The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	397632	458640	5041366	lysis,tail,head,portal,terminase,integrase,capsid,transposase	Escherichia_phage(41.18%)	72	399003:399050	444105:444152
WP_000772656.1|397632_398841_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
399003:399050	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_057077950.1|399443_400583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429347.1|401208_401478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000461705.1|401615_401978_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_001730411.1|401970_403041_-	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_108084473.1|403492_403999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|404001_404412_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001619155.1|404392_404626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233083.1|407686_408286_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	6.3e-109
WP_048237154.1|408356_411854_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_047626228.1|411914_412562_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	7.3e-111
WP_047626227.1|412459_413203_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
WP_001152638.1|413208_413907_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|413906_414236_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|414232_416812_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|416804_417239_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548554.1|417220_417643_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_021548555.1|417658_418399_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|418406_418802_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|418798_419377_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|419388_419742_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|419753_420149_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|420190_421216_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|421271_421604_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|421613_422933_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|422913_424515_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|424511_424718_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|424714_426640_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|426614_427160_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001663509.1|427548_427782_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|427838_428249_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139675.1|428600_428753_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|428740_429208_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|429204_429702_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|429701_429917_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|429984_431037_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|431187_431391_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|431614_432040_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_039268527.1|432320_433073_-	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	99.2	8.1e-138
WP_001360050.1|433086_434076_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|434083_434893_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_021518589.1|435297_435624_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	4.5e-53
WP_001373594.1|435623_436118_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	100.0	3.9e-88
WP_000104977.1|436114_437056_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|437045_437225_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|437400_437952_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|437989_438190_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|438287_438914_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000559916.1|439141_439657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|440127_440490_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_057077927.1|440555_441380_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|441507_442044_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|442034_442397_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|442396_442702_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_077873866.1|442617_443052_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_057077906.1|442928_444092_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	7.0e-229
WP_000893278.1|444296_445550_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
444105:444152	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|445561_446665_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|446952_448008_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|448046_448448_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|448505_449750_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|449841_450300_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|450560_452018_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|452074_452611_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|452543_452810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|453115_453568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|453577_453976_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554758.1|453978_454272_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|454323_455379_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|455449_456220_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|456179_457919_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|458142_458640_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	466898	539740	5041366	plate,tRNA,transposase,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|466898_468035_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|468465_468858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|468835_473068_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|473143_475285_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|475494_476013_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|476707_477208_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|477242_477467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|477517_478993_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|478999_479413_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|479416_481267_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|481230_482313_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|482337_483618_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|483614_484139_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|484141_485473_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|485477_486239_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|486247_489013_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|489009_489753_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|489757_491170_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|491278_494713_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|494723_496076_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|496099_496582_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|496625_497540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|497549_498029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|498165_498951_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|499487_500219_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|500283_500751_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|500747_501470_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|501503_502259_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|502330_503689_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|503736_504360_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|504363_505164_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|505404_506319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|506315_507119_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|512877_513453_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|513640_514672_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|514664_515318_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|515357_516173_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|516290_516695_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|516691_517399_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|517510_519229_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|519282_520107_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|520306_521017_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|521030_521453_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|521449_521995_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|522160_522361_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|522347_522608_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|522656_523955_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|524019_524409_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|524465_526607_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|526705_527665_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|527677_531160_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|531196_531793_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|531789_532938_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|532937_533726_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|533729_534185_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|534289_535315_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|535318_535804_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|535925_538358_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|538387_539740_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 3
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	2229629	2236362	5041366		Escherichia_phage(44.44%)	11	NA	NA
WP_000004195.1|2229629_2231018_+	replicative DNA helicase	NA	O80281	Escherichia_phage	50.1	5.8e-113
WP_032353286.1|2231007_2232657_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_072668240.1|2232649_2233381_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	37.3	8.2e-18
WP_006859641.1|2233377_2233956_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_072668239.1|2233952_2234201_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.3	5.4e-06
WP_000063336.1|2234210_2234468_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	81.2	1.7e-31
WP_001229293.1|2234681_2235047_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	7.3e-68
WP_072674900.1|2235043_2235430_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.0	2.1e-41
WP_000951710.1|2235431_2235641_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_072668238.1|2235637_2236144_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	63.6	2.0e-15
WP_001696194.1|2236140_2236362_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	54.1	5.3e-13
>prophage 4
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	2573985	2581125	5041366		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2573985_2574624_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_086353591.1|2574620_2575883_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	4.9e-135
WP_000847993.1|2575879_2576788_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|2576983_2577751_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|2577801_2578458_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|2578563_2581125_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 5
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	2956907	3004399	5041366	holin,terminase,tail,head,lysis,integrase	Salmonella_phage(33.33%)	66	2949147:2949169	3003317:3003339
2949147:2949169	attL	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_000749077.1|2956907_2957099_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001706457.1|2957255_2958002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149819.1|2958003_2959290_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	3.2e-65
WP_001163428.1|2959542_2959743_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281193.1|2959866_2960211_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
WP_001277767.1|2960311_2960491_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_064770252.1|2960587_2961217_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.7	1.0e-53
WP_059329558.1|2961218_2961863_-	hypothetical protein	NA	K7P881	Enterobacteria_phage	58.9	1.8e-53
WP_001214460.1|2962499_2962667_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	3.3e-23
WP_001111278.1|2962677_2962971_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000168265.1|2963473_2963947_-	single-stranded DNA-binding protein	NA	Q716E8	Shigella_phage	99.4	1.2e-59
WP_000365280.1|2963947_2964655_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_001308813.1|2964909_2965185_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_106421809.1|2965306_2965378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032194733.1|2965532_2965805_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_086353667.1|2966276_2967272_-	SppA protein	NA	NA	NA	NA	NA
WP_021572762.1|2967447_2968152_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	1.9e-133
WP_000064149.1|2968265_2968499_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_001735519.1|2968637_2968934_+	regulatory protein CII	NA	G9L678	Escherichia_phage	96.9	4.4e-47
WP_000185505.1|2968966_2969866_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788877.1|2969862_2970564_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145931.1|2970560_2970851_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|2970924_2971365_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_016063117.1|2971361_2971544_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_000567007.1|2971540_2971711_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_086353598.1|2971703_2972312_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	98.5	9.6e-97
WP_086353599.1|2972308_2972980_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.0	1.8e-128
WP_015973887.1|2972970_2973489_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	100.0	9.0e-96
WP_086353600.1|2973950_2974274_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	98.1	7.2e-51
WP_086353601.1|2974257_2974734_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	98.7	2.4e-87
WP_086353602.1|2974730_2975198_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_057077893.1|2975273_2975828_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.4	3.0e-65
WP_023565726.1|2975830_2977453_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.9	0.0e+00
WP_086353603.1|2977452_2978919_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.3	3.6e-267
WP_086353604.1|2978806_2979544_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
WP_086353605.1|2979558_2980779_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.8	5.8e-202
WP_057077880.1|2980782_2981289_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_023565721.1|2981300_2982242_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.5	3.4e-157
WP_001096924.1|2982283_2982505_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	1.0e-11
WP_023565719.1|2982470_2982878_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	3.5e-71
WP_057077881.1|2982874_2983429_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	6.1e-82
WP_001142482.1|2983415_2983805_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
WP_033544654.1|2983779_2984343_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_086353606.1|2984346_2985492_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	2.1e-161
WP_000109249.1|2985502_2985943_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_023565715.1|2985946_2986399_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_086353607.1|2986576_2988529_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	64.0	1.2e-164
WP_047643983.1|2988528_2989179_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	3.1e-61
WP_086353608.1|2989182_2989485_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	58.0	5.2e-27
WP_032330411.1|2989487_2990522_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.2	2.1e-99
WP_000755137.1|2990518_2990854_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	55.6	1.6e-24
WP_001302649.1|2990878_2991199_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2991306_2991480_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_086353609.1|2991551_2992430_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	1.7e-94
WP_086353610.1|2992490_2993246_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	78.7	7.5e-91
WP_001270637.1|2993245_2993599_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_086353611.1|2993598_2994798_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.1	2.4e-184
WP_086353612.1|2994794_2995568_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	53.3	4.8e-77
WP_086353613.1|2998202_2999015_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	36.4	2.9e-40
WP_057077890.1|2999108_2999348_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	8.0e-15
WP_057077891.1|2999347_2999665_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	2.4e-22
WP_105310546.1|2999887_3000076_-|integrase	tyrosine-type recombinase/integrase	integrase	A5VW56	Enterobacteria_phage	98.4	5.3e-30
WP_086353614.1|3000591_3001491_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	73.7	1.1e-61
WP_086353615.1|3001493_3001910_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.8	1.2e-21
WP_086353616.1|3001997_3003155_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	3.4e-220
WP_000368131.1|3003466_3004399_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3003317:3003339	attR	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	3270548	3333316	5041366	plate,lysis,protease,terminase,tail,head,portal,tRNA,integrase,capsid,transposase	Escherichia_phage(24.39%)	69	3297790:3297811	3331784:3331805
WP_001300883.1|3270548_3272582_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001005448.1|3272713_3273823_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|3274085_3274367_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|3274659_3275202_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|3275281_3275956_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_038999767.1|3275971_3278452_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405713.1|3278467_3279502_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_047149163.1|3279583_3279922_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134636.1|3280140_3280965_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3281085_3281358_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195564.1|3281580_3282369_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3282365_3283166_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_029488678.1|3283230_3284049_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_047149162.1|3284100_3284847_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|3284820_3285786_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|3285782_3286787_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858484.1|3286783_3288061_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|3288317_3289370_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001307281.1|3289677_3290532_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_047149161.1|3290560_3291823_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|3291832_3292285_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|3292315_3292600_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3292603_3293959_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|3294006_3295047_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3295146_3295926_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807356.1|3296007_3296907_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|3297312_3297630_+	hypothetical protein	NA	NA	NA	NA	NA
3297790:3297811	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_000111938.1|3297895_3298909_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	83.6	1.4e-164
WP_000613396.1|3299005_3299302_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	8.6e-35
WP_001082439.1|3299437_3299713_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	4.4e-41
WP_004010431.1|3299890_3300391_+	hypothetical protein	NA	M1SV55	Escherichia_phage	83.1	1.1e-77
WP_000549519.1|3300457_3300676_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	64.0	1.6e-09
WP_000027679.1|3300698_3300974_+	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	47.7	5.2e-18
WP_047149159.1|3300963_3303255_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
WP_047149158.1|3303254_3303713_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	53.0	9.6e-41
WP_001396141.1|3303729_3303954_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	6.4e-14
WP_064756689.1|3304254_3305883_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000906719.1|3305885_3306998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747182.1|3307093_3308101_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.1	1.1e-161
WP_000156051.1|3308102_3309872_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.7	4.7e-301
WP_047149156.1|3310038_3310893_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.9	4.8e-118
WP_001742976.1|3310953_3312021_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	3.9e-170
WP_047149155.1|3312024_3312780_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	72.2	4.6e-80
WP_046276225.1|3312879_3313386_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
WP_047149154.1|3313385_3313589_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	83.6	1.3e-26
WP_000524521.1|3313579_3313801_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.2e-27
WP_004010248.1|3313784_3314294_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.4e-80
WP_004010253.1|3314290_3314716_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.6	2.1e-42
WP_004010256.1|3314811_3315279_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.5e-60
WP_004010258.1|3315271_3315718_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	1.8e-47
WP_000019473.1|3316068_3317049_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_157662034.1|3317080_3318103_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_029392305.1|3318089_3318668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029392303.1|3318931_3319573_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	81.2	7.3e-95
WP_004010220.1|3319569_3319920_+	lysozyme family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
WP_047149153.1|3319925_3320834_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.5	5.0e-134
WP_004010222.1|3320826_3321357_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	8.1e-92
WP_029392299.1|3321368_3323054_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	60.0	6.1e-125
WP_000143189.1|3323053_3323632_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	52.1	8.4e-50
WP_047149152.1|3323767_3324961_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	4.4e-186
WP_047149151.1|3324973_3325492_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.1	2.5e-77
WP_000789944.1|3325546_3325861_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	63.9	1.9e-27
WP_000763322.1|3325893_3326016_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
WP_047149150.1|3326005_3328447_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	4.2e-308
WP_000928499.1|3328460_3328925_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	3.2e-60
WP_000627827.1|3328921_3330085_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.3	1.7e-171
WP_000468306.1|3330165_3330387_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	4.5e-28
WP_001059829.1|3330693_3331545_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000476014.1|3331954_3333316_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
3331784:3331805	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
>prophage 7
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	4317939	4324377	5041366		Enterobacteria_phage(33.33%)	9	NA	NA
WP_000332303.1|4317939_4318671_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|4318891_4319296_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|4319348_4319459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|4319996_4320320_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000539894.1|4320422_4320575_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_042346543.1|4320926_4321370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042346540.1|4321556_4322822_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	2.1e-207
WP_004179627.1|4322823_4323243_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_022066379.1|4323807_4324377_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	98.3	3.9e-92
>prophage 8
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	4327607	4421485	5041366	holin,protease,tail,head,tRNA,portal,terminase,integrase,capsid,transposase	Escherichia_phage(31.03%)	111	4372321:4372335	4421587:4421601
WP_057077864.1|4327607_4329947_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	76.3	4.0e-50
WP_057077865.1|4330023_4333092_-	kinase	NA	A0A286S259	Klebsiella_phage	96.0	0.0e+00
WP_042346234.1|4333088_4333469_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	6.2e-70
WP_042346237.1|4333479_4333962_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	95.6	2.8e-83
WP_042346239.1|4333948_4334428_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	3.3e-92
WP_042346242.1|4334427_4336863_-|tail	phage tail length tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.4	0.0e+00
WP_042346245.1|4336932_4337325_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_032432338.1|4337388_4337652_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	92.0	3.6e-40
WP_042346250.1|4337654_4338038_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	92.3	4.0e-56
WP_017880225.1|4338081_4338573_-|tail	major tail subunit	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.3e-88
WP_049162797.1|4338629_4338995_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	94.2	9.3e-63
WP_042346256.1|4338991_4339531_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	2.2e-92
WP_023317183.1|4339523_4339856_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	3.4e-56
WP_042346260.1|4339857_4340070_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_042346263.1|4340130_4340457_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	97.2	3.7e-55
WP_042346268.1|4340684_4341848_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.0	1.5e-210
WP_000019473.1|4342101_4343082_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_042346275.1|4343745_4345023_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.2e-245
WP_042346278.1|4345025_4346558_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	5.1e-296
WP_042346281.1|4346567_4347002_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	1.1e-73
WP_042346284.1|4347123_4347333_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	82.6	5.3e-23
WP_040182580.1|4347345_4347636_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_042346292.1|4348265_4348895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086353650.1|4349033_4349819_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_042346301.1|4350042_4350318_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	3.7e-24
WP_042346304.1|4350314_4350623_-	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	51.5	6.7e-14
WP_042346306.1|4350624_4351254_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	1.0e-85
WP_019705280.1|4351253_4351535_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|4351521_4351917_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_057077933.1|4352046_4352643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042345959.1|4352718_4353297_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_042345962.1|4353310_4354291_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
WP_000779146.1|4354303_4354681_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_042345965.1|4354690_4355500_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	7.7e-110
WP_042345967.1|4355496_4356411_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_023317571.1|4356367_4356580_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|4356817_4357279_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001191665.1|4357313_4357556_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_040219347.1|4357653_4358349_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	72.0	1.6e-87
WP_023301986.1|4358712_4359012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042345976.1|4359011_4359797_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	1.3e-61
WP_042345979.1|4359793_4359985_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	87.3	1.2e-26
WP_000089156.1|4360048_4360285_+	excisionase	NA	NA	NA	NA	NA
WP_042345983.1|4360274_4361417_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.6	5.9e-172
WP_000444493.1|4361529_4362780_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_001248681.1|4362951_4363605_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|4363614_4364076_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|4364129_4365236_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|4365271_4365913_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|4365916_4367287_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|4367455_4368127_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|4368126_4369587_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|4369662_4370784_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|4370832_4372059_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|4372308_4373445_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
4372321:4372335	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|4373428_4374292_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|4374846_4375515_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072146730.1|4375472_4375664_-	hypothetical protein	NA	A0A291AX19	Escherichia_phage	89.5	1.0e-12
WP_085948620.1|4375629_4376843_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_042047081.1|4377065_4377596_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|4378329_4378701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|4379009_4380518_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|4384471_4385071_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|4385138_4388618_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|4388678_4389287_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|4389223_4389967_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|4389972_4390671_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|4390670_4391027_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|4391004_4394232_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|4394278_4394539_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|4394580_4394967_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|4394966_4395671_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|4395731_4396076_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|4396072_4396522_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|4396518_4396857_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|4396865_4397183_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|4397259_4398477_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|4398491_4399091_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|4399083_4400310_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|4400457_4402215_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|4402214_4402697_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|4402844_4403195_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|4403720_4404014_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|4404104_4404287_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|4404503_4405037_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|4405100_4405451_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|4405455_4405671_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|4405978_4406167_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|4406427_4406763_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|4406833_4407046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|4407534_4407621_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|4408015_4408837_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|4408833_4409214_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|4409214_4410273_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|4410274_4410553_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|4410720_4410933_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|4411967_4412150_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|4412243_4412600_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|4412657_4413080_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|4413120_4414191_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|4414262_4414688_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|4414671_4414914_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|4415305_4415644_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|4416075_4416276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4416368_4416587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|4416551_4416755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|4417155_4417344_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|4417340_4417532_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|4417625_4420067_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|4420128_4420398_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|4420366_4421485_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
4421587:4421601	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 9
NZ_CP021175	Escherichia coli strain 5CRE51 chromosome, complete genome	5041366	4741622	4772834	5041366	protease,integrase,transposase	Enterobacteria_phage(20.0%)	24	4736115:4736129	4778125:4778139
4736115:4736129	attL	CCAGCAACCAGCAGC	NA	NA	NA	NA
WP_086353658.1|4741622_4743164_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	2.9e-129
WP_001016257.1|4743178_4743925_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001345400.1|4744093_4745140_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|4745814_4746006_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|4746058_4746292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|4746387_4747011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023153739.1|4747099_4747609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|4748066_4748525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000262203.1|4750502_4751801_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677245.1|4751866_4752586_-	amino acid racemase	NA	NA	NA	NA	NA
WP_001333359.1|4752930_4753875_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001423524.1|4754928_4755126_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	72.2	2.0e-16
WP_032277686.1|4756585_4756990_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	92.5	1.2e-63
WP_001440936.1|4756986_4757250_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.8	4.1e-44
WP_000035067.1|4757693_4757882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233440.1|4757899_4760260_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	6.9e-34
WP_032277685.1|4760414_4760978_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000019473.1|4762793_4763774_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000579535.1|4764650_4764848_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|4765074_4765371_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_086353660.1|4766482_4768300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|4768486_4769689_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|4770206_4772483_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4772513_4772834_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
4778125:4778139	attR	CCAGCAACCAGCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP021177	Escherichia coli strain 5CRE51 plasmid p5CRE51-NDM-9 sequence	154099	24240	97543	154099	transposase,integrase	Escherichia_phage(28.0%)	78	35731:35746	97547:98367
WP_087522250.1|24240_25609_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|25708_25867_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|26285_26489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|26534_26885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031421.1|26944_27544_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778030.1|27643_28588_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001272970.1|29689_30874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|30939_31221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|31477_31684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|31804_32101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|32145_32583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|32650_33187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|33351_33720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|34152_34455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|34811_35096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|35161_35515_+	hypothetical protein	NA	NA	NA	NA	NA
35731:35746	attL	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
WP_000422741.1|35950_36376_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
35731:35746	attL	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
WP_072647959.1|36372_36723_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_000080195.1|36753_38367_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_072647958.1|38353_39073_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|39074_40256_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|40266_40929_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|40915_42025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|42024_44109_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|44108_47255_-	helicase	NA	NA	NA	NA	NA
WP_000128631.1|47264_48002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|47998_48484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|49242_50043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|50044_50557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|51150_52197_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|52186_53602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072647581.1|53610_57564_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001284752.1|57744_59034_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_024136329.1|59141_59708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|59790_60330_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|60477_61227_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|61251_61644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|61677_62100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|62159_62771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|62877_63687_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|63732_64992_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|64975_65410_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|65603_66221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|66370_66727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|66977_67148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|67184_67889_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|68383_69010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|69514_70390_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|70627_71332_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839978.1|71831_72620_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|72619_73138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|73142_73559_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|73944_74649_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|74923_75937_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|76081_76579_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|76689_76980_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|76985_77777_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|77940_78288_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|78281_79121_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|79525_81067_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
79306:79321	attR	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
WP_004201171.1|81507_81837_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
79306:79321	attR	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
WP_004201169.1|81841_82873_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|82883_83522_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|83526_83892_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_032495672.1|83895_84708_-	subclass B1 metallo-beta-lactamase NDM-9	NA	NA	NA	NA	NA
WP_072649515.1|84808_85012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|85002_85707_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_157662037.1|85754_86213_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	56.6	2.8e-40
WP_001067858.1|86496_87201_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_157662038.1|87225_87594_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|87719_88280_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|88282_91249_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_046788546.1|91257_91659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|91743_92448_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|93372_94257_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|94473_95688_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|95715_96021_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|96838_97543_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
97547:98367	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCCACCTATGTGCTCGACGGC	NA	NA	NA	NA
