The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	327622	338499	5467988	transposase,integrase	Enterobacteria_phage(25.0%)	10	321214:321227	335121:335134
321214:321227	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000749863.1|327622_328678_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|328965_330069_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|330080_331334_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|331689_332904_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|333046_333928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|334125_334323_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|334322_334754_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_085948178.1|335031_336244_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
335121:335134	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_001444700.1|336790_337450_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000942525.1|337428_338499_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	552101	631998	5467988	transposase,tRNA,head,tail,protease,capsid	Escherichia_phage(33.33%)	69	NA	NA
WP_000186631.1|552101_552581_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|552784_553579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|553716_554058_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|554171_556676_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|556937_557870_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|557872_559165_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|559289_559697_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000970323.1|559697_560156_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|560152_561070_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|561215_561893_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001297299.1|561879_562659_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|562721_563576_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|563636_564446_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|564435_565059_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110572.1|565029_565716_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561851.1|565712_568127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021351705.1|572756_573017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|574248_575343_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|575411_576338_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|576567_577050_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|577127_577943_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|578032_579814_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|579826_580603_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|580702_581581_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401096.1|581749_583204_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|583263_584625_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|584681_585983_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|586004_587150_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|587278_588064_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|588074_589310_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|589331_590381_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|590697_592365_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495382.1|592374_593634_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|593644_594460_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|594456_595350_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|595486_596554_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|596550_597060_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|597177_597900_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|597902_598397_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|598570_599956_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|599991_600513_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|600620_600833_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|600834_601701_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|602181_602724_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|602943_603636_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|603666_606276_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|607327_607843_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|607845_608478_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|609688_610021_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|610076_611102_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|611143_611539_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|611550_611850_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085948269.1|611870_613083_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_000683103.1|613751_614147_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|614154_614895_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|614910_615333_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|615314_615749_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|615741_617922_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|617927_619140_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244794.1|619106_619253_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_000239881.1|619210_619879_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|619935_620241_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|620424_621909_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|622095_623049_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|623561_624323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001224569.1|624505_625396_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|625396_628369_-	phage receptor	NA	NA	NA	NA	NA
WP_000383942.1|628355_630593_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|630861_631998_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	851545	882991	5467988	transposase,integrase,holin,head,tail,capsid	Enterobacteria_phage(58.82%)	39	846138:846154	875307:875323
846138:846154	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|851545_852622_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000075132.1|852635_853133_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411800.1|853132_853339_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_086893270.1|853786_855637_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000499454.1|855935_856094_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|856179_856923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|857107_857797_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|857811_857934_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|858273_859233_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|859444_859633_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|859629_859992_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|859988_860279_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|860271_860484_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|860476_860653_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|860652_861012_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|861014_861191_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_085948178.1|861297_862510_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254039.1|863135_864641_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|864677_865025_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|865082_866111_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|866162_866537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|866529_866883_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|866897_867473_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|867469_867865_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|867872_868625_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|868638_869070_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|869096_869510_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082361.1|869490_872070_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847298.1|872066_872396_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001426561.1|872395_873094_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_001444516.1|873104_873848_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_072147834.1|873793_874423_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514984.1|874663_878140_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
875307:875323	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|878207_878807_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|878871_880185_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|880186_880456_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|880561_881443_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369640.1|881659_882496_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	1.9e-151
WP_021351651.1|882619_882991_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
>prophage 4
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	1095286	1135404	5467988	holin,transposase,protease,lysis	Escherichia_phage(30.77%)	52	NA	NA
WP_000156528.1|1095286_1097047_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1097232_1097685_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1097760_1098801_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1099157_1099667_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1099939_1100515_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1100477_1102640_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1102649_1103096_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1103218_1105273_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1105304_1105763_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1105858_1106521_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1106693_1107107_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1107151_1107469_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1107526_1108717_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1108811_1109090_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1109086_1109416_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1109506_1110166_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1111566_1111809_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_086893271.1|1111876_1114348_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
WP_001090200.1|1114440_1114632_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1114628_1114817_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1115348_1115723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1115734_1115887_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1116159_1116876_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1116925_1117141_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1117137_1117563_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1117634_1118705_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1118745_1119168_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1119164_1119461_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1119457_1119919_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1119896_1120253_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1120303_1120516_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1120601_1120766_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1120767_1121031_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1121041_1121911_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1122026_1122131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1122319_1122532_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1122699_1122960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1122979_1124029_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1124041_1124413_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1124402_1124774_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1124925_1125744_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1126030_1126228_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1126365_1127079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1127846_1129697_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1130144_1130351_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1130606_1130879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003123.1|1131038_1131572_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|1131792_1131906_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_021351510.1|1131907_1132201_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	92.8	2.3e-40
WP_085948178.1|1132240_1133454_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_086893272.1|1133540_1134575_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1135020_1135404_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	1349956	1419575	5467988	transposase,integrase,tRNA,holin,capsid,head,tail,terminase	Stx2-converting_phage(39.62%)	78	1364830:1364846	1406314:1406330
WP_021351694.1|1349956_1350127_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.9	4.5e-12
WP_012817871.1|1350294_1350567_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1350568_1351624_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1351624_1351990_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1351998_1352529_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1352770_1352968_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1353118_1354177_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_086893273.1|1354973_1355879_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.6	2.3e-171
WP_085948269.1|1355885_1357098_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_000411802.1|1358532_1358739_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1358743_1359088_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1359138_1359672_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_085948178.1|1359915_1361129_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_086893274.1|1361255_1361819_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-97
WP_085948178.1|1361821_1363035_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000539792.1|1363137_1363284_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1363511_1363697_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1364121_1364349_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1364390_1364756_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
1364830:1364846	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958415.1|1365045_1365609_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1365605_1367267_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_086893275.1|1367330_1369268_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1369312_1369534_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1372222_1372549_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1372558_1372909_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1372905_1373352_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1373348_1373693_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1373759_1374476_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1374481_1374856_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1374951_1375161_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1375212_1378455_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1378447_1378789_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1378788_1379487_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1379503_1379824_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1379931_1380105_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1381152_1381890_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_157420851.1|1381835_1382468_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	7.6e-105
WP_086893277.1|1382706_1386186_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.5	0.0e+00
WP_001230462.1|1386252_1386852_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	5.2e-111
WP_086893301.1|1386916_1388239_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	1.8e-76
WP_001023356.1|1388240_1388510_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1388616_1388706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1388725_1391074_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1391664_1395066_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_000145590.1|1395234_1395813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1395835_1395961_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1396040_1396316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1396376_1397738_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1398101_1398965_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1398948_1400085_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1400334_1401564_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1401709_1402831_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|1403079_1404309_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1404673_1404862_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1404911_1405238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1405362_1405536_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1405666_1405864_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1405856_1406069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551672.1|1406058_1406298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1406290_1406524_+	hypothetical protein	NA	NA	NA	NA	NA
1406314:1406330	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204985.1|1406516_1406750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1406755_1407055_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1407051_1408452_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|1408652_1408904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1408900_1409311_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233303.1|1409321_1409594_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1409720_1409945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796963.1|1410196_1410403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1410402_1411458_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1411470_1411806_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224606.1|1411818_1412232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1412437_1412980_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1413235_1413517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1414118_1415579_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1415578_1416250_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1416417_1417788_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1417791_1418433_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1418468_1419575_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	1520791	1544942	5467988	tail,holin	Escherichia_phage(35.48%)	32	NA	NA
WP_000268365.1|1520791_1521340_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_000075578.1|1523145_1523682_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1523714_1523996_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1523992_1524289_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1524285_1524747_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403787.1|1524724_1525072_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.4	2.1e-56
WP_000137950.1|1525176_1525548_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1525544_1525898_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1526103_1526403_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1526408_1526666_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1526801_1527080_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1527081_1528131_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1528143_1528518_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1528514_1529336_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917750.1|1529562_1529760_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935545.1|1529910_1530969_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	96.9	2.7e-203
WP_086893278.1|1531563_1533510_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.2	0.0e+00
WP_000143458.1|1533647_1533827_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1533867_1534113_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1534190_1534406_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087730.1|1534410_1534944_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_086201924.1|1535215_1535785_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	1.2e-104
WP_100223600.1|1535809_1536892_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	96.1	2.4e-183
WP_001230469.1|1536959_1537559_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	5.7e-110
WP_000268904.1|1537623_1538739_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	93.3	3.9e-80
WP_001023452.1|1538740_1539010_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1539150_1540026_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|1540250_1540901_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|1541496_1541811_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1541870_1543154_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1543242_1544703_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1544738_1544942_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	1830769	1927993	5467988	integrase,tail,transposase,protease	Escherichia_phage(27.08%)	103	1863255:1863270	1931857:1931872
WP_000422045.1|1830769_1831819_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1832038_1832797_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1832793_1833384_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1833423_1834296_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1834396_1835017_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1835013_1835895_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1836032_1836077_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1836168_1837731_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1837730_1839326_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|1839329_1840688_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|1840699_1841893_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1841892_1842699_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1843079_1843259_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1843344_1843845_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1843890_1844397_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|1845433_1846024_-	protein kinase	NA	NA	NA	NA	NA
WP_001023407.1|1847159_1847429_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_086893279.1|1847430_1848744_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	3.3e-78
WP_001230428.1|1848808_1849408_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_157420845.1|1849475_1850429_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	93.1	2.1e-154
WP_085948178.1|1850484_1851697_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001059384.1|1855296_1855986_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1855982_1856348_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1856348_1857404_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|1857405_1857684_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1857753_1858011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1858231_1858444_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1858722_1859481_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1860179_1860344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1860340_1861075_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001302276.1|1861108_1861531_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000705622.1|1862574_1863126_-	hypothetical protein	NA	NA	NA	NA	NA
1863255:1863270	attL	GCAACGCTTGCCAGCC	NA	NA	NA	NA
WP_000787428.1|1863412_1863820_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1864084_1864384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1864456_1864675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1864697_1865105_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1865082_1865316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1865309_1865477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1865876_1866065_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1866061_1866250_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_086893281.1|1866345_1868817_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1868881_1869130_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1869107_1870238_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000737224.1|1870283_1870922_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028531.1|1871278_1872022_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|1872051_1872591_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|1872695_1873094_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|1873133_1873853_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_001261192.1|1873943_1874297_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001144878.1|1876802_1877393_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1877576_1878224_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1878360_1878507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1878934_1879213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1880380_1880950_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1881015_1881927_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1882033_1882156_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023476.1|1883270_1883540_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_086893282.1|1883541_1884594_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	85.3	1.8e-79
WP_001228290.1|1884745_1885345_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000514703.1|1885412_1888886_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_096860308.1|1889228_1889861_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1889806_1890550_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1890555_1891254_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1891253_1891595_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369428.1|1891587_1893030_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000091308.1|1893048_1893414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1893413_1894601_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001344632.1|1896850_1896982_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_001064906.1|1897408_1898098_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_000054483.1|1898469_1899435_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000387475.1|1899415_1899667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1899759_1900972_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000476993.1|1901233_1901461_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1901538_1901946_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1902138_1902291_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1902302_1902668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1902636_1902924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1903339_1903528_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1903524_1903716_+	YebW family protein	NA	NA	NA	NA	NA
WP_000048302.1|1903809_1906281_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|1906368_1906605_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1906639_1907920_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1907939_1908050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1908107_1909127_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1909138_1910353_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1910558_1910885_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1911019_1911361_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1911395_1911956_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1911958_1912669_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1912776_1913082_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1913280_1915707_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1915767_1918191_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1918201_1918819_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1918820_1919675_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1919717_1920332_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|1920490_1921783_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1921735_1922431_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1922555_1923776_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019545.1|1923910_1924804_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1924910_1926164_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|1926560_1926896_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1926988_1927072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|1927171_1927993_+|protease	serine protease	protease	NA	NA	NA	NA
1931857:1931872	attR	GCAACGCTTGCCAGCC	NA	NA	NA	NA
>prophage 8
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	2003109	2087011	5467988	integrase,transposase,tRNA,holin,capsid,head,portal,tail,plate,terminase	Enterobacteria_phage(66.67%)	82	2047876:2047900	2079652:2079676
WP_085948178.1|2003109_2004323_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001070230.1|2006515_2007142_-	ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000528342.1|2007597_2007807_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_001295403.1|2008363_2009776_+	pyruvate kinase I	NA	NA	NA	NA	NA
WP_000648420.1|2010086_2010323_+	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_000817104.1|2010386_2011391_-	L,D-transpeptidase LdtE	NA	NA	NA	NA	NA
WP_001196530.1|2011539_2011956_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_000144575.1|2011968_2013189_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|2013185_2014457_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|2014431_2015178_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|2015187_2016675_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2016683_2017052_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001296104.1|2017599_2017788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637982.1|2017887_2018298_-	1,4-dihydroxy-2-naphthoyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_000612968.1|2018294_2021351_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000248645.1|2021739_2022852_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_001299124.1|2023280_2023637_+	YdiL family protein	NA	NA	NA	NA	NA
WP_000795566.1|2023736_2024951_+	MFS transporter	NA	NA	NA	NA	NA
WP_001297389.1|2025177_2026443_+	MFS transporter	NA	NA	NA	NA	NA
WP_000383460.1|2026454_2027321_+	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000860176.1|2027351_2028110_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_000347854.1|2029861_2031013_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284799.1|2031055_2031967_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000692133.1|2032282_2033047_+	electron transfer flavoprotein	NA	NA	NA	NA	NA
WP_000080700.1|2033066_2034005_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_001287818.1|2034060_2035350_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000081071.1|2035346_2035640_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000553696.1|2035642_2037343_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|2037399_2039778_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2040110_2040944_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|2041100_2042147_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2042278_2042470_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175600.1|2042473_2043910_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|2043972_2044686_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|2044931_2045396_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|2045473_2046223_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154176.1|2046222_2046774_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|2046836_2047817_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2047876:2047900	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000550059.1|2048006_2048378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077633861.1|2048411_2049023_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	48.8	5.5e-52
WP_001382139.1|2049135_2049354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288335.1|2049350_2052191_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686506.1|2052267_2053227_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2053231_2053543_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2053907_2054177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2054739_2055264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2055278_2056325_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2056324_2058076_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2058231_2059068_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2059091_2060144_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2060189_2060990_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2061092_2061587_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2061586_2061787_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2061789_2062113_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2062109_2062502_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2062498_2062906_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2063043_2063511_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2063503_2064139_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2064135_2064717_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2064713_2065064_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2065067_2065964_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071741.1|2065956_2066487_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.5e-93
WP_001098696.1|2066489_2068622_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	67.1	5.0e-132
WP_000144026.1|2068621_2069200_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2069243_2069816_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2069972_2070461_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2070473_2073281_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2073267_2073423_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2073431_2073806_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000005431.1|2074372_2075557_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2075714_2076824_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2077049_2078552_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2078795_2079056_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2079246_2079387_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2079693_2079993_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2079652:2079676	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672378.1|2079997_2082385_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2082399_2083383_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2083666_2083711_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2083833_2084190_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2084242_2084440_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2084536_2085079_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2085082_2087011_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 9
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	2149015	2257500	5467988	transposase,integrase,tRNA,holin,head,terminase,tail,protease,capsid	Escherichia_phage(32.81%)	119	2215522:2215538	2255482:2255498
WP_000138052.1|2149015_2149519_+|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000999630.1|2149519_2149624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460707.1|2149793_2150240_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000972250.1|2150196_2151018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000128477.1|2151114_2152296_+	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_001297652.1|2152350_2152698_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000691903.1|2152719_2152974_-	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_001283455.1|2153156_2154182_+	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_001219350.1|2154214_2154313_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|2154315_2154390_+	protein YoaJ	NA	NA	NA	NA	NA
WP_000512153.1|2154448_2154697_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000826412.1|2154924_2156133_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_001349736.1|2156140_2157103_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_000457202.1|2157311_2157950_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|2158076_2159000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|2159102_2160188_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|2160438_2162049_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067822.1|2162080_2163205_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001286997.1|2163260_2164226_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001323996.1|2164279_2165395_-	ribonuclease D	NA	NA	NA	NA	NA
WP_001344701.1|2165476_2167162_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.4e-35
WP_000290576.1|2167366_2167948_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220987.1|2167987_2168683_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2168740_2170651_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2170782_2171127_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2171489_2171849_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2171968_2172148_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|2172221_2173583_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456712.1|2173586_2174165_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|2174348_2175713_+	L-serine dehydratase 1	NA	NA	NA	NA	NA
WP_001344702.1|2175843_2177442_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|2177445_2179002_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|2179464_2180436_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2180498_2181299_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2181311_2182163_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156265.1|2182217_2182676_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2183104_2183671_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|2183667_2184477_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2184642_2184852_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2184864_2185008_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|2185676_2185964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714552.1|2186038_2186182_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|2186340_2186580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|2186722_2187514_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001344704.1|2187690_2189064_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2189109_2189991_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2190182_2192231_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2192250_2192949_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2193045_2193543_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|2193672_2194956_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|2194924_2197558_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001369706.1|2197637_2199077_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2199194_2199431_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2199535_2199727_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2199727_2200384_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_085948178.1|2201299_2202513_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_122988840.1|2203657_2203735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|2203845_2204115_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_021824160.1|2204116_2205430_-|tail	tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.7	1.1e-78
WP_001230553.1|2205494_2206094_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	3.3e-110
WP_086893283.1|2206164_2209662_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.6	0.0e+00
WP_123006618.1|2209897_2210530_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	2.5e-103
WP_086893284.1|2210475_2211219_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	1.0e-145
WP_062863825.1|2211229_2211928_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	3.6e-132
WP_000807964.1|2211927_2212269_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_086893285.1|2212261_2215504_-|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	98.4	0.0e+00
2215522:2215538	attL	TAAAAAAACCGCCTCAG	NA	NA	NA	NA
WP_001513217.1|2215551_2215761_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710962.1|2215856_2216231_-|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_021351560.1|2216245_2216962_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	1.8e-126
WP_000133388.1|2217028_2217373_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2217369_2217816_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007911.1|2217812_2218163_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000126000.1|2218172_2218499_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	2.7e-53
WP_001063025.1|2221025_2221247_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_021351655.1|2221291_2223229_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_021351656.1|2223292_2224954_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.3	0.0e+00
WP_000958366.1|2224950_2225514_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000279796.1|2225802_2226168_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001369651.1|2226209_2226434_+	YlcI/YnfO family protein	NA	A0A0P0ZCG8	Stx2-converting_phage	76.1	2.3e-19
WP_001302717.1|2226515_2226830_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|2227029_2228242_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001208680.1|2228668_2228854_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000992108.1|2229371_2229905_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	6.2e-100
WP_000731236.1|2229955_2230300_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|2230304_2230511_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_060552899.1|2230958_2232809_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000301785.1|2233600_2234314_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369585.1|2234448_2234646_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_000211416.1|2234888_2235470_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|2235743_2236298_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228038.1|2236294_2236585_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940300.1|2236584_2237184_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	89.9	4.4e-102
WP_085960004.1|2237255_2237507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369586.1|2237742_2237880_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_000200358.1|2238419_2239193_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000426669.1|2239313_2239709_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	98.5	4.4e-66
WP_001369587.1|2240085_2240595_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	81.3	3.7e-49
WP_001289349.1|2241108_2242056_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.1	1.2e-178
WP_000004203.1|2242548_2243022_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.1e-66
WP_001151127.1|2243018_2243441_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	8.8e-65
WP_000450877.1|2243456_2244227_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	6.3e-85
WP_000788938.1|2244252_2244993_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|2244999_2245962_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2245984_2246410_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2246393_2246717_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2246841_2247318_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379547.1|2247635_2247788_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560219.1|2248208_2248430_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_000358365.1|2248429_2248600_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_000102202.1|2249051_2252201_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	74.2	0.0e+00
WP_001004413.1|2252212_2253265_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_010989194.1|2253328_2253523_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_024177035.1|2253515_2253704_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.7	3.9e-17
WP_005127484.1|2253810_2254092_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_001189085.1|2254057_2255134_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_000976491.1|2255526_2255868_-	YebY family protein	NA	NA	NA	NA	NA
2255482:2255498	attR	CTGAGGCGGTTTTTTTA	NA	NA	NA	NA
WP_000879274.1|2255880_2256753_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2256756_2257131_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2257269_2257500_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 10
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	2359898	2449331	5467988	transposase,integrase,holin,head,terminase,portal,tail,capsid	Enterobacteria_phage(33.33%)	104	2390652:2390669	2450001:2450018
WP_000826461.1|2359898_2361107_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000879833.1|2362498_2363296_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2363305_2363857_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2364025_2364358_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2364691_2365006_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994453.1|2365220_2366879_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2366871_2367867_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2367859_2368546_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2368545_2369919_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2369937_2370381_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620091.1|2370377_2371505_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2371609_2372074_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2372078_2373083_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2373079_2373493_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2373495_2373861_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2373860_2374598_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2374607_2374877_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2374884_2375670_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2375959_2376583_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2376626_2376869_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2376977_2377205_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2377502_2378318_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2378314_2380009_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2380179_2380362_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2380440_2381358_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2381530_2382451_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2382439_2382910_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2382890_2384309_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2384375_2385071_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2385110_2385476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2386041_2387205_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|2387795_2388647_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2388754_2390113_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001339045.1|2390112_2390784_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
2390652:2390669	attL	AATCATCCTTCAGCGCAA	NA	NA	NA	NA
WP_000920136.1|2390916_2391330_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2391438_2392443_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2392443_2393079_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_122993428.1|2393314_2393986_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079060.1|2394328_2394859_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2396093_2397107_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2397512_2397782_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_086893287.1|2397783_2399097_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	8.2e-77
WP_001230459.1|2399161_2399761_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_086893288.1|2399828_2403305_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.1	0.0e+00
WP_157420852.1|2403545_2404175_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	6.6e-109
WP_001444516.1|2404120_2404864_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|2404874_2405573_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|2405572_2405902_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|2405898_2408511_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533440.1|2408491_2408905_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2408931_2409354_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2409367_2410120_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2410127_2410523_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2410519_2411053_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2411068_2411422_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2411414_2411798_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2411849_2412878_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2412935_2413283_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253978.1|2413319_2414825_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2414814_2416407_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2416403_2416610_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2416593_2418522_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2418493_2419000_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2419426_2419651_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2419732_2420047_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2420572_2420758_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2421275_2421809_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|2422371_2422587_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2422663_2422936_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2422976_2423156_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000023158.1|2423293_2425231_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2425709_2426141_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2426228_2426654_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2426650_2427001_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2427031_2428645_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2429130_2429844_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2429978_2430176_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2430399_2430954_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2430962_2431322_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2431334_2432384_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2432385_2432658_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2432779_2433124_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2433243_2433456_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2433689_2434247_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2434248_2434467_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2434594_2434906_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2434898_2435126_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2435122_2435404_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2435436_2436153_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2436174_2436921_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000693883.1|2438068_2438494_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2438477_2438759_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2438858_2439278_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2439543_2439696_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2439707_2440346_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2440346_2440556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2441126_2441315_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2441311_2441503_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_086893289.1|2441595_2444067_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_000096346.1|2444125_2444329_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|2444544_2445758_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000142672.1|2445822_2446668_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	64.6	5.1e-96
WP_001300307.1|2446903_2447701_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2448056_2449331_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2450001:2450018	attR	TTGCGCTGAAGGATGATT	NA	NA	NA	NA
>prophage 11
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	2698506	2758151	5467988	integrase,transposase,holin,protease,lysis	Escherichia_phage(17.86%)	46	2710906:2710941	2740867:2740902
WP_000849214.1|2698506_2698995_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2699143_2700790_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2701007_2702651_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2702726_2703377_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2703376_2704441_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2704514_2705570_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2705681_2706773_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2707511_2710184_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2710200_2710851_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2710906:2710941	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2711050_2713900_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2714174_2714951_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2714955_2716605_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_134793277.1|2716605_2721000_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2721801_2723124_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_157420846.1|2723919_2724351_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	41.1	2.5e-22
WP_000881319.1|2724311_2724956_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	88.6	4.0e-85
WP_000092247.1|2725105_2725543_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2725539_2726037_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2726036_2726252_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2726394_2726793_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2726873_2727032_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_032336818.1|2727117_2727525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2727579_2728792_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_021351585.1|2728832_2729417_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.9	3.2e-89
WP_001108084.1|2729391_2729958_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2730487_2731420_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2731458_2732286_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2732789_2732972_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2733128_2733473_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2733578_2733797_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2733774_2734845_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2734839_2735466_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2735462_2737151_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2737299_2739927_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|2740073_2740796_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001345213.1|2740923_2744658_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.6e-19
2740867:2740902	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001075177.1|2745353_2747639_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|2747727_2748858_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000179250.1|2748857_2749112_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2749165_2749816_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|2750278_2751355_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000948732.1|2751359_2752718_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000857257.1|2752990_2754619_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_001209922.1|2754608_2755868_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_001000358.1|2755864_2757055_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_000140560.1|2757248_2758151_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.3e-68
>prophage 12
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	2816424	2958228	5467988	integrase,transposase,tRNA,holin,terminase,head,portal,tail,plate,capsid	Escherichia_phage(48.18%)	152	2834753:2834812	2954548:2955860
WP_000156114.1|2816424_2817315_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_085960005.1|2817398_2818612_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001293612.1|2818824_2819598_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|2819605_2820322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|2820318_2821005_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|2821094_2821877_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|2822097_2822880_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825710.1|2823145_2823715_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|2823809_2825327_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|2825363_2825852_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000157015.1|2826110_2826773_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584575.1|2826762_2828031_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|2828100_2829015_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364331.1|2829170_2829830_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283576.1|2829912_2830725_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2830724_2831738_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|2831803_2832961_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023402.1|2833119_2834124_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|2834220_2834541_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_157420847.1|2834679_2834832_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.5e-06
2834753:2834812	attL	ATCTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATC	NA	NA	NA	NA
WP_085948178.1|2834797_2836011_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071533448.1|2836009_2836255_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	51.4	4.1e-14
WP_000200503.1|2836261_2836468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|2836720_2837062_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158971.1|2837072_2837360_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|2837371_2837614_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2837610_2837724_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2837809_2838013_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2838009_2838255_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274220.1|2838251_2838551_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_000013441.1|2838873_2839104_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
WP_000599382.1|2839176_2839542_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_157420848.1|2839548_2842314_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.1	0.0e+00
WP_000502620.1|2842494_2843616_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001140704.1|2843639_2845865_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_086893291.1|2846357_2847404_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	9.7e-206
WP_086893292.1|2847403_2849155_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262673.1|2849310_2850147_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055105.1|2850170_2851223_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.3e-194
WP_000632344.1|2851268_2852069_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2852171_2852666_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864903.1|2852665_2852866_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.0e-31
WP_001369625.1|2852868_2853192_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
WP_000072327.1|2853188_2853581_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780553.1|2853577_2853985_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	5.9e-66
WP_000920600.1|2854122_2854590_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	8.4e-85
WP_000356339.1|2854582_2855218_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_157420849.1|2855214_2855796_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	1.7e-103
WP_024182996.1|2855792_2856143_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.6e-59
WP_001111924.1|2856146_2857043_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_000071722.1|2857035_2857566_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.5e-93
WP_021351617.1|2857568_2859965_+|tail	tail protein	tail	Q7Y4D4	Escherichia_virus	60.5	1.9e-209
WP_000972108.1|2859966_2860494_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	93.1	6.4e-89
WP_000972162.1|2860522_2861056_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	7.1e-96
WP_000905062.1|2862083_2862683_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.3	1.8e-95
WP_000979945.1|2862709_2863198_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853413.1|2863210_2866018_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|2866004_2866160_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2866168_2866543_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2866598_2867111_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005389.1|2867110_2868295_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	2.1e-225
WP_000132830.1|2868452_2869562_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|2869604_2869865_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078910.1|2870055_2870196_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	1.0e-17
WP_001173929.1|2870457_2870790_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000794123.1|2870794_2871688_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615813.1|2871955_2872951_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2872947_2874126_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2874409_2875630_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|2875788_2877795_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2877915_2878194_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2878227_2878776_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2878775_2879585_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2879584_2880409_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918465.1|2880412_2881498_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2881532_2882465_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2882630_2883182_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2883254_2884106_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2884107_2884647_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2884643_2885132_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2885128_2885638_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|2885653_2886406_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001369536.1|2886425_2889071_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2889152_2889716_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2890399_2890885_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2891087_2893232_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2893231_2894542_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2894721_2895006_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2895377_2896718_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2897084_2898143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2898324_2899080_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2899373_2900306_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331687.1|2900527_2908909_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	99.8	0.0e+00
WP_085948178.1|2909024_2910237_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001367376.1|2910702_2911164_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140442.1|2911213_2911603_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|2911658_2912873_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|2912896_2913904_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787520.1|2914061_2916206_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143991.1|2916205_2917912_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_001086077.1|2917892_2918699_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.6	3.8e-133
WP_000738505.1|2919107_2919401_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_122995391.1|2919491_2919677_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	100.0	4.9e-28
WP_000455406.1|2919904_2920054_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001369534.1|2920053_2920596_-	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_001080433.1|2920910_2921444_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_000284510.1|2921448_2921664_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290231.1|2921740_2922013_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2922053_2922233_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_086893293.1|2922369_2924307_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.5	0.0e+00
WP_000738068.1|2924792_2925062_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2925073_2926033_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2926415_2926568_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|2926816_2927251_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2927243_2927438_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2927434_2927998_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2928005_2928455_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|2928454_2929426_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|2929415_2930936_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|2930929_2931307_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|2931473_2931668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|2931838_2932042_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|2932137_2932851_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939559.1|2932945_2934415_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.8	1.0e-285
WP_001064714.1|2934411_2935365_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_001426810.1|2936119_2936764_+	Rha family transcriptional regulator	NA	A0A0H4IQ68	Shigella_phage	81.4	2.3e-93
WP_001369605.1|2937020_2937695_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000917252.1|2937765_2937978_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_024177061.1|2938049_2938271_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000995345.1|2938291_2938573_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_085948178.1|2938738_2939951_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000638209.1|2939935_2940853_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.3e-161
WP_000187063.1|2940849_2941539_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|2941538_2942126_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|2942200_2942548_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2942611_2943433_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|2943509_2943905_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_085948178.1|2944508_2945722_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000034212.1|2946090_2946498_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|2946499_2946691_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206800.1|2946693_2947590_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	99.7	2.1e-172
WP_000203834.1|2947945_2948584_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_000809302.1|2948639_2949071_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163447.1|2949067_2949694_+	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	99.5	2.3e-122
WP_001291843.1|2949653_2949866_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994798.1|2949901_2950309_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
WP_021351637.1|2950452_2950686_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|2950673_2950925_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000405131.1|2950985_2951168_+	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_001218303.1|2951151_2952321_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	99.7	2.2e-230
WP_085948178.1|2953348_2954561_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000194515.1|2956794_2958228_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
2954548:2955860	attR	GATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGATATGACACAAAGTGGAACCTCAATAGCATGTAACAGCTTCACTAATGAAATAATCCAGGGGTTAACGAACAGCGCGCAGGAAAGGATACGCAACGCCATAATCACAACACCGATAAGTAATGCATTTTTTGGCCCTACCCGATTCACAAAGAAAGGAATAATCGCCATGCATAGCGCTTCGAGTACCACCTGGAATGAGTTGAGATAACCATACAGGCGCGTTCCTACATCGTGTGATTCGAATAAACCTGCATAAAAGACAGGAAAAAGTTGTTGATCAAAAATGTTATAGAAAGACCACGTCCCCACAATAAATATGACGAAAACCCAGAAGTTTCGATCCTTGAAAACTGCGATAAAATCCTCTTTTTTTACCCCTCCCGCATCCGCCGCTACGCACTGGTGATCCTTATCTTTAAAACACATGTTGATCATCATAAATACAGCGCCAAATAGCGAGACCAACCAGAAGTTGATATGGGGACTGATACTAAAAAATATGCCGGCAAAGAACGCGCCAATAGCATAGCCAAAAGATCCCCAGGCGCGCGCTGTTCCATATTCGAAATGAAAATTTCGCGCCATTTTTTCGGTGAAGCTGTCAAGCAAACCGCATCCCGCCAGATACCCCAGGCCAAAAAAGAGCGCCCCCAGAATTAGACCTACAGAAAAATTGCTTTGCAGTAACGGTTCATAAACGTAAATCATAAACGGTCCGGTCAAGACCAGGATGAAACTCATACACCAGATGAGCGGTTTCTTCAGACCGAGTTTATCCTGAACGATGCCGTAGAACATCATAAATAGAATGCTGGTAAACTGGTTGACCGAATAAAGTGTACCTAATTCCGTCCCTGTCAACCCTAGATGTCCTTTCAGCCAAATAGCGTATAACGACCACCACAGCGACCAGGAAATAAAAAAGAGAAATGAGTAACTGGATGCAAAACGATAGTACGCATTTCTGAATGGAATATTCAGTGCCATAATTACCTACCTGTCGTTAAAAAATTCACGTCCTATTTAGAGATAAGAGCGACTTCGCCGTTTACTTCTCACTATTCCAGTTCTTGTCGACATGGCAGCGCTGTCATTGCCCCTTTCGCCGTTACTGCAAGCGCTCCGCAACGTTGAGCGAGATCGATAATTCGTCGCATTTCTCTCTCATCTGTAGATAATCCCGTAGAGGACAGACCTGTGAGTAACCCGGCAACGAACGCATCTCCCGCCCCCGTGCTATCGACACAATTCACA	NA	NA	NA	NA
>prophage 13
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	3183318	3261686	5467988	tRNA,holin,portal,tail,protease,terminase	Enterobacteria_phage(62.22%)	78	NA	NA
WP_001298974.1|3183318_3184056_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3184187_3185522_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3185731_3186613_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3186715_3187303_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627806.1|3187358_3187742_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	71.0	4.0e-32
WP_001262716.1|3188045_3188735_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3188782_3189820_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3190026_3190446_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3190514_3191213_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3191244_3193905_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3194018_3195374_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3195419_3195743_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3195739_3197038_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3202890_3205464_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3205593_3206325_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3206321_3207302_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3207436_3208174_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3208444_3208786_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3208889_3208937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3209035_3210196_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3210238_3211360_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3211370_3212441_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3212650_3213016_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3213165_3213684_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969032.1|3213673_3214900_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3214915_3215398_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3215474_3215822_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3215863_3216631_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3216661_3217210_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3217228_3217477_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3217725_3219087_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3219253_3220045_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3220065_3221352_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3221406_3222000_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3222122_3223001_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3223086_3224748_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3224896_3225238_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3225299_3225590_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3225579_3226056_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3226187_3226670_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3227518_3227767_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3228134_3228404_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_086893308.1|3228405_3229719_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	88.3	8.2e-77
WP_001230459.1|3229783_3230383_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_086893288.1|3230450_3233927_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.1	0.0e+00
WP_157420852.1|3234167_3234797_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	6.6e-109
WP_001444516.1|3234742_3235486_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|3235496_3236195_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|3236194_3236524_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021351599.1|3236520_3239166_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000532073.1|3239209_3239518_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3239544_3239967_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3239980_3240733_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|3240740_3241139_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|3241151_3241775_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281348.1|3241777_3242059_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3242051_3242378_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001369631.1|3242465_3244445_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_000974563.1|3244434_3245937_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_000102413.1|3245936_3246149_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3246145_3248269_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3248265_3248742_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3248774_3249047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126354079.1|3249258_3249444_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	2.3e-22
WP_000087709.1|3249960_3250494_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	2.5e-101
WP_001072901.1|3250498_3250714_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3250791_3251037_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3251077_3251257_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874265.1|3251394_3253341_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.4	0.0e+00
WP_000752026.1|3253851_3254121_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3254130_3255078_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3255584_3256019_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3256011_3256206_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108036.1|3256202_3256814_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	6.0e-99
WP_000950968.1|3256806_3256983_-	protein ninF	NA	A0A088CPS6	Enterobacteria_phage	98.3	1.3e-25
WP_000448925.1|3257729_3258146_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3258217_3259966_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3259967_3261686_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
>prophage 14
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	3333074	3340214	5467988		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3333074_3335636_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3335741_3336398_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3336448_3337216_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3337411_3338320_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590372.1|3338316_3339579_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	3.2e-134
WP_001278994.1|3339575_3340214_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	4863793	4905084	5467988	transposase,integrase,head,tail,plate,protease	Shigella_phage(53.66%)	61	4858534:4858550	4882939:4882955
4858534:4858550	attL	TGATTGTGAATGCTTAC	NA	NA	NA	NA
WP_001056416.1|4863793_4864378_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|4864545_4864794_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|4864795_4866886_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|4866957_4867890_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|4867892_4868114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4868126_4868381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4868382_4868664_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4868660_4868933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|4868937_4869231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4869242_4869773_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|4869870_4870413_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|4870416_4870950_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|4870949_4871465_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|4871468_4872020_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633439.1|4872016_4872268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4872319_4873532_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001310341.1|4873655_4874006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4874021_4874354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4874346_4874544_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|4874533_4874830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|4874826_4875336_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|4875405_4875831_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4875902_4876403_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4876437_4876866_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4876849_4877068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|4877077_4877305_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4877285_4877594_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4877590_4877881_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4877883_4878465_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|4878464_4880129_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|4880128_4881718_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|4881701_4883033_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
4882939:4882955	attR	TGATTGTGAATGCTTAC	NA	NA	NA	NA
WP_000094808.1|4883154_4883628_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4883804_4884929_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4884928_4885876_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002057.1|4885919_4886306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4886302_4886722_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4886718_4887279_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4887279_4887525_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4887521_4889024_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4889032_4889398_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4889412_4889889_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|4890015_4892091_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|4892077_4893427_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|4893410_4894535_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4894524_4895139_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4895131_4895569_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4895568_4896651_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4896641_4897202_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|4897201_4898113_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|4898147_4898669_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4898748_4898952_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4899173_4899734_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4899833_4901873_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4902019_4902202_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114105.1|4902237_4902483_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4902521_4902986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|4903100_4903301_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|4903254_4903992_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001369689.1|4904080_4904287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130533.1|4904292_4905084_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 16
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	4936220	4981134	5467988	integrase,tRNA,holin,capsid,head,tail,terminase	Stx2-converting_phage(34.09%)	48	4958476:4958489	4983883:4983896
WP_000956557.1|4936220_4936754_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|4937171_4937453_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4937489_4938062_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4938061_4938796_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4938798_4938990_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829412.1|4939042_4939459_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	71.0	2.1e-31
WP_000145671.1|4939603_4940077_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4940073_4940424_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4940414_4940951_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4941078_4941903_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4941968_4942331_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4943034_4943727_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4943824_4944085_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4944077_4944629_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4946141_4946894_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4947203_4947356_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_086893298.1|4948173_4950024_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_000411802.1|4950472_4950679_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4950678_4951176_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4951392_4951578_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4952105_4952420_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001377217.1|4952673_4953204_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_000958398.1|4953319_4953883_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4953879_4955541_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_086893299.1|4955604_4957542_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.6	0.0e+00
WP_001063096.1|4957586_4957808_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
4958476:4958489	attL	CAACTGGGACAGCG	NA	NA	NA	NA
WP_000125988.1|4960171_4960498_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4960507_4960858_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4960854_4961301_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4961297_4961642_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4961708_4962425_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4962430_4962805_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4962900_4963110_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807964.1|4966396_4966738_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001473433.1|4966737_4967436_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_000167715.1|4967441_4968185_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.5	1.6e-141
WP_122996286.1|4968130_4968763_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_086893300.1|4969008_4972485_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_001216290.1|4972553_4973177_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4973241_4974555_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4974556_4974826_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4974986_4975409_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4975538_4976597_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117799.1|4976675_4977326_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	36.6	4.0e-24
WP_001132154.1|4977508_4978099_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4978600_4978849_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|4978910_4980008_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543817.1|4980096_4981134_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4983883:4983896	attR	CGCTGTCCCAGTTG	NA	NA	NA	NA
>prophage 17
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	5121295	5159292	5467988	transposase,tRNA,protease	Vibrio_phage(11.11%)	42	NA	NA
WP_001294195.1|5121295_5122435_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|5122433_5123981_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|5123952_5124414_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|5124432_5125770_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|5125779_5127627_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|5127619_5128570_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|5128655_5128964_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|5129040_5130321_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|5130406_5131666_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5131668_5132673_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5132754_5132952_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527944.1|5133055_5134354_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	1.1e-65
WP_001177639.1|5134558_5134984_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076318.1|5135022_5137383_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001293281.1|5137562_5138294_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|5138420_5138822_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|5138840_5139539_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012546.1|5139589_5140249_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5140266_5140665_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5140674_5141313_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|5141315_5142479_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|5142562_5144188_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5144304_5144580_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|5144728_5145058_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569730.1|5145239_5145989_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5145985_5146741_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5146848_5147913_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|5148267_5149665_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|5149680_5149986_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|5149995_5150460_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5150473_5151124_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5151133_5151988_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5151987_5152674_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5152802_5153078_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5153404_5153800_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5153806_5154121_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5154125_5154353_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5154394_5154844_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001345309.1|5154914_5155709_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072098057.1|5156148_5156763_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
WP_085948178.1|5157694_5158908_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254202.1|5159001_5159292_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
>prophage 18
NZ_CP021339	Escherichia coli strain 95NR1 chromosome, complete genome	5467988	5164026	5284724	5467988	integrase,bacteriocin,holin,capsid,portal,tail,protease,terminase	Escherichia_phage(56.29%)	152	5159309:5159335	5226556:5226582
5159309:5159335	attL	CGTCCTTCAGGGCGTGGAGGATGTCAA	NA	NA	NA	NA
WP_001218308.1|5164026_5165196_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|5165179_5165362_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|5165440_5165818_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_016232247.1|5165853_5166066_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.6	2.7e-30
WP_077694932.1|5166025_5166553_-	hypothetical protein	NA	A0A0N7KZB6	Stx2-converting_phage	100.0	1.2e-100
WP_021351742.1|5166836_5167457_-	antirepressor	NA	A0A0P0ZCA2	Stx2-converting_phage	100.0	7.5e-113
WP_000203819.1|5167705_5167993_-	phage antirepressor Ant	NA	V5URG2	Shigella_phage	97.9	3.9e-48
WP_021351743.1|5168315_5169050_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	100.0	5.5e-131
WP_021351744.1|5169098_5169383_-	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	100.0	7.0e-50
WP_016241156.1|5169375_5169660_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	100.0	5.9e-49
WP_021351745.1|5169659_5170406_-	DUF551 domain-containing protein	NA	G9L658	Escherichia_phage	98.6	5.0e-39
WP_021351746.1|5170407_5171178_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
WP_000763383.1|5171174_5171396_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001443983.1|5171494_5171776_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|5171786_5171978_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|5171950_5172133_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186844.1|5172129_5172810_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_016241376.1|5172806_5173592_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|5173597_5173894_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|5173969_5174113_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198863.1|5174081_5174246_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000065377.1|5174318_5174687_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|5174837_5175308_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024177111.1|5175371_5175995_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	2.8e-107
WP_000198444.1|5176056_5176440_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_001130059.1|5177227_5177749_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000885202.1|5177901_5178243_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_000250473.1|5178303_5179011_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|5179089_5179317_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438533.1|5179455_5179752_+	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_024239443.1|5179914_5180712_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	92.5	1.4e-127
WP_047661639.1|5180819_5183726_+	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	99.3	0.0e+00
WP_021351627.1|5183726_5183996_+	hypothetical protein	NA	G9L682	Escherichia_phage	97.8	5.4e-44
WP_001000127.1|5184066_5184345_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|5184477_5184693_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|5184703_5184940_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|5184896_5185343_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153308.1|5185339_5185867_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254210.1|5185863_5186046_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
WP_021351626.1|5186320_5186998_+	antirepressor	NA	A0A0P0ZC44	Stx2-converting_phage	99.1	4.8e-129
WP_001004008.1|5187072_5187795_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_021351625.1|5187794_5188400_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	99.5	7.3e-97
WP_000144764.1|5188396_5188591_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|5188583_5189018_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_001304085.1|5189266_5189419_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000649753.1|5189799_5190759_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5190770_5191040_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_086893309.1|5191526_5193464_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.4	0.0e+00
WP_000143458.1|5193600_5193780_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|5193820_5194093_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|5194169_5194385_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|5194389_5194923_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_137049440.1|5195237_5195780_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	97.2	5.9e-98
WP_021351520.1|5195779_5195926_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	93.5	2.7e-13
WP_012816804.1|5196153_5196339_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001109019.1|5196577_5197129_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|5197421_5198228_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_086893310.1|5198208_5199915_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_000787034.1|5199914_5202059_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|5202216_5203224_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|5203247_5204462_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|5204517_5204907_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|5204956_5205418_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|5205401_5205965_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|5205964_5206615_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_086893311.1|5206611_5208594_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001023473.1|5208595_5208865_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|5209003_5209192_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_000197192.1|5211107_5212376_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|5212390_5212669_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|5212674_5213292_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|5213382_5214117_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|5214349_5214490_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|5214546_5214948_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|5215041_5215698_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|5215700_5216147_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|5216156_5216408_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|5216418_5217684_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000756595.1|5226684_5227029_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
5226556:5226582	attR	TTGACATCCTCCACGCCCTGAAGGACG	NA	NA	NA	NA
WP_000935259.1|5227148_5227361_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|5227594_5227990_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_016241157.1|5227989_5228601_-	DUF551 domain-containing protein	NA	A0A2L1IV16	Escherichia_phage	73.6	2.0e-81
WP_001014294.1|5228603_5228795_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000237063.1|5228796_5229288_-	hypothetical protein	NA	G9L661	Escherichia_phage	100.0	3.5e-89
WP_021351633.1|5229287_5229914_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	93.8	6.5e-72
WP_016241159.1|5229877_5230507_-	hypothetical protein	NA	G9L663	Escherichia_phage	100.0	7.3e-108
WP_001214440.1|5230503_5230671_-	DUF2737 family protein	NA	G9L664	Escherichia_phage	100.0	1.5e-23
WP_001111288.1|5230681_5230978_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_000073097.1|5231001_5231589_-	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_000536228.1|5231585_5232266_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|5232274_5232463_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|5232459_5232573_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198858.1|5232565_5232706_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000167592.1|5232897_5233368_-	hypothetical protein	NA	G9L670	Escherichia_phage	100.0	3.7e-88
WP_024177094.1|5233431_5234055_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	96.6	8.0e-107
WP_001450670.1|5234066_5234408_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_000035314.1|5235163_5235355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885926.1|5235886_5236228_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000092876.1|5236265_5236940_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	3.1e-104
WP_001054987.1|5237084_5237309_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000438533.1|5237415_5237712_+	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_021351628.1|5237874_5238651_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	99.2	6.0e-136
WP_086893312.1|5238761_5241668_+	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	99.6	0.0e+00
WP_021351627.1|5241668_5241938_+	hypothetical protein	NA	G9L682	Escherichia_phage	97.8	5.4e-44
WP_001220559.1|5242016_5242628_+	HNH endonuclease	NA	A0A0N7BTM0	Escherichia_phage	100.0	5.6e-113
WP_001000127.1|5242673_5242952_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|5243084_5243300_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|5243310_5243547_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|5243503_5243950_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153308.1|5243946_5244474_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254210.1|5244470_5244653_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
WP_021351626.1|5244927_5245605_+	antirepressor	NA	A0A0P0ZC44	Stx2-converting_phage	99.1	4.8e-129
WP_001004008.1|5245679_5246402_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_021351625.1|5246401_5247007_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	99.5	7.3e-97
WP_000144764.1|5247003_5247198_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|5247190_5247625_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_001304085.1|5247873_5248026_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_086893313.1|5248406_5249366_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	4.8e-175
WP_000738068.1|5249377_5249647_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|5250133_5252071_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|5252205_5252385_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|5252425_5252698_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|5252774_5252990_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_086893314.1|5252994_5253528_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	99.4	2.3e-102
WP_001056806.1|5253798_5254368_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_021351520.1|5254367_5254514_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	93.5	2.7e-13
WP_012816804.1|5254741_5254927_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001109019.1|5255165_5255717_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|5256009_5256816_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_086893310.1|5256796_5258503_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_000787034.1|5258502_5260647_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|5260804_5261812_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|5261835_5263050_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|5263105_5263495_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|5263544_5264006_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|5263989_5264553_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|5264552_5265203_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_086893311.1|5265199_5267182_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001023473.1|5267183_5267453_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|5267592_5267781_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|5268075_5269701_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|5269697_5270966_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|5270980_5271259_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|5271264_5271882_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|5271972_5272707_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|5272939_5273080_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|5273136_5273538_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|5273631_5274288_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|5274290_5274737_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|5274745_5274997_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|5275007_5276273_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_086893315.1|5276342_5284724_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	99.6	0.0e+00
>prophage 1
NZ_CP021340	Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence	86917	0	86571	86917	tail,terminase,head,integrase,transposase,holin	Escherichia_phage(61.7%)	102	28591:28610	75799:75818
WP_000888906.1|919_1804_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|2137_2530_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|2541_2682_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|2707_3130_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|3169_3958_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|3966_4146_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|4420_4705_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|4697_5603_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_085948178.1|5668_6882_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000896801.1|6954_7683_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|7686_8904_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|8913_9291_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|9437_9683_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|9685_10264_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000095381.1|10330_10486_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000484112.1|10987_11614_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	2.3e-122
WP_001354545.1|11610_12288_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684845.1|12284_12986_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_000107675.1|13287_14550_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	7.8e-234
WP_000021755.1|14622_15129_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000675629.1|15323_16049_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	3.8e-140
WP_024177054.1|16088_16280_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	4.7e-18
WP_000042974.1|16276_16492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071056.1|16484_17129_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.1	4.4e-132
WP_000154831.1|17125_17893_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	98.5	8.8e-31
WP_001369800.1|17889_18378_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.0	4.4e-44
WP_000797279.1|18550_18739_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000951710.1|18740_18950_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_021351680.1|18946_19489_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	74.6	7.3e-72
WP_000516537.1|19571_19805_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_000269003.1|19983_20277_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_000988658.1|20283_20658_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_000057449.1|20639_21572_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_001261544.1|21568_21931_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|22592_22844_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|22967_23357_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|23429_23651_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|23650_24031_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|24035_24215_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648825.1|24242_25286_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
WP_001369802.1|25374_25827_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219604.1|25913_27107_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	100.0	5.7e-210
WP_000124155.1|27106_28591_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
28591:28610	attL	AATATTTGCTCTAATAAATT	NA	NA	NA	NA
WP_071528000.1|28792_29152_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_021351678.1|29148_30267_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	87.9	1.2e-177
WP_000611662.1|30299_31151_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|31261_31471_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542341.1|32075_32297_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_000481733.1|32316_32712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185180.1|32708_33740_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	98.5	2.7e-192
WP_001224234.1|33790_34102_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_000848372.1|34347_34908_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.4	7.2e-99
WP_001398228.1|35097_35739_+	hypothetical protein	NA	Q71TG2	Escherichia_phage	98.6	6.3e-115
WP_000766013.1|35772_36084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245705.1|36523_36745_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	1.3e-30
WP_021351710.1|36741_37854_+	oxidoreductase	NA	A0A077SLR9	Escherichia_phage	88.7	2.6e-180
WP_000747846.1|37896_38145_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|38141_38582_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_001038175.1|38615_45383_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_000774711.1|45458_47168_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.1	0.0e+00
WP_000132939.1|47160_48180_+|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	9.2e-185
WP_001345478.1|48471_49029_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068865.1|49198_49687_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001376650.1|49884_50562_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_000432103.1|50568_51357_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.4	4.8e-141
WP_001165938.1|51386_51701_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	89.4	5.7e-45
WP_000058808.1|51690_54678_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_000175481.1|54690_55056_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	98.3	6.7e-45
WP_000434673.1|55052_56972_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.1	0.0e+00
WP_001345482.1|56973_57576_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|57562_58006_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|58002_58332_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|58222_58597_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_122995369.1|59087_59660_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|59703_60282_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_021351644.1|60281_63131_-|tail	tail protein	tail	Q71TP5	Escherichia_phage	94.6	0.0e+00
WP_001286326.1|63142_63577_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|63655_64492_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|64491_65925_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|65921_66278_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440148.1|66277_69682_-	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	92.8	0.0e+00
WP_000926354.1|69763_70645_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	3.1e-173
WP_000523980.1|70659_71271_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188915.1|71281_71848_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	9.5e-99
WP_071533444.1|71992_72064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555836.1|72123_73017_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	2.6e-26
WP_001057312.1|73068_73545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|73567_73918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|74276_74396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201261.1|74414_74636_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.1e-25
WP_001260613.1|74632_75724_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	79.4	4.6e-158
WP_001187879.1|75888_76689_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	9.2e-148
75799:75818	attR	AATATTTGCTCTAATAAATT	NA	NA	NA	NA
WP_001369580.1|76718_77564_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.9	3.6e-150
WP_001369577.1|77614_77860_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	43.8	1.7e-12
WP_000268408.1|78042_78639_-	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.0	1.2e-107
WP_000509942.1|78811_79321_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	3.9e-91
WP_000035302.1|79332_79914_-	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000041774.1|79949_80765_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085153.1|80774_82364_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.6	3.7e-305
WP_000067713.1|82424_84131_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038866.1|84356_85358_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|85374_86571_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
