The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	246426	288322	5591645	holin,lysis,terminase,tail,head	Salmonella_phage(38.3%)	67	NA	NA
WP_004224598.1|246426_246942_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|247234_247393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|248004_248265_-	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_086893320.1|248362_248659_-	hypothetical protein	NA	A0A1U8QJU8	Salmonella_virus	54.8	1.3e-19
WP_086893321.1|248655_249378_-	hypothetical protein	NA	Q71T76	Escherichia_phage	73.6	9.0e-94
WP_048265754.1|249370_249715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893322.1|249711_249936_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.1e-18
WP_086893323.1|249932_250496_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	5.3e-25
WP_124053771.1|250504_250726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032454804.1|250798_251092_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_074189305.1|251565_251760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158874.1|251725_251944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893442.1|252154_252364_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	89.9	3.6e-27
WP_025714807.1|252392_252797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893443.1|252941_253340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086893324.1|253453_253705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047664973.1|253708_254122_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	9.9e-45
WP_047664972.1|254135_254384_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_086893325.1|254380_255475_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	5.7e-31
WP_086893326.1|255501_255897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|255896_256118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893327.1|256110_256896_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	1.1e-63
WP_019705292.1|256892_257096_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_071033563.1|257088_257328_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.1	3.2e-32
WP_046878918.1|257324_257525_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	52.5	7.9e-08
WP_086893328.1|257517_258291_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	47.5	1.3e-45
WP_080816389.1|258337_258607_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	1.2e-35
WP_023312768.1|258848_259157_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.6	2.1e-23
WP_086893329.1|259149_259809_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	2.4e-101
WP_086893330.1|259805_260384_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	1.2e-48
WP_124060769.1|261196_261718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542609.1|261877_262147_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032420388.1|262124_262622_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.0	1.8e-77
WP_065809763.1|262618_263089_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	58.4	1.1e-42
WP_085846336.1|263100_263343_+	DUF1378 family protein	NA	NA	NA	NA	NA
WP_065809765.1|263429_263921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065809778.1|263993_264770_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	67.9	6.4e-13
WP_021312714.1|264720_266121_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_086893331.1|266359_267811_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	1.9e-191
WP_086893444.1|267866_268415_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.0	8.2e-47
WP_086893332.1|268573_269776_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.9	5.3e-107
WP_071570697.1|269779_270274_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	5.5e-50
WP_040217289.1|270285_271227_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.0e-137
WP_071570698.1|271266_271548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893333.1|271516_271936_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	5.7e-40
WP_086893334.1|271932_272439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893335.1|272438_272843_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	70.8	1.1e-43
WP_086893336.1|272835_273387_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	45.5	5.2e-41
WP_029498708.1|273388_274540_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.7	1.6e-177
WP_029498705.1|274550_274991_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	4.7e-61
WP_029498703.1|274994_275414_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	3.0e-41
WP_016244729.1|275455_275608_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_086893337.1|275597_277595_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	63.7	5.7e-239
WP_086893338.1|277594_278170_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.4	2.8e-61
WP_086893339.1|278170_278473_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.1	2.2e-25
WP_086893340.1|278475_279540_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	66.9	2.2e-133
WP_086893341.1|279542_279896_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	80.8	3.2e-28
WP_137512694.1|279896_280514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665535.1|280568_281222_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.7	2.0e-71
WP_029498691.1|281223_281577_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.3e-50
WP_062920893.1|281576_282776_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.2	5.8e-162
WP_073511702.1|282772_283546_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	1.9e-65
WP_029498898.1|283545_284331_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	53.5	5.3e-31
WP_086893342.1|284330_284909_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	3.8e-50
WP_086893343.1|286795_287065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893344.1|287061_287274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040174799.1|287899_288322_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
>prophage 2
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	366533	377420	5591645		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|366533_367154_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|367146_368412_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|368423_369326_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|369586_370348_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|370368_371229_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|371526_371787_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|371873_372962_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|372992_374258_-	MFS transporter	NA	NA	NA	NA	NA
WP_004190234.1|374312_377420_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 3
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1117809	1180153	5591645	plate,portal,capsid,integrase,tRNA,terminase,tail,head,protease	Enterobacteria_phage(45.16%)	70	1110014:1110030	1175881:1175897
1110014:1110030	attL	GCTGGCGTCGCGTCGGC	NA	NA	NA	NA
WP_002910830.1|1117809_1118556_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910832.1|1118572_1119388_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_002910835.1|1119384_1120314_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_004180417.1|1120307_1121747_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004175476.1|1122131_1123877_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_004189310.1|1124128_1126249_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002910846.1|1126290_1126902_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
WP_002910883.1|1127077_1127992_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_004189307.1|1128084_1129818_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_071570875.1|1130397_1130646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570876.1|1130690_1131845_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	2.1e-177
WP_071570877.1|1131998_1133180_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	68.8	3.0e-155
WP_032424801.1|1133179_1133695_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.6	1.5e-63
WP_032426989.1|1133749_1134049_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	71.9	8.5e-30
WP_114141655.1|1134078_1134219_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	67.5	1.0e-09
WP_077271905.1|1134202_1137130_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.2	7.7e-208
WP_040197746.1|1137140_1137629_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.7e-54
WP_071570880.1|1137757_1138921_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.4	5.3e-43
WP_071570881.1|1139000_1139300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570882.1|1139311_1141360_-	hypothetical protein	NA	A0A1W5PUZ2	Salmonella_phage	35.2	1.3e-15
WP_049118716.1|1141364_1141961_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.9	3.3e-41
WP_071570883.1|1141953_1142853_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	1.1e-91
WP_071570884.1|1142839_1143208_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	8.0e-30
WP_071570885.1|1143204_1143789_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.7	2.3e-63
WP_071570886.1|1143788_1144430_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.7	6.2e-46
WP_071570887.1|1144426_1144885_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	9.6e-33
WP_071570888.1|1145029_1145425_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_071570889.1|1145421_1145973_-	lysozyme	NA	I7K3G5	Yersinia_phage	38.3	3.3e-27
WP_032424784.1|1145969_1146251_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
WP_032424783.1|1146241_1146442_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_071570890.1|1146441_1146939_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.8e-61
WP_071570891.1|1147041_1147956_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	8.5e-89
WP_032424780.1|1148003_1149053_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.8e-106
WP_070550023.1|1149077_1149911_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	5.5e-95
WP_071570892.1|1150071_1151793_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.6	6.9e-225
WP_071570893.1|1151792_1152839_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	9.9e-142
WP_071570894.1|1153438_1154413_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_071570895.1|1154639_1157234_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.9	1.0e-195
WP_086893355.1|1157258_1158245_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	62.9	3.1e-68
WP_157665536.1|1158220_1158373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077271908.1|1158383_1158611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570898.1|1159555_1159750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570899.1|1159746_1159974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570900.1|1159982_1160561_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	2.4e-33
WP_071570901.1|1160557_1160782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570983.1|1160851_1161124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737937.1|1161126_1161366_-	DUF4754 domain-containing protein	NA	NA	NA	NA	NA
WP_086893446.1|1161362_1161590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737939.1|1161619_1161886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064174338.1|1161967_1162267_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	55.2	7.7e-23
WP_064174353.1|1162331_1163300_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	46.3	3.8e-79
WP_032426923.1|1163303_1163693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426928.1|1163807_1164119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189304.1|1164254_1165325_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_004175465.1|1165334_1166633_-	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
WP_002910889.1|1166954_1168487_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002910890.1|1168561_1169281_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_004189299.1|1169529_1171080_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002910894.1|1171208_1171739_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002910895.1|1171889_1172234_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_002910896.1|1172240_1172687_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004189297.1|1172781_1173441_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002910898.1|1173457_1173739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910899.1|1173865_1174564_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002910900.1|1174587_1175400_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002910902.1|1175403_1175673_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_004189293.1|1175749_1176877_-	ribonuclease D	NA	NA	NA	NA	NA
1175881:1175897	attR	GCCGACGCGACGCCAGC	NA	NA	NA	NA
WP_002910904.1|1176946_1178632_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|1178837_1179419_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004189291.1|1179457_1180153_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1266985	1303848	5591645	holin,integrase,transposase,terminase,tail	uncultured_Caudovirales_phage(30.3%)	48	1260024:1260037	1305841:1305854
1260024:1260037	attL	GCTGGCGGGTCGTC	NA	NA	NA	NA
WP_032714848.1|1266985_1267345_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	40.4	2.1e-14
WP_086893357.1|1267341_1267878_-	lysozyme	NA	H6WRZ4	Salmonella_phage	76.7	8.0e-79
WP_086893358.1|1267861_1268089_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	69.1	4.2e-21
WP_135668099.1|1268307_1269042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893359.1|1269246_1269459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893360.1|1269455_1269725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665537.1|1269734_1271420_-	hypothetical protein	NA	T1SBJ2	Salmonella_phage	39.5	1.2e-11
WP_014386491.1|1271401_1272382_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_086893362.1|1272943_1274554_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.2	1.1e-221
WP_086893363.1|1274550_1274898_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	46.9	4.6e-19
WP_157665538.1|1274979_1275501_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	52.1	6.2e-36
WP_086893364.1|1275501_1278396_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	70.2	0.0e+00
WP_086893365.1|1278395_1281110_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	59.1	2.3e-291
WP_086893366.1|1281115_1281604_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	47.0	6.0e-09
WP_086893367.1|1281606_1282059_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	8.9e-23
WP_086893368.1|1282058_1284050_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.5	1.9e-186
WP_086893369.1|1284049_1284613_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.7	3.4e-48
WP_086893370.1|1284672_1285578_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	9.7e-45
WP_086893371.1|1285793_1286150_-	hypothetical protein	NA	A0AR14	Salmonella_phage	73.6	4.4e-41
WP_086893372.1|1286183_1287032_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	41.2	1.7e-43
WP_032409894.1|1287018_1287252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893373.1|1287248_1288874_-|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.5	2.6e-173
WP_032409891.1|1288877_1289099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893374.1|1289109_1289550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365933.1|1289578_1289875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665539.1|1289878_1290043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893375.1|1290030_1290408_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	47.4	1.7e-19
WP_086893376.1|1290325_1290823_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	42.2	2.8e-17
WP_015365932.1|1290812_1291409_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.7	2.3e-79
WP_042945558.1|1291477_1291669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893377.1|1291812_1292151_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.4	4.3e-46
WP_086893378.1|1292163_1292781_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004141582.1|1292777_1293008_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_015365927.1|1293010_1293601_-	adenine DNA methyltransferase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	85.0	7.9e-96
WP_064164989.1|1293746_1293980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064168734.1|1293983_1294652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893451.1|1294690_1296085_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
WP_086893452.1|1296093_1297062_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
WP_015365921.1|1297079_1297238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|1297321_1297768_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_049099638.1|1297830_1298028_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	57.6	4.1e-09
WP_077259849.1|1298096_1298510_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	57.5	2.7e-34
WP_050597398.1|1299208_1299442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893379.1|1299486_1301640_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	3.1e-97
WP_086893380.1|1301639_1302206_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	4.6e-53
WP_015365915.1|1302207_1302393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893381.1|1302602_1302848_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.0	1.4e-06
WP_086893382.1|1302831_1303848_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.5	4.8e-125
1305841:1305854	attR	GACGACCCGCCAGC	NA	NA	NA	NA
>prophage 5
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1390139	1399588	5591645		Escherichia_phage(25.0%)	9	NA	NA
WP_042943910.1|1390139_1391144_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	2.3e-31
WP_004144151.1|1391544_1391667_+	small membrane protein	NA	NA	NA	NA	NA
WP_009484573.1|1392090_1393257_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_029498789.1|1393437_1393992_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	8.6e-52
WP_029498787.1|1394006_1394897_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|1394928_1395798_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_042943911.1|1395824_1396889_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
WP_014343305.1|1397111_1398518_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_077271909.1|1398745_1399588_-	glycosyltransferase	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	30.3	2.4e-13
>prophage 6
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1442704	1449609	5591645	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|1442704_1444183_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1444179_1444902_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1445220_1446582_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|1446827_1447721_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_023307294.1|1447961_1448735_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|1448745_1449609_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1677167	1702209	5591645	transposase,tail	Klebsiella_phage(26.92%)	30	NA	NA
WP_086893390.1|1677167_1678952_-	hypothetical protein	NA	H2BD96	Pseudomonas_phage	32.6	7.9e-14
WP_086893391.1|1679009_1682078_-	kinase	NA	A0A286S259	Klebsiella_phage	91.5	0.0e+00
WP_086893392.1|1682074_1682455_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_004207033.1|1682584_1682854_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_086893393.1|1682834_1683203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043875397.1|1683212_1683695_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	1.9e-79
WP_004207036.1|1683691_1684162_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_086893394.1|1684161_1686597_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.9	0.0e+00
WP_157665541.1|1686666_1686915_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	44.3	5.6e-11
WP_086893395.1|1686932_1688036_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.9	1.1e-05
WP_031280381.1|1688218_1688665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|1688570_1688828_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_004899672.1|1689140_1689719_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_065808870.1|1689732_1690713_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_071570941.1|1690725_1691103_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	6.7e-48
WP_086893396.1|1691112_1691922_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	5.9e-110
WP_017880208.1|1691918_1692872_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
WP_085206676.1|1692861_1693041_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_086893397.1|1693278_1693731_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.8	1.9e-65
WP_040188689.1|1693765_1693963_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	84.6	3.0e-23
WP_040188688.1|1694062_1694719_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	88.1	1.5e-108
WP_017880281.1|1695064_1695364_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	49.5	1.5e-13
WP_071570944.1|1695363_1696149_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	9.9e-62
WP_019705292.1|1696145_1696349_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_071033563.1|1696341_1696581_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.1	3.2e-32
WP_046878918.1|1696577_1696778_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	52.5	7.9e-08
WP_077258766.1|1697298_1697547_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.6	2.7e-13
WP_071570946.1|1697901_1698765_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.4	1.1e-34
WP_002913367.1|1700477_1700960_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023158760.1|1701327_1702209_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
>prophage 8
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	1946838	1953834	5591645		Enterobacteria_phage(50.0%)	6	NA	NA
WP_002914164.1|1946838_1947321_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_071570987.1|1949136_1951095_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	33.5	2.7e-76
WP_071570988.1|1951142_1952204_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	38.5	1.0e-53
WP_004899969.1|1952527_1952992_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-40
WP_023278769.1|1953083_1953428_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	73.7	5.3e-44
WP_157665542.1|1953624_1953834_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	87.3	1.3e-21
>prophage 9
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	2618973	2676411	5591645	portal,tRNA,capsid,terminase,tail,head,protease	uncultured_Caudovirales_phage(62.5%)	63	NA	NA
WP_004188423.1|2618973_2619468_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|2619471_2620110_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|2620421_2620814_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|2620829_2621258_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_040189582.1|2621523_2622651_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|2622841_2623240_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004174125.1|2623413_2624781_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|2624868_2625927_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_023279306.1|2625952_2626663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188415.1|2626722_2628024_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_071571005.1|2628039_2629809_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004188412.1|2629824_2630076_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004188410.1|2630217_2630835_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_004188409.1|2630834_2631734_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_004181428.1|2631766_2633035_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	1.8e-60
WP_004181429.1|2633246_2633912_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086893406.1|2633898_2634528_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002918570.1|2634658_2635597_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|2636011_2636482_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_004889568.1|2636857_2637121_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|2637219_2637486_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|2637536_2637812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|2637891_2639859_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|2639864_2640797_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|2640804_2641008_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|2641139_2642069_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_004144958.1|2642104_2643550_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004174111.1|2643638_2647436_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|2647473_2648943_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|2648945_2649527_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|2649534_2650023_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|2650022_2651015_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|2651085_2652129_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|2652434_2654375_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|2654454_2654646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174108.1|2654874_2655876_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_004185869.1|2655875_2656484_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004174104.1|2656707_2657160_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|2657182_2657650_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|2657660_2659010_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|2659120_2659363_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004188394.1|2659352_2660804_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|2660815_2661697_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|2662054_2663020_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2663044_2663341_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|2663494_2663686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|2663688_2665350_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|2665333_2665690_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|2665965_2666409_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|2666408_2666708_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|2666704_2667040_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|2667036_2668278_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|2668279_2668840_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|2668891_2670058_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|2670321_2670834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|2670882_2671218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2671560_2673696_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|2673695_2674061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|2674057_2674426_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|2674422_2674737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|2674729_2674918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|2674910_2675180_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|2675631_2676411_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 10
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	4504764	4548228	5591645	holin,integrase,tRNA,lysis,terminase,tail	uncultured_Caudovirales_phage(30.77%)	67	4504934:4504949	4537026:4537041
WP_004191607.1|4504764_4506150_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
4504934:4504949	attL	TCGGCTATAAGCTGAA	NA	NA	NA	NA
WP_004143016.1|4506195_4506408_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|4506409_4507276_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_137056379.1|4507706_4508543_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.4	1.0e-141
WP_004223135.1|4508746_4509082_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_019704094.1|4509094_4509334_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	5.9e-10
WP_071570656.1|4509392_4509920_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	59.8	7.1e-56
WP_071570658.1|4509916_4510075_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	5.1e-10
WP_014342890.1|4510071_4510695_-	hypothetical protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_023283325.1|4510691_4511195_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	6.0e-12
WP_071570660.1|4511206_4511491_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	1.0e-29
WP_032717012.1|4511580_4511775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986758.1|4512391_4512595_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_071570777.1|4512792_4513128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837632.1|4513432_4513552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025987689.1|4513574_4514273_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	3.4e-106
WP_004201115.1|4514384_4514612_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_071570664.1|4514652_4514874_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_047684223.1|4515098_4515998_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	1.6e-87
WP_071570668.1|4515987_4517418_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	4.4e-185
WP_071570669.1|4517417_4517711_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	4.3e-26
WP_071570671.1|4517707_4518286_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	29.8	1.1e-06
WP_071570673.1|4518282_4518513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893426.1|4518502_4519129_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	69.7	3.0e-45
WP_071570675.1|4519129_4519324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570679.1|4519871_4520213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570681.1|4520205_4520445_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	58.1	3.0e-14
WP_071570683.1|4520610_4521207_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_032413853.1|4521212_4521383_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_071570685.1|4521375_4522014_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_071570686.1|4522010_4522211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570688.1|4522337_4523027_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	9.3e-64
WP_012542609.1|4523511_4523781_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_071570779.1|4523758_4524256_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.0	8.2e-78
WP_077268745.1|4524252_4524717_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	56.5	7.0e-39
WP_134905963.1|4525474_4525726_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	92.9	2.2e-15
WP_049162787.1|4525756_4525936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570691.1|4526048_4526804_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	57.3	4.7e-77
WP_071570692.1|4526901_4527222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570693.1|4527273_4528050_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	64.2	4.2e-12
WP_071570694.1|4528000_4529401_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
WP_071570695.1|4529638_4531090_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	2.9e-192
WP_071570780.1|4531145_4531694_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	4.8e-47
WP_071570696.1|4531745_4532948_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.9	6.1e-111
WP_071570697.1|4532951_4533446_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	5.5e-50
WP_040217289.1|4533457_4534399_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.0e-137
WP_071570698.1|4534438_4534720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893427.1|4534688_4535108_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_071570700.1|4535104_4535611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312779.1|4535610_4535997_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_071570701.1|4536091_4536532_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	7.8e-40
WP_071570851.1|4536535_4537681_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	1.6e-164
4537026:4537041	attR	TCGGCTATAAGCTGAA	NA	NA	NA	NA
WP_023312781.1|4537690_4538134_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802505.1|4538137_4538557_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_049073657.1|4538598_4538751_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	1.7e-18
WP_071570850.1|4538740_4540744_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.1	2.2e-243
WP_023158909.1|4540743_4541343_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	5.8e-54
WP_042929830.1|4541343_4541646_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.2	5.2e-27
WP_065519883.1|4541648_4542680_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.5	9.6e-97
WP_088295932.1|4542780_4543014_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	6.4e-17
WP_071570849.1|4543046_4543715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570848.1|4543887_4544541_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	62.9	8.5e-59
WP_071570706.1|4544542_4544896_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.9e-49
WP_071570707.1|4544895_4546095_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.4	2.6e-162
WP_071570708.1|4546091_4546865_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	3.8e-66
WP_071570709.1|4546864_4547650_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	53.5	1.2e-30
WP_071570710.1|4547649_4548228_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	2.2e-50
>prophage 11
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	5037890	5047353	5591645	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_004191152.1|5037890_5039006_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004191149.1|5039002_5040943_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_002896516.1|5041019_5041241_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|5041566_5041884_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|5041914_5044194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|5044313_5044532_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|5044885_5045587_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004191145.1|5045631_5047353_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
>prophage 12
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	5148984	5171656	5591645	integrase,tail,head	Pectobacterium_phage(27.27%)	34	5147887:5147901	5180646:5180660
5147887:5147901	attL	TCAGTTTGCGCAGTT	NA	NA	NA	NA
WP_025712918.1|5148984_5150013_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
WP_004199480.1|5150016_5150241_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_009308318.1|5150637_5151204_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_071570741.1|5151203_5153333_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.2	8.0e-98
WP_022644594.1|5153362_5153608_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_024623105.1|5153615_5153849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|5154790_5155177_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_022644596.1|5155257_5155452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|5155512_5155959_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_016197573.1|5156042_5156201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279640.1|5156218_5157187_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
WP_025712911.1|5157183_5158572_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.9	1.1e-106
WP_071570743.1|5158610_5159261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191074.1|5159264_5159498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042929464.1|5159537_5160323_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	54.5	1.0e-66
WP_071570744.1|5160450_5161041_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	6.7e-95
WP_004141582.1|5161043_5161274_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_004141581.1|5161270_5161888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162584.1|5161900_5162239_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	3.0e-47
WP_025712904.1|5162419_5162611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025712903.1|5162679_5163273_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	3.6e-80
WP_071570746.1|5163262_5163586_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_071570748.1|5163573_5163921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199525.1|5163926_5164367_+	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_071570750.1|5164407_5164932_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	52.9	8.1e-44
WP_071570751.1|5164993_5165227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308351.1|5165210_5165471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570753.1|5165477_5165930_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	4.2e-49
WP_020947864.1|5166014_5167409_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_064185222.1|5167408_5169073_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_029503969.1|5169075_5169399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570754.1|5169385_5170138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191051.1|5170148_5171144_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004191050.1|5171182_5171656_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
5180646:5180660	attR	TCAGTTTGCGCAGTT	NA	NA	NA	NA
>prophage 13
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	5176591	5187120	5591645		Salmonella_phage(50.0%)	8	NA	NA
WP_086893436.1|5176591_5179063_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	30.3	2.3e-35
WP_071570763.1|5179062_5180904_+	hypothetical protein	NA	Q858F9	Salmonella_phage	32.4	3.0e-77
WP_071570764.1|5180903_5183621_+	hypothetical protein	NA	Q858F8	Salmonella_phage	50.8	1.5e-258
WP_064150322.1|5183617_5183926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157665544.1|5184373_5185624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199490.1|5185836_5186052_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_004199518.1|5186053_5186593_+	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
WP_071570766.1|5186589_5187120_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.3	9.1e-35
>prophage 14
NZ_CP020841	Klebsiella pneumoniae strain KPN1482 chromosome, complete genome	5591645	5375519	5432417	5591645	integrase,tRNA,transposase	Salmonella_phage(15.79%)	53	5429519:5429555	5436501:5436537
WP_002901088.1|5375519_5376020_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004190876.1|5376263_5377403_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002901096.1|5377573_5377816_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_002901192.1|5378086_5378506_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152360.1|5378508_5379774_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_004190873.1|5379780_5380686_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901225.1|5380852_5381602_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004190870.1|5381598_5382816_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179386.1|5382991_5383873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190867.1|5384129_5384441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|5384562_5385045_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_004190861.1|5385203_5385767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|5385812_5387096_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_071570775.1|5387181_5389116_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_002901236.1|5389532_5390279_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_023279120.1|5390370_5391225_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	2.1e-17
WP_004190857.1|5391281_5392166_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002901243.1|5392240_5393236_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004190855.1|5393574_5393988_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002901249.1|5394031_5394310_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002901254.1|5394404_5394749_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002901255.1|5394909_5396163_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
WP_004190847.1|5396334_5396976_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
WP_004176535.1|5396985_5398005_-	asparaginase	NA	NA	NA	NA	NA
WP_004140411.1|5398143_5399997_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_004176531.1|5400162_5400714_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_087529040.1|5400833_5402197_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
WP_002901387.1|5402898_5403645_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004190843.1|5403870_5404914_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_004148065.1|5404918_5406865_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
WP_004190839.1|5407044_5408025_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004176526.1|5408068_5409412_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_023279119.1|5409594_5410005_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002901398.1|5410091_5410715_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004214268.1|5410766_5412074_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_004176522.1|5412167_5412800_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
WP_004190832.1|5412799_5414335_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190830.1|5414307_5415486_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004176519.1|5415488_5416049_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004190827.1|5416045_5416756_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_004190824.1|5416742_5417399_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002901486.1|5417612_5418419_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002901489.1|5418857_5420078_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
WP_004190819.1|5420074_5421109_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000608644.1|5421518_5422781_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|5423036_5423912_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|5423958_5424291_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|5426612_5427317_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|5427948_5428779_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|5428909_5429464_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
5429519:5429555	attL	CTCCCAATTTGTGTAGGGCTTATTATGCACGCTTAAA	NA	NA	NA	NA
WP_001067855.1|5429607_5430312_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|5430862_5431567_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|5431457_5432417_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
5436501:5436537	attR	TTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAG	NA	NA	NA	NA
>prophage 1
NZ_CP020842	Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence	180210	13802	117236	180210	transposase,bacteriocin,integrase	uncultured_Caudovirales_phage(19.35%)	95	5545:5559	102426:102580
5545:5559	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|13802_14543_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
5545:5559	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004152065.1|15686_16634_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|16660_16972_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|17036_17960_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|18632_18890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|19491_20946_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|21928_23206_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|23268_25266_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|26305_27513_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
25572:25586	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|28941_29373_-	silver-binding protein SilE	NA	NA	NA	NA	NA
25572:25586	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_003032875.1|29623_31099_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|31091_31772_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|31961_33347_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|33375_33729_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|33842_35135_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|35145_38292_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|38378_38819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893457.1|38945_41393_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|41433_41631_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|41664_42402_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|42690_43140_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|43373_45191_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|45190_46087_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|46126_46507_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|46511_47441_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|47495_48176_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|48172_49573_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|49789_50224_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|50455_50635_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|52377_52887_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|52936_53434_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|53765_54092_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|54091_54802_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|54810_55356_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|55431_55794_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|57690_58227_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|58259_58685_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|58697_59987_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|60034_61786_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|61803_62166_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|62215_62566_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|62923_63193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|63180_63756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|63786_64281_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|64324_64693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|64726_64930_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|64978_65236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|65311_65566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|65741_66008_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|65995_66478_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|66678_68082_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|68110_68743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253394.1|68968_70315_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015632387.1|70363_70759_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_015632388.1|72117_73401_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_015632389.1|73530_75723_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|76140_77064_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022631502.1|77364_77565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|77979_78984_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|79062_82029_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|82103_82394_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|82390_82792_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|82781_83138_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|83392_83707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|84133_85315_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|85974_86580_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_015632391.1|87961_90955_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	1.3e-258
WP_022631505.1|90958_91369_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_023356273.1|91368_91608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|91950_92715_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|93098_93239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|93221_93722_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031281281.1|94504_95137_+	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
WP_015632396.1|96785_97565_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
WP_022631510.1|97975_98530_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_022631163.1|99250_100504_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_000237816.1|100584_101037_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_000845048.1|101209_102223_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023277723.1|102397_102559_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	72.7	4.7e-11
WP_012585400.1|102665_102914_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001173919.1|103040_103616_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_022631165.1|103728_104649_+	DNA invertase	NA	E5FFF9	Burkholderia_phage	47.0	2.3e-41
WP_014386481.1|106412_107057_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_020324562.1|107839_108544_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_057951057.1|108577_108985_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|109038_109320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|109492_109828_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_004152292.1|110871_111729_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|111721_111799_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|112015_112294_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004152294.1|112614_113166_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_086893461.1|113434_113704_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014386491.1|113729_114710_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_157665545.1|114748_114937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|114914_117236_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP020843	Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence	97202	13402	22621	97202	transposase	Escherichia_phage(33.33%)	13	NA	NA
WP_004152492.1|13402_14224_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_023287139.1|15053_15467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|15467_15746_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|15735_16056_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_014343499.1|16136_16361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706020.1|16371_16584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071571082.1|16676_17657_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_009310022.1|17899_18409_-|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
WP_023280872.1|18609_18984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|19039_19366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|19362_20091_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568057.1|20087_20519_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_071571081.1|20563_22621_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
>prophage 2
NZ_CP020843	Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence	97202	33872	40963	97202	integrase	Escherichia_phage(50.0%)	7	35756:35768	42556:42568
WP_004152353.1|33872_34844_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|35077_35509_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|35508_36780_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
35756:35768	attL	TGATGAACTGCCT	NA	NA	NA	NA
WP_004098982.1|37191_38067_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|38707_39334_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_077253981.1|39453_39633_+	Par-like protein	NA	NA	NA	NA	NA
WP_004197635.1|40168_40963_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
42556:42568	attR	AGGCAGTTCATCA	NA	NA	NA	NA
