The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	290999	369690	5012084	tail,holin,integrase,tRNA,protease,plate,capsid,terminase,portal,head	Enterobacteria_phage(57.14%)	84	306933:306975	340575:340617
WP_000208242.1|290999_291530_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|291539_292871_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|292937_293864_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|293956_294442_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|294526_294772_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|295196_296042_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136804.1|296064_297573_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|297743_298754_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796342.1|298850_299597_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|299601_300030_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|300056_300356_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155252.1|300567_301008_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802235.1|301108_301708_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|301815_302583_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001296622.1|302637_303393_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758732.1|303499_304489_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|304808_305771_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|305951_306854_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
306933:306975	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGG	NA	NA	NA	NA
WP_072129309.1|307102_307351_-	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	45.3	1.2e-08
WP_052929135.1|307389_308499_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	1.1e-194
WP_021533073.1|308655_309840_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	5.3e-224
WP_000290462.1|309839_310352_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|310407_310782_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_170891090.1|310790_310946_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.2e-21
WP_086908449.1|310932_313740_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.9	0.0e+00
WP_000979954.1|313752_314241_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905060.1|314276_314864_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	100.0	2.4e-105
WP_000071739.1|319240_319771_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111924.1|319763_320660_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_001067548.1|320663_320993_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077626020.1|321010_321577_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	3.9e-100
WP_000356345.1|321588_322224_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	3.1e-114
WP_000920597.1|322216_322684_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.2e-85
WP_000780540.1|322821_323229_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
WP_000072328.1|323225_323618_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104350.1|323614_323938_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|323940_324141_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063082.1|324140_324635_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_086908451.1|324737_325538_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	1.4e-124
WP_001055118.1|325583_326636_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_001262673.1|326658_327495_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613769.1|327649_329401_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.3	0.0e+00
WP_000087812.1|329400_330447_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_052929073.1|330940_331579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052929074.1|331582_332581_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_086908452.1|332739_335127_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	88.5	0.0e+00
WP_072129282.1|335123_336038_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	53.2	1.6e-95
WP_023309722.1|336034_336355_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.9e-27
WP_086908453.1|336354_337326_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	4.7e-138
WP_052929078.1|337327_337540_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	65.7	2.8e-19
WP_016246743.1|337626_337857_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	97.4	1.4e-37
WP_077817609.1|337846_338053_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	1.6e-32
WP_086908454.1|338063_338267_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	95.5	9.8e-30
WP_032969839.1|338277_338559_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	97.8	9.0e-50
WP_032969836.1|338654_338891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000229412.1|339096_339417_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	6.9e-54
WP_052929080.1|339486_340467_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	1.8e-185
WP_001223800.1|340644_341145_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
340575:340617	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGG	NA	NA	NA	NA
WP_001033720.1|341294_341993_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|341989_343363_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270242.1|343533_344208_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001296619.1|345597_346218_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001296618.1|347532_348471_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217147.1|348454_349291_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144100.1|349578_351048_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001296617.1|351044_352304_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179746.1|352570_353395_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619499.1|353404_353719_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000749934.1|353759_355154_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000753589.1|356149_356983_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077633686.1|357176_360227_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331383.1|360239_361142_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|361138_361774_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027696.1|361770_362700_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001068514.1|362881_363124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|363413_364262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140890.1|364577_365027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|365211_365430_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001296612.1|365826_366105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|366463_366754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897302.1|366754_367066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001385591.1|367294_368203_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001297068.1|368266_369208_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560981.1|369252_369690_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	1416739	1463429	5012084	lysis,transposase	Stx2-converting_phage(45.45%)	34	NA	NA
WP_000080195.1|1416739_1418353_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1418383_1418734_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1418730_1419156_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_042012683.1|1419270_1419612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997995.1|1419832_1421371_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|1422498_1422849_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|1422845_1423271_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|1423642_1423780_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001149834.1|1423931_1424849_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|1424882_1425758_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|1425806_1427279_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|1427282_1428113_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|1428158_1428869_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|1428881_1429991_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001305022.1|1430040_1430976_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|1431011_1431746_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|1431845_1432832_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|1432983_1434211_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|1434711_1436802_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|1437663_1437906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|1438196_1438556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|1438559_1438775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|1443555_1444707_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_011076574.1|1449439_1449583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|1450133_1452335_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|1452416_1453694_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|1453690_1455433_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|1455432_1456380_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|1456380_1458105_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|1458240_1459434_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|1460151_1460580_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|1460619_1461180_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|1461221_1461482_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|1463315_1463429_+|lysis	lysis protein	lysis	NA	NA	NA	NA
>prophage 3
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	1754911	1762051	5012084		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1754911_1755550_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1755546_1756809_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1756805_1757714_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|1757909_1758677_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1758727_1759384_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|1759489_1762051_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 4
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	2338651	2348096	5012084		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|2338651_2339578_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|2339582_2340314_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2340294_2340402_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|2340461_2341193_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|2341414_2343100_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2343096_2343816_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2343862_2344333_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|2344373_2344835_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|2344959_2346963_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|2346959_2348096_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 5
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	2442272	2448575	5012084		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|2442272_2443667_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|2443841_2444735_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|2445107_2446193_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|2446192_2447092_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|2447149_2448028_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|2448032_2448575_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 6
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	2479378	2485830	5012084	transposase	Pseudomonas_phage(16.67%)	9	NA	NA
WP_000086752.1|2479378_2480023_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|2480041_2480263_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|2480325_2480802_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|2480817_2481291_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|2481384_2481630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2481629_2482448_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|2482668_2483079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|2483527_2484274_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2484288_2485830_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 7
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	2629971	2719469	5012084	tail,holin,integrase,tRNA,transposase,plate,capsid,terminase,portal	Pectobacterium_phage(20.45%)	103	2629786:2629845	2673650:2673774
2629786:2629845	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|2629971_2630988_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2630956_2631220_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2631429_2631612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2631611_2632181_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2632177_2634394_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2634424_2634745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2635755_2636169_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2636267_2636498_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2636556_2637033_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2637072_2637297_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2637293_2638049_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2638038_2639454_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2639492_2639903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2639904_2640141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2640137_2640449_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2640445_2640670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2641351_2642140_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2642314_2643238_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2644425_2645124_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2645586_2646192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2646201_2646690_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2647088_2647322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2647565_2648207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2648358_2648538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2648615_2649212_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2649208_2649502_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2649501_2650173_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2650285_2650669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2650668_2650941_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2650940_2651420_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2651427_2651622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2651681_2651927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2652295_2652862_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2652848_2654711_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2654710_2654944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2654940_2656515_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2656514_2657822_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2657821_2658151_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2658209_2659244_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2659278_2659698_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2659694_2660075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2660106_2660787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2660783_2661320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2661300_2662203_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2662205_2662547_+	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2662543_2663464_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2663466_2664093_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2664085_2665270_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2665269_2665659_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2665655_2667158_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2667175_2667688_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000444667.1|2667700_2667982_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2668090_2669731_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2669766_2670156_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2670317_2670542_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_085949154.1|2671907_2673054_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000847882.1|2673900_2674566_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2673650:2673774	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|2674616_2675828_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2676018_2676258_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2676295_2676793_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2676964_2677288_-	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_010723106.1|2677551_2677638_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2677752_2678004_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2678081_2678585_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2679379_2680369_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|2680438_2681953_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|2681967_2682954_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2683120_2683921_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2683895_2685320_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2685326_2685755_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2686534_2686885_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2686887_2687466_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2687592_2688480_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2688476_2689403_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2689407_2691372_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2691392_2691896_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2692040_2693702_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2693992_2694853_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2694855_2695905_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2695919_2696309_+	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|2696319_2696964_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2697152_2698301_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2698293_2700372_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2700371_2700764_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2700816_2702550_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2702765_2703332_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2703345_2704092_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2704479_2705580_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2705604_2708034_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|2708069_2709041_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2709037_2709781_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2709821_2710217_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639277.1|2710269_2711088_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|2711084_2711651_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2711960_2713733_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|2713725_2714178_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2714206_2714947_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2714981_2715503_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|2715504_2716107_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|2716177_2716243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2716381_2716993_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|2717001_2718012_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|2718121_2719469_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 8
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	3212082	3283049	5012084	tail,holin,integrase,transposase,protease,capsid,terminase,portal,head	Stx2-converting_phage(24.14%)	80	3240968:3240982	3284013:3284027
WP_000422062.1|3212082_3213132_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|3213351_3214110_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|3214106_3214697_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|3214753_3215062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622024.1|3215071_3216094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|3216263_3217139_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|3217351_3219247_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3219274_3219895_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|3219891_3220773_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3220910_3220955_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|3221046_3222609_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|3222608_3224204_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|3224207_3225566_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|3225577_3226771_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|3226770_3227577_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|3227952_3228228_+	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|3228224_3228782_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000251936.1|3228908_3229079_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|3229193_3229463_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|3229519_3230188_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|3230386_3230569_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|3230694_3231663_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|3231678_3232206_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|3232236_3232770_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|3232771_3235597_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|3236058_3236805_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3236819_3238361_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|3239001_3242475_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
3240968:3240982	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|3242817_3243450_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|3243395_3244139_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|3244149_3244848_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|3244847_3245189_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|3245181_3248424_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|3248471_3248681_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|3248776_3249151_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|3249165_3249882_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3249948_3250293_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3250289_3250736_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3250732_3251083_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3251092_3251419_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|3251415_3254001_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3253946_3254168_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|3254212_3256150_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|3256213_3257875_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|3257871_3258435_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|3258724_3259090_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|3259131_3259332_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|3259530_3259746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|3259831_3260017_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|3260238_3260325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|3260879_3261413_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_085949154.1|3261522_3262670_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000369850.1|3262771_3263044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|3263009_3263354_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|3263358_3263574_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|3263724_3265578_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|3265838_3266174_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|3266454_3266586_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|3267387_3268437_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|3268588_3268786_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|3269012_3269834_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|3269830_3270211_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|3270211_3271267_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|3271268_3271541_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|3271708_3271921_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|3272101_3272767_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|3272941_3273367_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|3273382_3274153_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|3274174_3274921_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|3274927_3275890_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|3275912_3276338_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3276334_3276550_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|3276599_3277316_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|3277588_3277744_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|3277903_3278122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|3278687_3278876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|3278872_3279064_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|3279156_3281628_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|3281692_3281941_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|3281918_3283049_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3284013:3284027	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 9
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	3422261	3467970	5012084	tail,lysis,holin,integrase,tRNA,capsid,terminase,portal,head	Enterobacteria_phage(56.0%)	58	3441045:3441059	3469639:3469653
WP_000654172.1|3422261_3422540_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|3422536_3424558_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|3424616_3428099_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|3428159_3428762_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|3428698_3429442_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|3429446_3430145_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|3430144_3430474_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|3430470_3433032_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|3433024_3433459_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|3433440_3433863_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|3433878_3434619_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|3434626_3435022_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|3435018_3435597_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|3435608_3435962_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|3435973_3436372_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|3436413_3437439_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|3437494_3437827_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|3437836_3439156_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|3439136_3440738_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|3440734_3440941_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|3440937_3442863_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
3441045:3441059	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|3442837_3443383_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|3443946_3444129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3444335_3444662_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3445142_3445436_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3445526_3445709_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|3445925_3446402_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|3446388_3446694_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|3447015_3447705_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|3447701_3447842_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|3447838_3448201_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|3448197_3448488_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|3448480_3448651_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|3448650_3449106_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|3449102_3449204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|3449553_3450597_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|3450633_3454899_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|3455148_3455850_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_000147894.1|3455846_3456866_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_001182900.1|3456862_3457402_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|3457471_3457702_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3457806_3458496_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3459091_3459298_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|3459373_3459670_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|3459675_3460461_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3460457_3461138_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|3461134_3461317_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|3461289_3461481_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|3461491_3461773_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|3461871_3462093_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3462092_3462419_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3462402_3462642_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3462781_3463018_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3463007_3464150_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3464263_3465514_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|3465685_3466339_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3466348_3466810_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3466863_3467970_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3469639:3469653	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 10
NZ_CP021179	Escherichia coli strain 81009 chromosome, complete genome	5012084	3665078	3750431	5012084	tail,holin,tRNA,integrase,transposase,plate,protease,capsid	Burkholderia_virus(33.33%)	92	3674363:3674378	3693684:3693699
WP_001295930.1|3665078_3665864_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3665999_3666779_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3666755_3667649_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3667802_3668549_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3668545_3668728_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3668779_3670012_-	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000570547.1|3670048_3671035_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3671031_3672780_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3672816_3675081_-	ComEC family protein	NA	NA	NA	NA	NA
3674363:3674378	attL	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_000167336.1|3675286_3675571_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3675730_3677404_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3677514_3678198_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|3678370_3679153_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|3679296_3679686_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|3679657_3680107_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|3680108_3680315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|3680304_3680535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|3680531_3681215_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|3681211_3681427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3681441_3681738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|3681747_3682020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3682308_3682839_-	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|3682866_3683136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|3683138_3684305_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|3684315_3686085_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|3686100_3686418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|3686417_3687338_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|3687348_3687657_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3687709_3687898_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3687991_3688348_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3688464_3689229_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3689419_3689635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|3689636_3690038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|3690013_3690742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3690872_3691223_+|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|3691225_3691966_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|3691949_3692600_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|3692596_3692923_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|3692922_3693234_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|3693233_3693779_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
3693684:3693699	attR	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_169542415.1|3693829_3695371_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000090684.1|3695370_3696867_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|3696847_3697669_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|3697671_3698130_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|3698344_3699460_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|3699474_3700428_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|3700437_3700776_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|3700777_3701224_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|3701223_3701688_+	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666499.1|3701687_3701939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|3701928_3703356_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|3703352_3703877_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000110114.1|3703879_3704161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|3704258_3704594_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|3704517_3704676_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|3704751_3707703_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|3707702_3708587_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000478224.1|3708586_3708799_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|3708786_3709941_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|3709937_3710534_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|3710588_3710936_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|3710926_3712030_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|3712022_3712601_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|3712603_3713935_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|3713934_3714549_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|3714555_3715017_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_064767240.1|3715027_3715468_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|3715527_3716100_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|3716355_3717639_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3717709_3718798_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3718996_3719689_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|3719818_3721579_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|3721984_3722842_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3722896_3725179_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3725370_3726111_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|3726207_3727356_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3727669_3728296_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|3728331_3729195_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3729196_3729814_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3729824_3732269_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3732507_3733800_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|3733890_3735234_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3735244_3735856_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|3736014_3740121_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3740255_3740750_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|3741293_3742259_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|3742381_3744148_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|3744148_3745870_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|3745911_3746616_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3746900_3747119_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3747803_3750080_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3750110_3750431_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 1
NZ_CP021180	Escherichia coli strain 81009 plasmid pEC-81009, complete sequence	135720	18029	66571	135720	transposase,integrase	Escherichia_phage(50.0%)	43	4231:4250	58452:58471
4231:4250	attL	TAGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_001189113.1|18029_19538_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|20039_20444_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|20440_20788_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|21867_22890_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_001323403.1|22889_23669_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001067858.1|25057_25762_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|26727_27201_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|27331_28120_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|28325_28673_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|28666_29506_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|29633_29837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|29992_31198_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|31208_31514_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|31740_32505_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|32997_33582_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|33581_34820_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|34816_35722_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|35843_36548_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001043260.1|37092_37908_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|37968_38772_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|38771_39608_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_042005022.1|39661_39898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031606906.1|39929_40556_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|40661_41861_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001067858.1|42277_42982_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001298664.1|43253_45224_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|46466_46739_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001072358.1|47585_48755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|49121_49310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066941.1|49430_50171_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|50455_51433_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001617898.1|52218_52950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081352.1|54775_55708_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|55694_57098_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|57305_58322_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|58549_58867_+	hypothetical protein	NA	NA	NA	NA	NA
58452:58471	attR	GCTTATTCGCACCTTCCCTA	NA	NA	NA	NA
WP_001513660.1|59153_59513_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|59540_59720_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|59724_60105_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|60104_60326_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|60508_62065_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|62061_63333_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001553854.1|63454_66571_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
