300549_4303063_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.4	0.0e+00
WP_021523205.1|4303062_4303608_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	93.9	1.8e-86
WP_021523206.1|4303607_4304072_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_021523207.1|4304071_4306543_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
WP_000179265.1|4306542_4307148_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
WP_000424495.1|4307147_4307471_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_001546919.1|4307521_4307857_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	8.5e-55
WP_001546921.1|4307867_4308305_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	1.4e-70
WP_021523208.1|4308356_4309343_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	5.6e-187
WP_001546923.1|4309357_4310053_-	hypothetical protein	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|4310055_4310352_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_021523209.1|4310348_4312028_-	hypothetical protein	NA	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000335899.1|4312042_4312249_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_057950734.1|4313000_4313702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523211.1|4313913_4315383_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.8	6.8e-290
WP_024166494.1|4315379_4316090_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
WP_021523213.1|4316130_4316469_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	3.5e-56
WP_021523214.1|4316583_4317243_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.9	1.4e-53
WP_021523215.1|4317253_4318009_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
WP_021523216.1|4318010_4318907_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	88.9	2.9e-158
WP_021523217.1|4318903_4319380_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	68.8	9.4e-31
WP_016235747.1|4319441_4319786_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	8.2e-61
WP_001406039.1|4319903_4320689_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_021523218.1|4320685_4321501_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402896.1|4321516_4321717_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001282459.1|4321867_4322098_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|4322252_4322837_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|4322990_4323143_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_021523219.1|4323145_4323445_+	hypothetical protein	NA	G9L6A4	Escherichia_phage	99.0	5.8e-47
WP_021523220.1|4323441_4324263_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	1.5e-161
WP_001617197.1|4324259_4325201_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_000675390.1|4325250_4325499_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001341620.1|4325656_4325908_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_023153950.1|4325900_4326551_+	MT-A70 protein	NA	G9L699	Escherichia_phage	96.3	5.2e-125
WP_001055435.1|4326547_4327207_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_021523223.1|4327209_4328466_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	4.4e-237
WP_000138282.1|4328658_4330236_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4328657:4328673	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001296289.1|4330304_4331771_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 9
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	4548720	4555860	5177498		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|4548720_4551282_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|4551387_4552044_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|4552094_4552862_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|4553057_4553966_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|4553962_4555225_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4555221_4555860_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
NZ_CP021202	Escherichia coli strain Z1002 chromosome, complete genome	5177498	4803759	4847257	5177498	tRNA,protease,integrase,transposase	Staphylococcus_phage(25.0%)	44	4819633:4819647	4835262:4835276
WP_001319878.1|4803759_4804518_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|4804723_4805644_-	agmatinase	NA	NA	NA	NA	NA
WP_001556203.1|4805781_4807758_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4807766_4807898_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4808033_4808249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4808552_4809707_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4810142_4811537_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_032142436.1|4811613_4812111_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286517.1|4812205_4812913_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|4812992_4813724_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4813736_4814687_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4814795_4815359_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4815358_4815775_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001389259.1|4815949_4816930_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4816947_4817652_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4817669_4818236_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4818232_4818523_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|4818530_4819124_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|4819116_4820253_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
4819633:4819647	attL	CTGGAAGAGGCGCTT	NA	NA	NA	NA
WP_000745217.1|4820407_4821415_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4821531_4822578_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4822753_4823473_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001178593.1|4823493_4823634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107564.1|4823656_4823983_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4823982_4824702_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001295382.1|4824862_4825915_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4825942_4826218_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4826282_4827362_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4827563_4828820_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839790.1|4828868_4831004_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234533.1|4831396_4832104_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005761259.1|4832482_4833748_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.6	3.3e-75
WP_000612632.1|4836011_4836359_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
4835262:4835276	attR	AAGCGCCTCTTCCAG	NA	NA	NA	NA
WP_001221615.1|4837090_4837525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270971.1|4837512_4837914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|4838173_4838743_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000840364.1|4839862_4840129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|4840197_4840476_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813456.1|4840570_4841173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250228.1|4842375_4843293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057950850.1|4843377_4844250_+	GTPase family protein	NA	NA	NA	NA	NA
WP_004020235.1|4844635_4845457_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_089541817.1|4845584_4846812_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_088561087.1|4846996_4847257_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP021203	Escherichia coli strain Z1002 plasmid p1002-1, complete sequence	183508	3442	110390	183508	holin,integrase,tail,transposase,head	Escherichia_phage(63.0%)	109	12585:12644	113054:113874
WP_001389365.1|3442_4207_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|4700_5285_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|6517_7423_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|7544_8249_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362819.1|8383_8479_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_013362818.1|8604_9342_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_170852050.1|9286_9457_+	rRNA adenine methyltransferase	NA	E4ZFP9	Streptococcus_phage	92.7	3.4e-20
WP_013362817.1|9971_10421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023909256.1|10381_10723_+	chaperonin	NA	NA	NA	NA	NA
WP_013362816.1|10949_12482_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
12585:12644	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067834.1|12636_13341_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_072196854.1|13611_14109_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	57.3	2.9e-43
WP_000367942.1|14114_14726_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_023156927.1|15191_15620_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_032245979.1|15630_16116_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	5.8e-36
WP_064764636.1|16144_16621_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.4	2.4e-47
WP_085701450.1|16630_17059_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	69.3	1.4e-49
WP_001165547.1|17130_17703_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|18138_18402_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|18476_18806_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|18802_19246_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|19232_19835_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_086352858.1|19836_21756_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
WP_000175491.1|21752_22118_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_086352859.1|22130_25118_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
WP_001165937.1|25107_25416_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
WP_099368671.1|25619_25991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148486.1|26198_27554_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_000068872.1|27802_28291_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	79.0	1.3e-64
WP_001345478.1|28460_29018_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_024187336.1|29010_29259_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	1.0e-36
WP_000132937.1|29303_30323_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001312284.1|30435_31566_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
WP_025210446.1|31598_33320_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_060578233.1|33395_40163_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_000224043.1|40196_40637_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|40633_40882_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000526244.1|40918_42046_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
WP_023351534.1|42148_42790_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
WP_023356281.1|42979_43540_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.9	1.5e-99
WP_001224234.1|43786_44098_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_000067530.1|44148_45180_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	100.0	9.9e-195
WP_000542336.1|45187_45409_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000874156.1|46005_46215_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|46325_47177_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_032246984.1|47209_48328_-	phage antirepressor KilAC domain-containing protein	NA	A0A077SLR9	Escherichia_phage	88.7	3.7e-179
WP_071528000.1|48324_48684_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_000124159.1|48885_50370_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_060578234.1|50369_51563_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.0	9.8e-178
WP_001326849.1|51648_52101_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_029393260.1|52189_53233_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.4	1.7e-205
WP_000113018.1|53260_53440_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216045.1|53444_53825_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001190712.1|53824_54046_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_060578235.1|54228_55785_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.4e-104
WP_086352860.1|55781_57026_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_072650946.1|57147_60264_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
WP_060578216.1|60529_61036_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
WP_001774489.1|61108_62371_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	2.7e-234
WP_032162337.1|62672_63374_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	1.3e-142
WP_001354545.1|63370_64048_-	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484107.1|64044_64671_-	hypothetical protein	NA	A0A077SK52	Escherichia_phage	99.5	2.3e-122
WP_012817939.1|64568_65231_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000095380.1|65172_65328_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_060578240.1|65394_65973_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	96.9	2.0e-104
WP_000840930.1|65975_66221_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|66367_66745_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|66754_67972_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896801.1|67975_68704_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_060578241.1|68690_69476_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	7.9e-144
WP_000212025.1|69477_70494_+	hypothetical protein	NA	Q1MVH7	Enterobacteria_phage	100.0	3.5e-192
WP_000535203.1|70486_71119_+	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_060578242.1|71165_72164_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	97.6	3.4e-192
WP_001276599.1|72163_73528_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000234831.1|74000_74165_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_000900640.1|74164_74590_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_000660972.1|76147_78412_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.5	0.0e+00
WP_000472529.1|78408_79314_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|79306_79591_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001569402.1|80053_80842_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
WP_000007765.1|80881_81304_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_000336812.1|81329_81470_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281115.1|81479_81872_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_001113742.1|82207_83092_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154687.1|83384_84194_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|84362_85559_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|85575_86577_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_023153705.1|86803_88510_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_000085137.1|88570_90160_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
WP_000041757.1|90169_90985_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
WP_000035302.1|91020_91602_+	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000509939.1|91613_92123_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000268409.1|92294_92891_+	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.5	5.3e-108
WP_001426344.1|93073_93319_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_024188253.1|93369_94215_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	9.4e-151
WP_001187875.1|94244_95045_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_023154138.1|95209_96253_-	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	97.7	1.9e-185
WP_000245712.1|96249_96471_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_000908460.1|97051_97369_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_024166536.1|97376_98156_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	9.3e-145
WP_023153778.1|98403_98970_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_000523980.1|98980_99592_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926342.1|99606_100488_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_089477381.1|100569_104265_+	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.8	0.0e+00
WP_000002800.1|104264_104621_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047924.1|104617_106051_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
WP_001189832.1|106050_106887_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|106965_107400_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_001067834.1|109685_110390_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
113054:113874	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGATATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 1
NZ_CP021206	Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence	111688	20009	38587	111688	transposase,integrase	Escherichia_phage(44.44%)	15	13814:13873	37282:37505
13814:13873	attL	AAAAATGTCTGGTATAATAAGAATATCATCAATAAAATTGAGTGTTGCTCTGTGGATAAC	NA	NA	NA	NA
WP_000845048.1|20009_21023_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|21225_21576_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|21778_22543_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|23035_23620_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|23619_24858_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|24854_25760_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|25881_26586_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000587837.1|26795_27338_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|27350_28211_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|30379_31084_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|31325_32186_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067845.1|32741_33446_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_013362812.1|35196_36165_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001617865.1|36199_37075_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|37324_38587_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
37282:37505	attR	GTTATCCACAGAGCAACACTCAATTTTATTGATGATATTCTTATTATACCAGACATTTTTCATACACTCCCTTGTACGGATAGTTTTCCGACAACTTCATGATTACATATCTTGCGGTTTTGATTATTTTTGCTGCAAGAAATACATACTTCAAACGAAAGGTCTTTATTTGCTGTCTGTATTCTGAAGAGTCCAAGGAATCAAACTTGAACAACAAAAATAGG	NA	NA	NA	NA
