The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	1732	83709	2129370	integrase,head,capsid,transposase,protease,terminase,plate,portal	Lactobacillus_phage(71.7%)	96	36300:36359	83809:83875
WP_024273054.1|1732_2782_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_065169494.1|4429_7000_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035425608.1|7009_7720_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	6.5e-36
WP_035425606.1|8002_8635_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_020807292.1|8696_9821_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020807294.1|12657_13203_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.8	2.0e-32
WP_003648947.1|13316_13853_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_020807295.1|13880_17069_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_020807296.1|17061_18150_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	8.6e-56
WP_020807297.1|18146_19424_-	dihydroorotase	NA	NA	NA	NA	NA
WP_020807298.1|19423_20380_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.9	2.5e-22
WP_003648952.1|20526_21069_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003648953.1|21238_22162_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_020807299.1|22413_23121_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003647205.1|23122_23761_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	31.4	1.4e-26
WP_065169493.1|24010_25606_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_020807301.1|25647_26469_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_020807302.1|26473_27502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648959.1|27631_27958_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	36.5	2.4e-06
WP_020807303.1|27987_29379_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_020807304.1|29378_30356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024272995.1|30414_31464_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_087261171.1|31529_32294_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020807306.1|32375_32948_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003648964.1|32975_33161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807307.1|33232_34069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807308.1|34078_34897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648967.1|34899_35607_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.0e-16
WP_003648968.1|35608_35977_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
36300:36359	attL	TTTCTCTCAACATTCAATTGATTGATCTTACGTAAAACATCCACAGCTTTCCACATACTT	NA	NA	NA	NA
WP_065169492.1|36503_36689_-	hypothetical protein	NA	O48431	Lactobacillus_phage	88.5	2.3e-22
WP_003656391.1|37233_38181_-	lysin	NA	Q38317	Lactobacillus_phage	88.7	6.6e-161
WP_003656393.1|38184_38529_-	hypothetical protein	NA	Q38316	Lactobacillus_phage	93.0	1.7e-50
WP_003656394.1|38525_38735_-	hypothetical protein	NA	Q9T1D9	Lactobacillus_phage	98.6	2.5e-20
WP_024273047.1|38738_39128_-	hypothetical protein	NA	Q9T1E0	Lactobacillus_phage	88.7	3.7e-41
WP_020807530.1|39093_39303_-	hypothetical protein	NA	Q9T1E1	Lactobacillus_phage	98.6	1.3e-32
WP_065169660.1|39315_39780_-	hypothetical protein	NA	Q9T1E2	Lactobacillus_phage	94.8	1.0e-74
WP_087261173.1|39834_42666_-|plate	BppU family phage baseplate upper protein	plate	Q9T1E3	Lactobacillus_phage	91.5	0.0e+00
WP_020807532.1|42595_42805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169533.1|42820_45619_-	endopeptidase	NA	Q9T1E4	Lactobacillus_phage	97.6	0.0e+00
WP_020807534.1|45615_46359_-	phage protein	NA	Q9T1E6	Lactobacillus_phage	85.0	2.1e-125
WP_087261174.1|46345_51802_-	tape measure protein	NA	Q9T1E7	Lactobacillus_phage	93.0	0.0e+00
WP_065169532.1|52012_52564_-	hypothetical protein	NA	Q9T1F0	Lactobacillus_phage	85.8	5.7e-80
WP_065169531.1|53527_53899_-	DUF806 family protein	NA	Q9T1F2	Lactobacillus_phage	91.1	3.4e-60
WP_020807539.1|53882_54362_-	hypothetical protein	NA	Q9T1F3	Lactobacillus_phage	84.9	9.3e-71
WP_035425575.1|54354_54711_-|head	phage head closure protein	head	Q9T1F4	Lactobacillus_phage	94.9	3.6e-59
WP_087261177.1|54667_55048_-	DNA packaging protein	NA	Q9T1F5	Lactobacillus_phage	84.1	3.8e-51
WP_065169529.1|55064_56255_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	87.8	8.5e-198
WP_087261179.1|56260_56974_-|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	87.0	5.6e-112
WP_087261182.1|56933_58130_-|portal	phage portal protein	portal	Q9T1F8	Lactobacillus_phage	92.0	2.9e-198
WP_065169526.1|58129_58336_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_087261185.1|58316_60191_-|terminase	terminase large subunit	terminase	Q9T1F9	Lactobacillus_phage	93.3	0.0e+00
WP_020807546.1|60187_60637_-|terminase	phage terminase small subunit P27 family	terminase	Q9T1G0	Lactobacillus_phage	96.0	1.3e-77
WP_065169523.1|60802_61315_-	HNH endonuclease	NA	Q9T1G1	Lactobacillus_phage	85.9	1.2e-87
WP_147614539.1|61646_62102_-	hypothetical protein	NA	Q9T1G2	Lactobacillus_phage	89.2	4.2e-73
WP_003656430.1|62192_62687_-	hypothetical protein	NA	Q9T1G3	Lactobacillus_phage	98.8	7.6e-92
WP_065169535.1|62683_63046_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	64.1	2.9e-40
WP_081275656.1|63038_63419_-	hypothetical protein	NA	Q9T1G5	Lactobacillus_phage	84.9	2.1e-49
WP_065169521.1|63553_63871_-	hypothetical protein	NA	Q9T1G6	Lactobacillus_phage	99.0	5.6e-48
WP_081275650.1|63870_64161_-	hypothetical protein	NA	Q9T1G7	Lactobacillus_phage	86.3	6.1e-25
WP_147614540.1|64171_64342_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_065169520.1|64331_64574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169519.1|64557_64809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169518.1|64801_65074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169517.1|65060_65327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261187.1|65323_65569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664534.1|66223_67504_-	virulence protein E	NA	A0A0A1EL11	Lactobacillus_phage	47.2	4.8e-98
WP_087261197.1|67493_68300_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	64.6	2.8e-88
WP_087261200.1|68312_68912_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	42.6	2.2e-37
WP_087261204.1|68915_69650_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	45.3	4.9e-47
WP_087261207.1|71035_71290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261210.1|71283_71625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169503.1|72064_72280_-	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	94.4	1.8e-34
WP_021315033.1|72291_72489_-	hypothetical protein	NA	Q9T1I7	Lactobacillus_phage	96.9	6.1e-29
WP_155761827.1|72579_72744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169502.1|72877_73324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664536.1|73450_73612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169501.1|73761_74058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261212.1|74114_74324_-	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	46.4	2.8e-08
WP_087261215.1|74604_74832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087261220.1|74937_75159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087261223.1|75173_75446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261226.1|75506_75692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087261229.1|75684_75906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035422750.1|75967_76234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035422755.1|76346_76568_-	hypothetical protein	NA	Q9T1J1	Lactobacillus_phage	90.3	1.4e-29
WP_003656455.1|76594_77326_-	toxin Bro	NA	A0A141DZC7	Streptococcus_phage	49.1	4.2e-54
WP_051994791.1|77383_77572_-	helix-turn-helix transcriptional regulator	NA	Q9G0C3	Lactococcus_phage	45.9	1.2e-05
WP_157664538.1|77537_77711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656456.1|78050_78422_+	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	38.5	1.2e-09
WP_087261232.1|78437_78839_+	ImmA/IrrE family metallo-endopeptidase	NA	O48433	Lactobacillus_phage	68.3	2.0e-42
WP_087261235.1|78873_79554_+	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	45.0	8.6e-46
WP_087261238.1|79571_79940_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	31.9	1.1e-10
WP_087261241.1|79914_80121_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_087261244.1|80152_80383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003653473.1|80913_81894_+	Abi family protein	NA	M1PS09	Streptococcus_phage	43.4	5.4e-65
WP_065169753.1|82455_83709_+|integrase	site-specific integrase	integrase	Q37880	Lactobacillus_phage	39.5	7.1e-78
83809:83875	attR	TTTCTCTCAACATTCAATTGATTGATCTTACGTAAAACATCCACAGCTTTCCACATACTTTCGAGGA	NA	NA	NA	NA
>prophage 2
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	257331	304807	2129370	protease,transposase,bacteriocin	unidentified_phage(27.27%)	40	NA	NA
WP_024273054.1|257331_258381_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_003649102.1|260667_261105_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065169717.1|261277_262750_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_020807525.1|262749_263310_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_024273048.1|263351_264017_-	nitroreductase	NA	NA	NA	NA	NA
WP_020807580.1|264290_265421_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_020807581.1|265467_266055_-	cell division protein	NA	NA	NA	NA	NA
WP_020807582.1|266047_266467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020807583.1|266602_268414_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.2	2.3e-93
WP_003649162.1|268755_269451_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_020806787.1|269496_270267_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_065169716.1|270354_272889_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.8	2.5e-66
WP_080972639.1|273578_273992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806790.1|274114_276499_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_020806791.1|276628_277903_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_020806792.1|277912_278578_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	3.8e-22
WP_020806793.1|278582_279194_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_020806794.1|279261_280326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806795.1|280454_280865_-	OsmC family protein	NA	NA	NA	NA	NA
WP_020806796.1|280878_282426_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_051904648.1|282418_283381_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	9.1e-25
WP_087261251.1|283501_284551_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_020806798.1|284707_285541_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_003649175.1|285660_286569_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.1e-78
WP_020806799.1|286627_287551_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003649177.1|287566_288391_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003649178.1|288577_289024_+	flavodoxin	NA	NA	NA	NA	NA
WP_020806801.1|289562_290705_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.5	8.5e-30
WP_020806802.1|291187_292513_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_020806803.1|292512_293748_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	27.6	1.8e-33
WP_020806804.1|293758_294475_-	lysozyme M1 (1,4-beta-N-acetylmuramidase)	NA	NA	NA	NA	NA
WP_020806805.1|294588_295899_+	amino acid permease	NA	NA	NA	NA	NA
WP_003649185.1|295982_296552_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.1	1.0e-07
WP_039157093.1|296649_298029_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_051904647.1|298079_298784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|299012_300062_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_003649188.1|300097_300754_-	nitroreductase	NA	NA	NA	NA	NA
WP_020806808.1|300920_303326_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_020806809.1|303437_304217_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_020806810.1|304480_304807_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	309352	367343	2129370	transposase,bacteriocin	unidentified_phage(35.71%)	53	NA	NA
WP_024272995.1|309352_310402_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_020806815.1|310537_312076_-	YfcC family protein	NA	NA	NA	NA	NA
WP_048684893.1|312230_312914_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_020806817.1|312931_313687_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.5e-17
WP_003647608.1|313697_314498_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.0	3.1e-10
WP_003647609.1|314508_315399_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_020806818.1|315398_316391_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_020806819.1|316407_317277_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003649202.1|317394_317925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087261269.1|318583_319633_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
WP_020806822.1|319934_321431_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_020806823.1|321532_322381_-	patatin family protein	NA	NA	NA	NA	NA
WP_024273036.1|322453_325255_-	cation-transporting P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	27.9	6.7e-76
WP_020806825.1|325390_325705_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003649208.1|325888_326119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|326260_327310_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_003649213.1|327592_327790_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_049159833.1|327799_328027_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_087261269.1|328346_329396_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
WP_003649215.1|329529_330123_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003649216.1|330133_332293_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	6.5e-47
WP_003649217.1|332305_333103_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065169554.1|333099_334407_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003649220.1|334409_334562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806830.1|334704_336072_-	MFS transporter	NA	NA	NA	NA	NA
WP_035425644.1|336230_336869_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	1.1e-37
WP_003649223.1|336908_337703_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_065169555.1|337845_339774_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_020806832.1|339968_340694_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_020806833.1|340707_342366_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_020806834.1|342472_343309_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_020806835.1|343355_344006_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003647625.1|344019_344658_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020806836.1|344654_345479_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003647627.1|345480_346230_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.9e-35
WP_020806837.1|346680_347502_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020806838.1|347553_349323_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	5.4e-47
WP_020806839.1|349315_351049_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.0e-38
WP_003649234.1|351049_351490_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806840.1|351578_352430_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003649236.1|352527_353760_-	MFS transporter	NA	NA	NA	NA	NA
WP_020806841.1|353912_355406_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.5	2.0e-71
WP_020806842.1|355553_357590_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_020806843.1|357944_359231_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_020806844.1|359265_360699_+	amino acid permease	NA	NA	NA	NA	NA
WP_020806845.1|360724_362011_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_003649245.1|362068_362269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806846.1|362268_363354_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_020806847.1|363659_364247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649248.1|364332_364764_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806848.1|364756_364966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806849.1|364967_366179_+	MFS transporter	NA	NA	NA	NA	NA
WP_087261269.1|366293_367343_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
>prophage 4
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	598911	650529	2129370	protease,transposase,tRNA,holin	unidentified_phage(30.77%)	40	NA	NA
WP_020807222.1|598911_601380_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.6	3.1e-125
WP_020807223.1|601832_603374_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.7	4.3e-85
WP_003649473.1|603388_604396_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_020807224.1|604455_605331_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_024273054.1|605522_606572_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020807225.1|606753_609453_-	YfhO family protein	NA	NA	NA	NA	NA
WP_020807226.1|609535_611662_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	42.0	7.0e-110
WP_020807227.1|611745_613041_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.6	2.9e-10
WP_003649478.1|613062_613419_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003647843.1|613418_613796_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003649479.1|613884_614127_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_065169769.1|614140_617638_-	transcription-repair coupling factor	NA	S6B678	Bacillus_phage	32.1	3.1e-06
WP_020807229.1|617639_618197_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003649482.1|618377_619349_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003647846.1|619491_620172_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087261301.1|620234_621365_-	alanine racemase	NA	NA	NA	NA	NA
WP_020807231.1|621364_621724_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_020807232.1|621796_623254_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	39.4	2.4e-69
WP_020807233.1|623269_624637_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003647850.1|624802_625054_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_020807234.1|625171_626773_-	APC family permease	NA	NA	NA	NA	NA
WP_020807235.1|626871_627636_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.2	6.6e-10
WP_020807236.1|627628_628528_-	ribose/xylose/arabinose/galactoside ABC transporter permease	NA	NA	NA	NA	NA
WP_020807237.1|628524_629517_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020807238.1|629775_632007_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_020807239.1|632077_633313_-	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	52.4	8.8e-97
WP_020807240.1|633461_634877_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_087261269.1|635118_636168_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
WP_024273009.1|636260_636743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806545.1|637307_638024_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_020806546.1|638062_638329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806547.1|638392_639574_-	permease	NA	NA	NA	NA	NA
WP_020806548.1|641675_643034_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_003649502.1|643240_643753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806549.1|643838_644348_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	40.6	5.3e-24
WP_003649506.1|645727_646018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155761860.1|646075_646243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|646249_647299_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_077410116.1|647979_648069_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_087261269.1|649479_650529_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
>prophage 5
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	879257	926737	2129370	transposase,integrase	Streptococcus_phage(30.77%)	48	903353:903412	925654:926847
WP_024273054.1|879257_880307_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020807263.1|880811_881639_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	64.2	3.9e-101
WP_003648116.1|881774_882041_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020807262.1|882075_882240_-	CsbD family protein	NA	NA	NA	NA	NA
WP_020807261.1|882529_883456_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_020807260.1|883490_885413_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	28.8	9.5e-66
WP_087261323.1|885647_887240_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.2	7.0e-06
WP_003649711.1|887564_887750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649712.1|887861_888701_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	37.3	8.7e-48
WP_020807258.1|888736_889444_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_020807257.1|889583_890273_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_003649715.1|890325_890973_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020807256.1|891111_891969_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_020807255.1|892006_893170_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081275658.1|893413_894451_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003656874.1|894500_895019_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_003648125.1|895021_895216_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065169565.1|896599_897439_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_052536208.1|898696_899899_-	MFS transporter	NA	NA	NA	NA	NA
WP_007125836.1|899904_900642_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	35.4	1.3e-15
WP_007125837.1|900707_900980_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_065169564.1|901446_902304_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065169563.1|902421_903255_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
903353:903412	attL	TCGTAAATTGCAATAATAAATTGAACACTTTTGGTTAAGCTGCTTGATAGATTCGATCTA	NA	NA	NA	NA
WP_024273054.1|903386_904436_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_087261325.1|904568_905426_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065169561.1|905495_906401_-	hypothetical protein	NA	A0A1D8EX18	Mycobacterium_phage	40.1	9.7e-53
WP_060462323.1|906400_907441_-	DNA methylase	NA	A0A1D8EX39	Mycobacterium_phage	60.6	6.8e-127
WP_065169560.1|907492_908722_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_056940688.1|908767_908947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940687.1|908948_909332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624854.1|909331_910153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624855.1|910239_911034_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_060462321.1|911023_911575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056940629.1|911592_912033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060462320.1|912215_912932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065169559.1|913003_913810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003656878.1|914223_914925_+	methyltransferase	NA	G3MA03	Bacillus_virus	41.9	2.3e-17
WP_020807252.1|915032_917051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807251.1|917179_918322_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003649724.1|918399_919284_-	ROK family protein	NA	NA	NA	NA	NA
WP_003649725.1|919380_920754_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.1	1.3e-125
WP_003649726.1|920756_921212_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003648132.1|921223_923242_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_020807249.1|923347_924265_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003649728.1|924359_924596_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003648134.1|924620_925139_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	50.6	2.7e-39
WP_003648136.1|925172_925469_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_024273054.1|925687_926737_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
925654:926847	attR	TCGTAAATTGCAATAATAAATTGAACACTTTTGGTTAAGCTGCTTGATAGATTCGATCTAATTCTCTTTCAAAGATTTCATCTGGTGTATGATAAGCTAAGATCTTTCTTGGCAATGAGTTGCACCAGGTTTCAATATCAATGATATTTTGTAAAGAATAGTTAGCTATTGCTTCTCCTTTAGGAATGAATCTGCGAATAAGACCATTGTGTCTTTCAACTGTTCCCTTATCACAAGAAGTGTAAGGATGGGCATAGTAAACCAGTGTATTGGATGCTTCTTCTAGGTTGGACAGATCCGCAAATTCTGAACCATTATCAGTGGTAATAGTTTTAAAAATATCATTCCAGTGTTCACTGTATTGTCTTTGGAGTTCTTTAAAGGCTTGCATGACACTGATAGAAGTCTTGTCGGGAATACGAATAATTAAGAATTCACGACTCATGCGCTCAGATAAGGTTAACAGCACTTCATCATCTTTAGTCTTATGTCCAAGAACCAAATCGCATTCCCAATGACCGAATTCATTACGTTCACTAATTTCTTTTGGACGTTCTTCAATACTTCTGCCAAGCTTTTTCTTGTTTTTGCGAACACGATGAAGCTTGGTATTGCGTTTAAGCTTCTCAGGCAAGTCGTAATTATAAATGCCTAATAAGCCCTTATCAACGTAATTATAAAGAGTTTTGGTGCAGACAACATCGCTGCTAGAGAATTCGCCAGCAGCAGTGGCACGATTACTGCAAACATCAAGCGACCAACCGTCTTTAAAGAAATGTTTGTGGACATAGTGAATAAATTGAGTTTTTTTGAGAAAGTCTGATTTGCGCCCACAATTTTTACGATGAGCTTGATATACATCATGTCCTTGAGTAGCCTTGTATCTTTTGACTTTACCATGATACAGTTTTACAGTGCCACGTTTAATCTCATAACTGATAGTAGAAGGAGAACAGTTGAGTTCACGAGCAATTGCACGCAAAGAGCAGCCATCTTTCAAACGCAATTGAATAATAACTCGCTCTTCAAATGATAAATGCTTTCCTTTAACGTGCTGGTTCATGGTAGAATGTAAAGAGTCCATTTTGACCTCCAATAGAAAGTTTTTGTGGTTATTAACATTCTATCAAACAGGTCCGAATGGACTTTTTATTTTTCTAAAGTGTTCAATTTGATTTTACAATCAACGAATTT	NA	NA	NA	NA
>prophage 6
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	1695530	1747110	2129370	protease,transposase	unidentified_phage(41.67%)	49	NA	NA
WP_003648638.1|1695530_1696796_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.4	2.4e-134
WP_003648639.1|1696795_1697380_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_020807138.1|1697592_1698069_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_020807137.1|1698068_1698584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807136.1|1698826_1699357_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_020807135.1|1699454_1700723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807134.1|1700790_1701456_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_020807133.1|1701573_1702428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807132.1|1702634_1703108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807131.1|1703353_1704358_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_020807130.1|1704364_1705225_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065169544.1|1705235_1705997_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_020807128.1|1706002_1706773_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024273054.1|1706810_1707860_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020807921.1|1707998_1708664_+	sugar transferase	NA	NA	NA	NA	NA
WP_020807920.1|1708663_1709611_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020807919.1|1709643_1710723_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020807918.1|1710712_1711543_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020807917.1|1711562_1712726_+	EpsG family protein	NA	NA	NA	NA	NA
WP_020807916.1|1712749_1713487_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_020807915.1|1713515_1714637_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	72.9	7.1e-162
WP_020807914.1|1714642_1716070_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_087261398.1|1716292_1717309_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.1e-47
WP_065169820.1|1718230_1718434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|1718452_1719502_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020807932.1|1719702_1720215_+	DUF4065 domain-containing protein	NA	M4SRU1	Rhodobacter_phage	30.6	8.9e-11
WP_020807933.1|1720214_1720580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087261401.1|1720721_1720994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169749.1|1721610_1721868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807937.1|1721852_1722047_-	Mobile element protein	NA	NA	NA	NA	NA
WP_087261405.1|1722637_1723555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|1723561_1724611_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_087261407.1|1724693_1725176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261410.1|1726507_1727851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169748.1|1729419_1729905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169747.1|1729901_1730477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169746.1|1730478_1731435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113533095.1|1732084_1732252_-	DUF3938 domain-containing protein	NA	NA	NA	NA	NA
WP_020807057.1|1732872_1734048_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003647166.1|1734129_1735167_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	3.4e-86
WP_020807056.1|1735173_1736058_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.6	2.2e-94
WP_003647168.1|1736090_1736699_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.8	1.7e-45
WP_020807055.1|1736715_1737702_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.3	3.1e-28
WP_020807054.1|1738034_1742195_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_020807053.1|1742400_1743309_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_087261458.1|1743286_1743628_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_087261412.1|1743588_1744257_+	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_020807050.1|1745568_1745994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273054.1|1746060_1747110_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
>prophage 7
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	1790791	1851586	2129370	protease,transposase,tRNA,integrase	unidentified_phage(15.79%)	56	1790109:1790126	1792431:1792448
1790109:1790126	attL	CTTCAGCAACGAAAATTG	NA	NA	NA	NA
WP_020807019.1|1790791_1791727_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.7	1.8e-81
WP_065169692.1|1793052_1794339_+	hypothetical protein	NA	NA	NA	NA	NA
1792431:1792448	attR	CAATTTTCGTTGCTGAAG	NA	NA	NA	NA
WP_020807016.1|1794766_1795678_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_133258104.1|1795688_1796225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273065.1|1796230_1796959_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	50.4	3.0e-36
WP_020807013.1|1797398_1798340_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_020807012.1|1798586_1799801_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_020807011.1|1800003_1800894_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.9	5.2e-59
WP_065169694.1|1800949_1802146_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	30.7	1.3e-33
WP_003651163.1|1802194_1802860_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_020807009.1|1803001_1803859_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.1	2.2e-14
WP_020807008.1|1803858_1804086_+	YozE family protein	NA	NA	NA	NA	NA
WP_087261416.1|1804093_1805542_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	5.1e-11
WP_020807006.1|1805543_1806383_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_020807005.1|1806379_1807132_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	40.4	4.9e-26
WP_020807004.1|1807183_1808029_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003648735.1|1808094_1810176_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	4.2e-99
WP_020807003.1|1810273_1811590_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_065169696.1|1811592_1812516_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	29.6	1.8e-17
WP_020807002.1|1812519_1813044_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_020807001.1|1813054_1814449_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	27.1	1.9e-31
WP_020807000.1|1814476_1815364_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_020806999.1|1815423_1816026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806998.1|1816184_1816748_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003648742.1|1817015_1817477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169697.1|1817673_1818705_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_020806996.1|1818867_1819215_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081275669.1|1819340_1819718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806994.1|1821108_1821747_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.8e-19
WP_020806993.1|1822633_1824313_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_020806992.1|1824296_1825049_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_020806991.1|1825104_1825518_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_020806990.1|1825519_1825957_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024272995.1|1826190_1827240_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_147614543.1|1827724_1829230_+	adhesin	NA	NA	NA	NA	NA
WP_020806987.1|1829319_1829919_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_020806986.1|1829949_1830573_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020806985.1|1830862_1831609_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_020806984.1|1832071_1833448_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_020806983.1|1833660_1834506_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_020806982.1|1834516_1834897_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020806981.1|1835014_1835308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806980.1|1835363_1836536_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.8	6.9e-43
WP_020806979.1|1836632_1837427_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	2.0e-09
WP_020806978.1|1837606_1839202_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	28.4	1.7e-15
WP_065169735.1|1839198_1840782_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	20.8	5.2e-17
WP_020806976.1|1840945_1841797_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	3.5e-20
WP_020806975.1|1841796_1842651_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_020806974.1|1842654_1843107_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806973.1|1843108_1843504_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_020806972.1|1843550_1844270_+	Fic family protein	NA	NA	NA	NA	NA
WP_020806971.1|1844375_1844789_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_020806970.1|1845418_1846786_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_020806969.1|1846962_1847940_+	choloylglycine hydrolase family protein	NA	NA	NA	NA	NA
WP_024273054.1|1848072_1849122_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_087261421.1|1850536_1851586_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	4.1e-47
>prophage 8
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	1877656	2009485	2129370	integrase,tail,head,capsid,holin,transposase,protease,terminase,portal	Lactobacillus_phage(52.86%)	147	1978573:1978589	2001905:2001921
WP_024273054.1|1877656_1878706_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_003647298.1|1879413_1880112_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_020807357.1|1880179_1880767_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	44.4	1.0e-26
WP_020807356.1|1880829_1882623_-	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	38.7	6.1e-83
WP_003647301.1|1882696_1883632_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_087261425.1|1884940_1887421_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	30.7	2.8e-94
WP_020807354.1|1887437_1889396_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.7	2.4e-117
WP_020807353.1|1889495_1890155_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_020807352.1|1890257_1890872_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_020807351.1|1891000_1891651_+	endonuclease III-like protein	NA	NA	NA	NA	NA
WP_065169824.1|1891697_1892573_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	34.0	1.3e-41
WP_113533196.1|1892541_1893057_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_020807348.1|1893044_1893914_-	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	28.5	2.8e-09
WP_020807347.1|1893920_1895168_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020807346.1|1895164_1896280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087261269.1|1896882_1897932_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
WP_020807344.1|1898411_1898648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807343.1|1898765_1899479_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_087261269.1|1899585_1900635_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.4e-47
WP_065169681.1|1901062_1901998_-	lysin	NA	Q6SE63	Lactobacillus_prophage	64.7	2.2e-116
WP_065169680.1|1902010_1902409_-|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	88.6	6.3e-57
WP_003656255.1|1902405_1902642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169679.1|1902655_1903057_-	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	66.2	4.0e-43
WP_100215364.1|1903118_1903262_-	XkdX family protein	NA	NA	NA	NA	NA
WP_035422715.1|1903261_1903915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169678.1|1903934_1904366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169677.1|1904392_1906963_-	hypothetical protein	NA	Q6SEC0	Lactobacillus_prophage	42.8	4.5e-63
WP_051994789.1|1906962_1907292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656249.1|1907323_1908679_-	hypothetical protein	NA	O03938	Lactobacillus_phage	26.6	4.6e-22
WP_003656247.1|1908693_1909515_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	46.7	6.1e-62
WP_065169676.1|1909507_1914526_-	tape measure protein	NA	Q9T1E7	Lactobacillus_phage	42.2	1.5e-107
WP_003656243.1|1914529_1915147_-	hypothetical protein	NA	A0A1S5SAD5	Streptococcus_phage	31.5	2.2e-11
WP_003656242.1|1915151_1915580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169682.1|1915591_1915942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656240.1|1916203_1916605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035422713.1|1916597_1916969_-|capsid	phage capsid protein	capsid	O03933	Lactobacillus_phage	39.4	4.3e-15
WP_003656238.1|1916978_1917329_-	hypothetical protein	NA	O03932	Lactobacillus_phage	41.5	1.1e-20
WP_003656237.1|1917322_1917712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656235.1|1917734_1918787_-	hypothetical protein	NA	O03966	Lactobacillus_phage	52.3	2.7e-99
WP_003656234.1|1918793_1919420_-	scaffold protein	NA	X2CYF9	Lactobacillus_phage	34.3	1.3e-16
WP_035422709.1|1919516_1919774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080581165.1|1919777_1920092_-	hypothetical protein	NA	U3PFU0	Lactobacillus_phage	56.4	6.8e-22
WP_035422707.1|1920208_1920865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169675.1|1921833_1923468_-|portal	phage portal protein	portal	Q38341	Lactococcus_phage	48.6	2.9e-132
WP_065169674.1|1923480_1924785_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	65.0	4.8e-170
WP_065169673.1|1924753_1925284_-|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	67.3	1.9e-48
WP_003656228.1|1925345_1925789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169672.1|1925763_1926234_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	40.5	8.1e-27
WP_065169671.1|1927585_1928089_-	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	94.0	2.7e-89
WP_011678824.1|1928118_1928289_-	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	100.0	5.5e-26
WP_003648032.1|1928587_1928848_-	hypothetical protein	NA	A9D9P5	Lactobacillus_prophage	60.5	2.3e-23
WP_065169670.1|1928955_1929207_-	helix-turn-helix transcriptional regulator	NA	X2CY61	Lactobacillus_phage	96.1	4.7e-34
WP_065169669.1|1929212_1930100_-	hypothetical protein	NA	Q6SEE7	Lactobacillus_prophage	86.7	1.8e-144
WP_065169668.1|1930112_1930904_-	hypothetical protein	NA	Q6SEE8	Lactobacillus_prophage	78.4	1.6e-112
WP_003656219.1|1930905_1931781_-	DUF1351 domain-containing protein	NA	Q6SE94	Lactobacillus_prophage	46.3	5.9e-63
WP_155761842.1|1931799_1931958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035422704.1|1932121_1932370_-	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	36.9	5.4e-06
WP_035422702.1|1932366_1932603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656218.1|1932616_1933399_-	hypothetical protein	NA	Q20DF7	Lactobacillus_phage	63.6	2.3e-79
WP_035422701.1|1933410_1933623_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003656217.1|1933776_1934400_+	helix-turn-helix domain-containing protein	NA	Q9G0C2	Lactococcus_phage	43.8	6.7e-37
WP_003656215.1|1935021_1935753_+	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	38.2	1.2e-29
WP_003656214.1|1935766_1936771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035422700.1|1936773_1936980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656213.1|1937183_1938398_+|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	33.4	6.1e-50
WP_024273054.1|1938980_1940030_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020807359.1|1940315_1941386_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	4.0e-05
WP_020807360.1|1941454_1942339_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020807361.1|1942408_1943500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807362.1|1943584_1944472_-	DegV family protein	NA	NA	NA	NA	NA
WP_003648850.1|1944576_1944987_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020807363.1|1945175_1946867_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	41.2	1.0e-10
WP_020807364.1|1946952_1950117_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_020807365.1|1950120_1951176_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_087261427.1|1951179_1952094_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.0e-09
WP_003648855.1|1952108_1952573_-	signal peptidase II	NA	NA	NA	NA	NA
WP_020807367.1|1952573_1954247_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_020807368.1|1954249_1954594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807369.1|1954726_1955650_+	DegV family protein	NA	NA	NA	NA	NA
WP_065169576.1|1955708_1956941_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_020807371.1|1956943_1958068_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003648861.1|1958532_1958970_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_065169667.1|1959276_1960251_-	glycoside hydrolase family 25	NA	Q6SE63	Lactobacillus_prophage	38.0	1.0e-47
WP_065169665.1|1960727_1960949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147614544.1|1960951_1961359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169663.1|1961324_1961534_-	XkdX family protein	NA	Q9T1E1	Lactobacillus_phage	49.1	1.3e-08
WP_065169662.1|1961533_1962049_-	hypothetical protein	NA	Q9T1E2	Lactobacillus_phage	53.6	1.2e-36
WP_065169578.1|1965104_1965314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169579.1|1965330_1968150_-	hypothetical protein	NA	B8R659	Lactobacillus_phage	43.4	5.4e-219
WP_147614545.1|1968149_1968926_-	hypothetical protein	NA	B8R658	Lactobacillus_phage	36.7	2.4e-28
WP_065169581.1|1968891_1975887_-|tail	phage tail tape measure protein	tail	F8J1C3	Lactobacillus_phage	36.9	3.6e-38
WP_065169582.1|1976114_1976540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169583.1|1976725_1977361_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	55.7	3.0e-56
WP_065169584.1|1977360_1977747_-	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	43.3	1.5e-26
WP_065169585.1|1977748_1978186_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	36.6	2.1e-21
WP_081275662.1|1978182_1978512_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	44.2	6.3e-18
WP_065169587.1|1978544_1978916_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8J1B6	Lactobacillus_phage	44.9	4.9e-19
1978573:1978589	attL	TCATCTTCTTTATCTTT	NA	NA	NA	NA
WP_065169588.1|1979178_1980354_-|capsid	phage major capsid protein	capsid	F8J1B4	Lactobacillus_phage	53.6	1.2e-103
WP_065169649.1|1980354_1981113_-|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	59.7	5.8e-67
WP_065169589.1|1981048_1982386_-|portal	phage portal protein	portal	F8J1B2	Lactobacillus_phage	51.7	4.3e-105
WP_065169590.1|1982401_1982680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169591.1|1982690_1983434_-	site-specific DNA-methyltransferase	NA	A0A2P0ZL38	Lactobacillus_phage	64.0	1.4e-78
WP_087261431.1|1983443_1984751_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	68.3	8.8e-180
WP_113779214.1|1985028_1985349_-	hypothetical protein	NA	A0A1B1P7R3	Bacillus_phage	59.4	4.6e-34
WP_065169594.1|1985519_1985978_-|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	45.0	7.4e-25
WP_157664545.1|1986183_1986519_-	HNH endonuclease	NA	F8J1B0	Lactobacillus_phage	49.1	2.1e-21
WP_065169595.1|1987770_1987962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169596.1|1987930_1988113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169597.1|1988102_1988303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169598.1|1988600_1988825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169599.1|1988940_1989333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169600.1|1989363_1989636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169601.1|1989882_1990269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169602.1|1990285_1990687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169603.1|1990697_1991075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169604.1|1991303_1991522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155761837.1|1992118_1992274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169605.1|1992302_1992521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169606.1|1992637_1993069_-	hypothetical protein	NA	F8J1G8	Lactobacillus_phage	50.4	1.7e-31
WP_155761838.1|1993080_1993257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169608.1|1995455_1995893_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SDG7	Lactococcus_phage	51.9	3.7e-34
WP_065169609.1|1995889_1996252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169610.1|1996267_1996846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065169611.1|1996918_1997146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087261434.1|1997222_1997456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169613.1|1997502_1997745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113779207.1|1997821_1997992_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_065169614.1|1997981_1998230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147614546.1|1998245_1998551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169616.1|1998567_1998816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169617.1|1998805_1999189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664546.1|1999185_1999353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169618.1|1999505_1999715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169619.1|1999714_2000104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113779203.1|2000320_2000482_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_065169621.1|2000522_2000969_-	single-stranded DNA-binding protein	NA	A0A1J0MFL8	Staphylococcus_phage	53.3	3.0e-31
WP_065169622.1|2000968_2001250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147614547.1|2001668_2001908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169624.1|2001985_2002171_-	hypothetical protein	NA	Q20DF6	Lactobacillus_phage	56.9	3.2e-11
2001905:2001921	attR	TCATCTTCTTTATCTTT	NA	NA	NA	NA
WP_065169625.1|2002187_2002973_-	hypothetical protein	NA	Q20DF7	Lactobacillus_phage	76.9	2.3e-98
WP_065169626.1|2003874_2004072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169627.1|2004064_2004310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169628.1|2004482_2006693_-	AAA family ATPase	NA	A0A2K9VD36	Lactobacillus_phage	28.4	2.0e-67
WP_065169629.1|2006695_2007013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065169630.1|2007013_2007820_-	AAA domain-containing protein	NA	B8R682	Lactobacillus_phage	43.8	1.1e-50
WP_065169631.1|2007835_2008750_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	39.0	7.0e-43
WP_065169632.1|2008768_2009485_-	hypothetical protein	NA	A0A1S5SAA3	Streptococcus_phage	38.3	1.4e-17
>prophage 9
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	2017345	2084477	2129370	tRNA,holin,transposase,protease,integrase	unidentified_phage(33.33%)	39	2016214:2016228	2022875:2022889
2016214:2016228	attL	TAAGATGGTTAATAA	NA	NA	NA	NA
WP_065169648.1|2017345_2018470_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	50.9	1.6e-100
WP_020807372.1|2018680_2019250_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003648863.1|2019318_2019948_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	39.3	4.4e-20
WP_020807373.1|2019937_2022316_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_020807374.1|2022402_2023032_-	endonuclease III	NA	NA	NA	NA	NA
2022875:2022889	attR	TTATTAACCATCTTA	NA	NA	NA	NA
WP_020807375.1|2023040_2023685_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003648867.1|2023752_2025051_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	26.5	1.3e-47
WP_020807376.1|2025119_2025614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807377.1|2025606_2028420_-	DEAD/DEAH box helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.6	8.8e-60
WP_020807378.1|2028444_2032059_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	24.0	2.7e-21
WP_020807379.1|2032059_2035536_-	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_020807380.1|2035622_2036540_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_020807381.1|2036539_2037505_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_020807382.1|2037539_2038613_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_020807383.1|2038637_2039663_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_020807384.1|2039749_2041333_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.5	2.2e-15
WP_087261251.1|2041734_2042784_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_020807880.1|2043080_2043899_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020807881.1|2044052_2044928_+|protease	membrane protease family stomatin/prohibitin-like protein	protease	NA	NA	NA	NA
WP_020807882.1|2044994_2045807_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_020807883.1|2045865_2046441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807884.1|2046524_2047070_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020807885.1|2047041_2047770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024272995.1|2047874_2048924_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_020807886.1|2049041_2049686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807887.1|2049740_2049941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807888.1|2050012_2051164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807889.1|2051288_2051933_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_020807890.1|2052092_2052956_-	homoserine kinase	NA	NA	NA	NA	NA
WP_020807891.1|2052965_2054192_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_020807892.1|2054292_2055780_+	threonine synthase	NA	NA	NA	NA	NA
WP_020807893.1|2055811_2056870_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020807894.1|2056958_2058314_+	aspartate kinase	NA	NA	NA	NA	NA
WP_024273054.1|2058426_2059476_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_065169808.1|2075689_2077942_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_147614549.1|2078619_2082312_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_065169805.1|2082566_2083589_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_065169804.1|2083758_2084106_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016378676.1|2084372_2084477_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 10
NZ_CP021427	Lactobacillus gasseri strain 4M13, complete genome	2129370	2111044	2118874	2129370		Lactococcus_phage(16.67%)	6	NA	NA
WP_020807716.1|2111044_2113213_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.3	4.2e-171
WP_020807717.1|2113205_2113628_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	34.2	1.5e-11
WP_020807718.1|2113611_2114619_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	54.0	1.2e-96
WP_020807721.1|2115906_2116494_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	5.9e-19
WP_065169814.1|2117229_2118045_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	3.5e-09
WP_047036257.1|2118031_2118874_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	8.8e-16
