The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	8580	77718	1893327	protease,transposase	Streptococcus_phage(25.0%)	57	NA	NA
WP_087448445.1|8580_9870_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	3.6e-45
WP_003701399.1|10036_10393_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_044005553.1|17537_18305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448446.1|18487_20521_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003700898.1|20534_20984_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_034983739.1|21156_22548_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	55.2	7.5e-129
WP_003702159.1|22621_23194_+	flavodoxin	NA	NA	NA	NA	NA
WP_034983737.1|23429_24722_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.6	1.1e-65
WP_034982990.1|25294_26230_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	2.4e-83
WP_034982991.1|26387_26915_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_034982992.1|27013_27748_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_034982993.1|27774_28518_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_034983678.1|28863_29382_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.8	2.3e-14
WP_148305435.1|29336_30281_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-40
WP_034982994.1|31243_32377_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	42.2	2.8e-73
WP_081325430.1|32406_33258_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_087448448.1|33273_34572_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	S4VRH6	Pandoravirus	23.7	1.5e-09
WP_087448449.1|34639_35680_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	25.1	9.9e-09
WP_143454463.1|35756_36152_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_087448450.1|36054_36750_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_087448451.1|37139_38039_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_087367794.1|38065_39682_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167370840.1|39866_40922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087448453.1|41118_42450_+	citrate transporter	NA	NA	NA	NA	NA
WP_049164593.1|42567_43452_+	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	30.6	8.3e-33
WP_087448454.1|43525_44860_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_087448455.1|44883_45774_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_087448456.1|45793_46924_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	34.1	1.9e-34
WP_087448457.1|46934_47783_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_087448458.1|47802_49320_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_087448459.1|49345_49705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|49742_50915_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_087448460.1|51034_52015_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_087448461.1|52154_52379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448462.1|52554_53478_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	62.5	4.5e-106
WP_087448463.1|53491_54298_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_087448464.1|54568_56383_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	28.0	2.3e-08
WP_080563877.1|56567_56654_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087448465.1|56680_57823_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.0	1.1e-45
WP_081514198.1|57945_58320_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_081514196.1|58336_58600_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_087448466.1|58599_60510_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.6	6.3e-110
WP_081541128.1|60628_61285_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.1	6.4e-06
WP_087448467.1|61303_62104_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003700953.1|62255_62813_+	elongation factor P	NA	NA	NA	NA	NA
WP_081535272.1|63187_64588_+	amino acid permease	NA	NA	NA	NA	NA
WP_034990335.1|66837_67773_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003700958.1|67772_68801_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003705591.1|68811_69855_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	1.7e-16
WP_087448468.1|69873_70821_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	5.4e-22
WP_041822967.1|70903_71344_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_087448469.1|71377_72745_-	amino acid permease	NA	NA	NA	NA	NA
WP_034983016.1|72858_73782_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003705586.1|73935_74370_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034983017.1|74366_74825_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_034983018.1|74910_75858_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_087448470.1|76497_77718_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	45.6	2.8e-95
>prophage 2
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	212173	220620	1893327	transposase	Escherichia_phage(28.57%)	8	NA	NA
WP_087448539.1|212173_213043_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.7	1.5e-106
WP_003701105.1|213045_213627_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.5	3.0e-31
WP_087448540.1|213638_214670_+	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	36.0	4.6e-51
WP_087448541.1|214725_215565_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.5	1.1e-37
WP_003709292.1|215718_216642_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	1.2e-50
WP_034982827.1|216781_217234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449015.1|217509_219048_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	60.7	4.5e-42
WP_087448542.1|219075_220620_+	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	38.9	5.0e-17
>prophage 3
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	297490	301543	1893327		Staphylococcus_phage(50.0%)	7	NA	NA
WP_003705375.1|297490_297814_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.4	2.5e-19
WP_011476362.1|297871_298261_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	34.2	1.5e-05
WP_081540996.1|298257_298602_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.2	3.6e-08
WP_087448565.1|298673_299546_+	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_087448566.1|300046_300544_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	37.4	4.4e-15
WP_041822915.1|300557_300785_+	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.6	1.9e-05
WP_087448567.1|300784_301543_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	5.3e-12
>prophage 4
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	380332	492390	1893327	protease,integrase,capsid,terminase,portal,holin,head,tRNA,transposase,tail	Erysipelothrix_phage(47.5%)	86	399958:399980	426148:426170
WP_003701368.1|380332_381583_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	7.0e-86
WP_003703671.1|381652_382615_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_003701371.1|383020_383659_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003703196.1|383851_384820_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_034982616.1|385068_385626_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_034982614.1|385647_389172_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_034982641.1|389181_390759_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003709726.1|390758_391028_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_034982613.1|391066_391462_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003703194.1|391550_392015_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_034982639.1|392071_393430_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.5	4.9e-16
WP_003701387.1|393446_393986_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	30.2	2.9e-12
WP_003701388.1|394126_396205_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	49.7	4.1e-107
WP_034983799.1|396337_397228_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003701390.1|397245_398238_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_034983798.1|398331_399864_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.5	4.6e-87
399958:399980	attL	TACACCAAAAATACACCATTTTT	NA	NA	NA	NA
WP_087448583.1|401646_407385_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_087448584.1|407684_408974_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	2.4e-44
WP_052399055.1|409093_409924_+|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	38.0	5.8e-36
WP_034983523.1|411170_411512_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034983521.1|411825_412683_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_157664618.1|412700_414596_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_034983519.1|416550_416775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983518.1|416755_417010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983516.1|417198_417699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983515.1|417695_418337_-	recombinase family protein	NA	NA	NA	NA	NA
WP_034983513.1|418979_419555_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.6	3.5e-32
WP_034983506.1|423779_424013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983503.1|424025_424592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672053.1|424642_424843_+	excisionase family DNA-binding protein	NA	A0A1S5SF07	Streptococcus_phage	42.6	7.9e-08
WP_087448586.1|424913_426146_+|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	41.1	4.5e-85
WP_087448587.1|432075_433215_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
426148:426170	attR	TACACCAAAAATACACCATTTTT	NA	NA	NA	NA
WP_167370857.1|433334_435557_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.3	1.0e-135
WP_034982967.1|435573_437592_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	4.4e-106
WP_034982968.1|437588_438734_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003702422.1|438885_439185_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004564244.1|439187_440651_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_087448589.1|440650_442084_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003705249.1|442116_443136_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.5e-17
WP_087448590.1|443216_444590_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	2.2e-125
WP_087448591.1|444890_445211_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_087448592.1|445367_446954_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	47.3	2.0e-125
WP_087448593.1|446940_447345_-	recombinase	NA	NA	NA	NA	NA
WP_087448594.1|447331_448885_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	34.9	2.3e-86
WP_003672653.1|448946_449135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448595.1|449232_449655_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.8	4.4e-40
WP_087448596.1|449644_450025_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_087448597.1|450025_450304_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_087448598.1|450317_451496_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.7e-129
WP_003672645.1|451516_452179_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	56.0	4.2e-53
WP_167370843.1|452175_453432_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.8	4.4e-152
WP_003672642.1|453488_453650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672640.1|453790_453952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923830.1|453979_455581_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.7	1.5e-250
WP_003672638.1|455646_455853_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_087448599.1|455845_456478_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	38.6	4.4e-36
WP_087448600.1|456551_457781_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	62.4	2.9e-148
WP_087448601.1|457780_458323_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.6	2.7e-58
WP_087448602.1|458445_458823_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.0	2.5e-31
WP_081509815.1|458957_459428_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_087448603.1|459396_460779_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.9	2.6e-158
WP_087448604.1|460738_461041_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.7	3.6e-20
WP_087448605.1|461235_463482_-	primase C-terminal domain-containing protein	NA	E4ZFK6	Streptococcus_phage	48.4	9.7e-211
WP_087449017.1|463484_463883_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	36.4	8.4e-17
WP_087448606.1|463977_465912_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.3	2.9e-224
WP_162854412.1|465962_466514_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	71.6	4.8e-71
WP_087448608.1|466515_467658_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	54.8	2.1e-113
WP_087448609.1|467641_467974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448610.1|467960_468158_-	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	40.4	8.6e-07
WP_087448611.1|468262_468790_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_087448612.1|469165_470485_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_087448613.1|470489_473105_+	helicase	NA	NA	NA	NA	NA
WP_087448614.1|473118_473340_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	67.2	6.1e-17
WP_087448615.1|473372_476447_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.5	1.3e-24
WP_087448616.1|476452_478081_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.7	2.1e-29
WP_087448617.1|478084_479272_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087448618.1|479387_480662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167370844.1|480861_481023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448619.1|481362_482220_+	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_044005169.1|482304_482634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|482757_483930_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_003705217.1|486790_487348_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_034982985.1|487526_489704_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	60.0	2.1e-258
WP_003703613.1|489693_490374_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	60.2	7.5e-58
WP_003703607.1|490601_491000_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_087448620.1|491100_492390_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	6.2e-45
>prophage 5
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	608317	617336	1893327		Enterococcus_phage(33.33%)	10	NA	NA
WP_034983632.1|608317_610489_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	1.2e-266
WP_003700671.1|610469_610853_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.7	5.8e-15
WP_003703366.1|610849_611080_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	6.1e-12
WP_003703376.1|611282_611894_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044005603.1|611940_612408_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011476228.1|612613_614353_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.9	6.6e-58
WP_003700666.1|614370_614685_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011476227.1|615323_615563_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003700663.1|615682_616309_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	6.9e-50
WP_081537012.1|616343_617336_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.9	3.4e-35
>prophage 6
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	653407	662210	1893327	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_003700627.1|653407_656242_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.7	3.0e-310
WP_003700626.1|656317_656788_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_087448638.1|656811_657453_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003700624.1|657600_658518_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	34.5	7.9e-10
WP_003700623.1|658514_659528_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	56.0	8.5e-98
WP_003700622.1|659550_660498_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	1.9e-51
WP_003700621.1|660547_661141_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.8	1.5e-54
WP_003709292.1|661286_662210_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	1.2e-50
>prophage 7
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	985043	1044668	1893327	tRNA,transposase,integrase	Streptococcus_phage(15.79%)	57	983714:983731	1054044:1054061
983714:983731	attL	TCTCTTAATTCCATAAAA	NA	NA	NA	NA
WP_044005740.1|985043_986333_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	3.6e-45
WP_087448717.1|986440_987361_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003706230.1|987386_988343_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087448718.1|988456_989077_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	34.6	1.2e-33
WP_003704381.1|989076_989790_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_087448719.1|989786_991718_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_086201542.1|991695_992796_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_003700158.1|992857_994165_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.0	3.6e-64
WP_003704375.1|994191_994728_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_087448720.1|994934_995831_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.0	2.2e-12
WP_081512044.1|995823_996270_-	signal peptidase II	NA	NA	NA	NA	NA
WP_081512042.1|996336_996951_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003700152.1|996955_997402_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_087448721.1|997416_999636_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	40.6	7.5e-14
WP_087448722.1|999675_1000407_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_087448723.1|1000406_1001297_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003700147.1|1001313_1001826_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_087448724.1|1002080_1003043_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_087448725.1|1003647_1004937_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	4.8e-45
WP_087448726.1|1005064_1005535_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003700143.1|1005551_1006193_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	1.3e-35
WP_087448727.1|1006215_1007355_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_087448728.1|1007507_1009925_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003700137.1|1009931_1010978_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.4	3.1e-26
WP_003700136.1|1011323_1011671_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003700135.1|1011812_1012337_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_087448729.1|1012445_1013207_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003700133.1|1013341_1013830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034984149.1|1013826_1014009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448730.1|1014600_1017075_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.0	9.4e-58
WP_087448731.1|1017067_1017736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448732.1|1017751_1018408_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_087448734.1|1020021_1021425_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_081536865.1|1021579_1022728_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	38.1	9.4e-61
WP_087448735.1|1023270_1023780_-	XRE family transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	54.2	2.8e-09
WP_087448736.1|1023920_1024115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449019.1|1024318_1024513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087448737.1|1024515_1025178_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	41.4	1.0e-27
WP_087448738.1|1025229_1025535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448739.1|1025549_1025759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448740.1|1025755_1026094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448741.1|1026352_1026724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448742.1|1026736_1027141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448743.1|1027153_1027921_+	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	29.2	3.3e-17
WP_087448744.1|1027935_1029330_+	DNA primase family protein	NA	H7BVJ4	unidentified_phage	27.9	1.9e-23
WP_087448745.1|1029613_1029922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081536854.1|1029981_1030422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448746.1|1030426_1030645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044004860.1|1032389_1033700_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003706174.1|1033722_1035834_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	35.1	3.9e-97
WP_148305435.1|1036259_1037204_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-40
WP_034983678.1|1037158_1037677_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.8	2.3e-14
WP_087448747.1|1038147_1038534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983384.1|1038557_1039052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448748.1|1041799_1043029_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_087448749.1|1043200_1044178_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	30.5	1.1e-22
WP_034983829.1|1044329_1044668_-|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	36.8	4.0e-12
1054044:1054061	attR	TCTCTTAATTCCATAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1059801	1067309	1893327	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_087448751.1|1059801_1060662_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.4	3.1e-56
WP_014568348.1|1060838_1061342_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	44.6	2.2e-30
WP_003700096.1|1061359_1062316_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.5	2.0e-117
WP_087448752.1|1062333_1064241_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	3.6e-57
WP_014568347.1|1064237_1065452_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.8	6.7e-49
WP_011475876.1|1065448_1066237_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_034983150.1|1066412_1067309_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.3	5.1e-54
>prophage 9
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1098557	1111529	1893327	transposase	Prochlorococcus_phage(25.0%)	12	NA	NA
WP_087448640.1|1098557_1099847_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	1.6e-45
WP_003700050.1|1099934_1101191_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_087448759.1|1101207_1102746_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	3.3e-69
WP_087448760.1|1102757_1103345_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.9	1.5e-25
WP_087448761.1|1103357_1104395_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.3	5.9e-62
WP_011475859.1|1104395_1105847_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	1.2e-63
WP_034982879.1|1105822_1108048_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.5e-142
WP_087448762.1|1108049_1108724_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003700038.1|1108723_1108972_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003700037.1|1108990_1109704_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.4	3.1e-38
WP_087448763.1|1110015_1111050_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011475856.1|1111046_1111529_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	1.6e-22
>prophage 10
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1204154	1294535	1893327	protease,capsid,integrase,terminase,portal,plate,head,tRNA,transposase,tail	Lactobacillus_phage(28.21%)	116	1278656:1278673	1300469:1300486
WP_014568277.1|1204154_1205063_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003699907.1|1205131_1205491_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_044004747.1|1205514_1207728_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.6	3.6e-24
WP_003699904.1|1207799_1208105_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003699903.1|1208094_1208394_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003703149.1|1208396_1209524_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003699900.1|1209549_1210023_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_044004745.1|1210231_1214566_-	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	22.2	4.1e-24
WP_003699897.1|1214663_1216379_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044004743.1|1216429_1217707_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003699893.1|1217731_1218520_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003699891.1|1218522_1219305_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	47.6	1.1e-25
WP_003699890.1|1219440_1220004_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003703168.1|1220006_1220729_-	UMP kinase	NA	NA	NA	NA	NA
WP_003699888.1|1220841_1221219_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_003699887.1|1221305_1221767_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	40.5	1.1e-23
WP_087448782.1|1221872_1223162_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.3	1.4e-44
WP_003699883.1|1223698_1225042_-	type I glutamate--ammonia ligase	NA	A0A0G2Y3D5	Acanthamoeba_polyphaga_mimivirus	24.8	1.3e-08
WP_003699881.1|1225071_1225458_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003699880.1|1225548_1226811_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_044004737.1|1226832_1227756_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003705942.1|1227887_1228064_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003705941.1|1228133_1228547_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044004733.1|1228589_1229552_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_011475814.1|1229548_1229788_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_044004731.1|1229827_1230490_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_087448783.1|1230503_1231052_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003699868.1|1231106_1231256_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_087448784.1|1231403_1233557_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_087449021.1|1233714_1235454_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_003699862.1|1235631_1235931_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	8.5e-22
WP_003709878.1|1235948_1236539_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003699860.1|1236621_1236846_-	YneF family protein	NA	NA	NA	NA	NA
WP_003704077.1|1236972_1237227_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003699857.1|1237373_1237994_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	58.8	3.2e-15
WP_003709292.1|1238050_1238974_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	1.2e-50
WP_087448785.1|1239116_1240784_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003699854.1|1240788_1241247_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003704070.1|1241271_1242099_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_174633251.1|1242101_1243019_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003699848.1|1242984_1243212_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_034982367.1|1243211_1244552_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	30.9	2.1e-35
WP_011475808.1|1244544_1245402_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	44.0	8.1e-41
WP_003699843.1|1245546_1245942_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003699841.1|1245941_1246364_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003699839.1|1246380_1246938_-	elongation factor P	NA	NA	NA	NA	NA
WP_087448786.1|1247071_1247524_-	dUTPase	NA	NA	NA	NA	NA
WP_087448787.1|1247554_1248550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044004716.1|1248551_1249433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448788.1|1249831_1250758_-	SH3 domain-containing protein	NA	A0A0A1ERA5	Lactobacillus_phage	66.7	5.9e-114
WP_034983548.1|1250759_1251119_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	44.5	8.1e-19
WP_034983550.1|1251119_1251431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448789.1|1251483_1251648_-	XkdX family protein	NA	NA	NA	NA	NA
WP_087448790.1|1251649_1252009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167370863.1|1252030_1252396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448792.1|1252446_1253397_-	carbohydrate binding domain-containing protein	NA	NA	NA	NA	NA
WP_087448793.1|1253402_1253912_-	Ig-like domain-containing protein	NA	A0A1D6Z291	Staphylococcus_phage	37.9	1.0e-06
WP_087448794.1|1253918_1255265_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_087448795.1|1255264_1255711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448796.1|1256519_1258196_-|tail	phage tail protein	tail	D2KRB9	Lactobacillus_phage	30.8	2.4e-25
WP_087448797.1|1258192_1259098_-|tail	phage tail family protein	tail	W5RV36	Staphylococcus_phage	28.6	2.0e-18
WP_087448798.1|1259099_1260617_-	transglycosylase SLT domain-containing protein	NA	V5URV5	Oenococcus_phage	39.1	6.0e-39
WP_087448800.1|1260874_1263580_-	tape measure protein	NA	A0A220GC82	Streptococcus_phage	37.3	2.1e-74
WP_087448801.1|1263590_1263914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448802.1|1263934_1264393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081561390.1|1264455_1265112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448803.1|1265126_1265534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448804.1|1265535_1266018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448805.1|1266004_1266322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448806.1|1266315_1266669_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_174633252.1|1266677_1267712_-	replication protein	NA	O03966	Lactobacillus_phage	45.2	1.1e-76
WP_087448807.1|1267723_1268311_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_087448808.1|1268441_1268654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448809.1|1268704_1268947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448810.1|1268952_1270299_-|capsid	minor capsid protein	capsid	X5JAI9	Clostridium_phage	21.6	2.5e-12
WP_087448811.1|1270298_1272005_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	37.7	3.2e-65
WP_087448812.1|1272015_1273284_-|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.9	1.8e-121
WP_087448813.1|1273261_1273756_-|terminase	small terminase subunit	terminase	A9D9R6	Lactobacillus_prophage	55.6	1.5e-39
WP_087448814.1|1273772_1274258_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_087448815.1|1274250_1275096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448816.1|1275092_1275596_-	ParB N-terminal domain-containing protein	NA	X2CXX2	Lactobacillus_phage	57.5	4.7e-41
WP_087449024.1|1276130_1276562_-	transcriptional regulator	NA	B8R690	Lactobacillus_phage	32.0	1.2e-08
WP_087448817.1|1276647_1276842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448818.1|1276844_1277342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448819.1|1277341_1277692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448820.1|1278160_1278379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448821.1|1278474_1278789_-	hypothetical protein	NA	NA	NA	NA	NA
1278656:1278673	attL	TTTTCTTTAAATTCATCA	NA	NA	NA	NA
WP_087448823.1|1278978_1279251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448824.1|1279240_1279516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448825.1|1279530_1280295_-	site-specific DNA-methyltransferase	NA	A0A097QQ03	Enterococcus_phage	69.2	3.0e-95
WP_087448826.1|1280316_1280943_-	HNH endonuclease	NA	A0A220GJG3	Streptococcus_phage	62.0	3.8e-48
WP_087448827.1|1280926_1281340_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	45.5	3.5e-26
WP_087448828.1|1281323_1281560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448829.1|1281552_1281783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448830.1|1281775_1282312_-	helix-turn-helix domain-containing protein	NA	A0A286QN41	Streptococcus_phage	39.8	6.0e-26
WP_087448831.1|1282314_1282506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157664622.1|1282505_1283330_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	34.6	1.4e-26
WP_087448833.1|1283322_1284117_-	DnaD domain protein	NA	A0A2H4JAS0	uncultured_Caudovirales_phage	41.4	8.6e-21
WP_081510371.1|1284223_1284454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448834.1|1284434_1284728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448835.1|1284738_1284927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448836.1|1284939_1285758_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	55.2	1.2e-89
WP_087448837.1|1285767_1286697_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	54.5	9.3e-75
WP_157664623.1|1286680_1286848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448838.1|1287173_1287458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448839.1|1287461_1288424_-	phage antirepressor KilAC domain-containing protein	NA	A9D9L9	Lactobacillus_prophage	46.1	1.1e-51
WP_087449025.1|1288435_1289029_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	31.4	9.0e-15
WP_087448840.1|1289337_1289544_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081530997.1|1289712_1290054_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	59.6	1.1e-28
WP_087448841.1|1290069_1290327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003709292.1|1290427_1291351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	1.2e-50
WP_157664624.1|1291589_1291766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448842.1|1291832_1292357_+	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	46.8	3.2e-08
WP_087448843.1|1292419_1292869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448844.1|1292868_1293303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448845.1|1293377_1294535_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	41.7	2.4e-72
1300469:1300486	attR	TTTTCTTTAAATTCATCA	NA	NA	NA	NA
>prophage 11
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1474479	1486385	1893327		Catovirus(12.5%)	13	NA	NA
WP_087448898.1|1474479_1475409_+	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.1e-10
WP_087448899.1|1475457_1476174_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003705736.1|1476272_1476683_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	38.4	4.9e-12
WP_087367728.1|1476696_1477788_+	phosphoesterase	NA	NA	NA	NA	NA
WP_003710743.1|1477805_1478642_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	29.6	7.7e-12
WP_087448900.1|1478683_1479052_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	34.2	3.7e-11
WP_003699582.1|1479067_1479316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081536739.1|1479362_1480478_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	32.4	1.9e-34
WP_003699585.1|1480496_1480904_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_087448901.1|1481033_1482512_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-64
WP_087448902.1|1482647_1484018_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_087448903.1|1484155_1484926_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	31.2	4.4e-22
WP_087118595.1|1485071_1486385_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.9	5.0e-50
>prophage 12
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1500583	1561741	1893327	tRNA,transposase	Streptococcus_phage(17.65%)	53	NA	NA
WP_003705110.1|1500583_1501015_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.2	7.9e-29
WP_087448910.1|1501114_1502392_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.9	6.6e-55
WP_080767659.1|1502651_1504007_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.1	5.6e-28
WP_034983530.1|1504022_1504844_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_034983531.1|1504907_1505837_+	DMT family transporter	NA	NA	NA	NA	NA
WP_087448911.1|1505983_1507273_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	8.1e-45
WP_087448912.1|1507419_1508136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448913.1|1508153_1509245_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_087448914.1|1509298_1511914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983534.1|1511906_1513919_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_034983536.1|1513911_1515207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448915.1|1515210_1516818_-	AAA family ATPase	NA	V5UQM2	Mycobacterium_phage	37.2	8.9e-33
WP_034983539.1|1516817_1517843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983540.1|1518062_1518812_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_167370852.1|1518808_1519909_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_034982703.1|1520037_1521003_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003709305.1|1521782_1523405_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.5	8.6e-52
WP_087448917.1|1523479_1524250_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	46.9	2.2e-37
WP_003699642.1|1524392_1524629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003709302.1|1524634_1525474_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.1	6.2e-46
WP_003699645.1|1525624_1526149_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003699646.1|1526222_1527200_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.0	1.5e-43
WP_003702576.1|1527290_1528700_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	30.6	4.6e-25
WP_087448918.1|1528842_1530060_-	MFS transporter	NA	NA	NA	NA	NA
WP_087448919.1|1530256_1531546_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	3.1e-44
WP_003709294.1|1531706_1532546_-	pur operon repressor	NA	NA	NA	NA	NA
WP_034982715.1|1532715_1532988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448920.1|1532987_1533524_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_034982716.1|1533535_1533943_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087448921.1|1534172_1535264_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_087449026.1|1535862_1536912_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_044004510.1|1536931_1537921_-	D-2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	38.5	3.1e-44
WP_087448923.1|1537936_1539112_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_087448924.1|1539673_1540885_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_087448925.1|1540908_1542291_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_087448926.1|1542512_1543727_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	45.9	9.5e-96
WP_034982926.1|1544151_1545021_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_034982925.1|1545059_1545530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448927.1|1545573_1546692_-	aminotransferase	NA	NA	NA	NA	NA
WP_087448928.1|1546704_1547559_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003702215.1|1547647_1547881_-	Veg family protein	NA	NA	NA	NA	NA
WP_087448929.1|1547968_1548859_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_080767637.1|1548870_1549428_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_034982920.1|1549438_1550209_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014568129.1|1550342_1552370_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-99
WP_086201643.1|1552473_1553430_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_034982917.1|1553429_1554695_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_086201645.1|1554774_1555578_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003704876.1|1555614_1556262_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003707052.1|1557389_1558115_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	9.3e-22
WP_034982912.1|1558206_1559136_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_087448930.1|1559224_1560244_-|tRNA	tryptophan--tRNA ligase	tRNA	A0A1V0SFS8	Hokovirus	25.9	1.3e-05
WP_002323245.1|1560568_1561741_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
>prophage 13
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1670118	1706631	1893327	integrase,transposase	Staphylococcus_phage(21.43%)	30	1669576:1669593	1671523:1671540
1669576:1669593	attL	GCTTGGGAACAGCGAAAG	NA	NA	NA	NA
WP_191981151.1|1670118_1671522_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	49.8	2.6e-81
WP_034982262.1|1671604_1673200_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	52.0	3.5e-130
1671523:1671540	attR	CTTTCGCTGTTCCCAAGC	NA	NA	NA	NA
WP_087449027.1|1673224_1674466_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.2	4.6e-21
WP_034982263.1|1674482_1677695_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.4	4.4e-15
WP_034982264.1|1677695_1678262_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_034982265.1|1678402_1680502_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_087448952.1|1680791_1682147_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087448953.1|1682204_1683086_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003700808.1|1683102_1683936_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_003702509.1|1684103_1684748_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_087449028.1|1684819_1685944_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	41.4	3.7e-70
WP_034982273.1|1686386_1686704_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_087448954.1|1686715_1687126_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_087448955.1|1688078_1689476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087448956.1|1689541_1689982_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	61.2	7.1e-41
WP_002323245.1|1690238_1691411_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_087448957.1|1691654_1692761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087448958.1|1693160_1693427_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_087448959.1|1693521_1693857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448960.1|1694402_1695374_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	5.6e-22
WP_143453819.1|1697684_1697843_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_087448961.1|1698256_1698955_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.5	2.4e-27
WP_157664628.1|1699047_1699371_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.2	7.8e-05
WP_095842242.1|1699330_1699828_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.0	3.7e-38
WP_087448962.1|1699824_1700280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448963.1|1700311_1701115_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_087449029.1|1701129_1702017_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.7	2.1e-36
WP_087448964.1|1702481_1703174_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.6	2.6e-29
WP_087448965.1|1704048_1704312_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_087448966.1|1704483_1706631_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.7	8.2e-58
>prophage 14
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1726591	1795512	1893327	protease,bacteriocin,transposase	Streptococcus_phage(25.0%)	57	NA	NA
WP_087448970.1|1726591_1726903_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003704561.1|1727238_1727469_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_034982286.1|1727486_1728452_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_003704556.1|1728454_1729060_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_034982287.1|1729062_1729383_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087448971.1|1729641_1730139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080739304.1|1730234_1730831_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_034982290.1|1730832_1732017_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	45.9	1.8e-99
WP_034982291.1|1732024_1733116_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	52.6	4.9e-99
WP_034982292.1|1733536_1735093_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GW44	Streptomyces_phage	46.4	6.8e-22
WP_087448778.1|1735223_1736513_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	1.4e-44
WP_003701867.1|1736856_1737246_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_003705037.1|1737266_1738181_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003700745.1|1738199_1739009_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_087448972.1|1739027_1740026_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_034982294.1|1740296_1741289_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003709098.1|1741288_1742587_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003705044.1|1742601_1743258_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003705046.1|1743267_1744563_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_087448973.1|1744721_1745408_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003707229.1|1745455_1745836_-	VOC family protein	NA	NA	NA	NA	NA
WP_051454347.1|1745835_1746276_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044004365.1|1746398_1747910_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_087448974.1|1747909_1748611_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_034982298.1|1748674_1749481_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_080739303.1|1750467_1751724_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.4	3.7e-18
WP_087448975.1|1751925_1753362_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_034982302.1|1753397_1753934_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_087448976.1|1754070_1755864_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_003701855.1|1756048_1756321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982304.1|1756398_1757415_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_034982305.1|1757441_1758104_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_034982306.1|1758180_1758819_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_034997509.1|1758838_1760227_-	potassium transporter KtrB	NA	NA	NA	NA	NA
WP_034982308.1|1760341_1762087_-	alpha amylase N-terminal ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_034982309.1|1762202_1764137_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_034982310.1|1764539_1766030_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_003700709.1|1766048_1767041_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.2e-19
WP_003701500.1|1772859_1773894_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003707259.1|1774133_1775591_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003709061.1|1775694_1775871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003705083.1|1775930_1776407_-	universal stress protein	NA	NA	NA	NA	NA
WP_087448977.1|1776618_1778727_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	1.0e-121
WP_003705087.1|1778852_1779083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448978.1|1779285_1780644_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003705091.1|1780696_1781416_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2I7RZT1	Vibrio_phage	26.9	2.1e-05
WP_087448979.1|1781566_1782151_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	44.1	7.7e-27
WP_087448980.1|1782517_1783999_+	ABC-F type ribosomal protection protein	NA	A0A2I4R674	Erysipelothrix_phage	27.5	5.7e-34
WP_157664629.1|1784370_1785693_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_087448981.1|1785939_1788060_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_034998092.1|1788177_1788696_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	1.0e-14
WP_157664634.1|1788692_1789595_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.4	7.2e-40
WP_087448983.1|1789660_1790536_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.0	7.0e-08
WP_087448984.1|1790559_1791468_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.1	4.6e-10
WP_087448885.1|1791688_1792978_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	4.0e-44
WP_087448985.1|1793709_1794615_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_087448986.1|1794615_1795512_-	glycosyltransferase family 2 protein	NA	K7Z8A5	Megavirus	32.1	5.5e-08
>prophage 15
NZ_CP020858	Ligilactobacillus salivarius strain ZLS006 chromosome, complete genome	1893327	1842349	1891959	1893327	bacteriocin,transposase	Bacillus_phage(22.22%)	44	NA	NA
WP_157664631.1|1842349_1842511_-|bacteriocin	bactofencin A family cationic bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003701471.1|1842611_1843439_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_034982766.1|1843560_1844190_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_087449000.1|1844296_1846081_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_081513189.1|1846097_1846829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449001.1|1846948_1848730_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.3e-50
WP_034982760.1|1848722_1850456_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	4.3e-33
WP_003705682.1|1850467_1850917_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087449002.1|1851114_1852506_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003701461.1|1852595_1852796_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_087449003.1|1852901_1853198_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_087449004.1|1853312_1853747_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_087449005.1|1853831_1854941_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_034982756.1|1855096_1856239_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.4	1.3e-17
WP_087449006.1|1856254_1857172_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	40.9	9.2e-59
WP_034982754.1|1857525_1859328_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	43.0	6.3e-136
WP_003702035.1|1859496_1860411_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003707363.1|1860609_1861170_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034982753.1|1861184_1862531_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003707369.1|1862707_1863574_-	sugar transporter	NA	NA	NA	NA	NA
WP_034982752.1|1863693_1864260_-	TetR/AcrR family transcriptional regulator	NA	Q6A200	Oenococcus_phage	31.2	8.0e-13
WP_087449007.1|1864393_1865617_+	MFS transporter	NA	NA	NA	NA	NA
WP_147781572.1|1865684_1866587_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.1	5.9e-42
WP_087449009.1|1866583_1867102_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.2	3.0e-14
WP_003708940.1|1867169_1867883_-	amino acid racemase	NA	NA	NA	NA	NA
WP_034982748.1|1867892_1869143_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_087449010.1|1869142_1870675_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_003701440.1|1870818_1871145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323245.1|1871635_1872808_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_087449011.1|1873006_1874893_+	pyruvate oxidase	NA	A9YVT5	Ostreococcus_tauri_virus	22.7	1.2e-09
WP_044004264.1|1874953_1875331_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_044004262.1|1876162_1878085_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.3	3.9e-27
WP_044005558.1|1878323_1879106_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.5	2.6e-06
WP_044004260.1|1879333_1880347_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_044004258.1|1880494_1881358_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	26.8	3.2e-21
WP_044004256.1|1881444_1882734_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	4.8e-45
WP_003701427.1|1882923_1883160_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003708930.1|1883181_1883733_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	53.8	1.1e-43
WP_003703382.1|1883773_1884064_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_087449012.1|1884282_1886835_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	1.2e-111
WP_044004246.1|1886871_1888830_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	1.2e-140
WP_003705635.1|1888832_1889972_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003701414.1|1889971_1890193_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_087448778.1|1890669_1891959_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	1.4e-44
>prophage 1
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	0	5372	264403		Lactobacillus_phage(100.0%)	5	NA	NA
WP_087449038.1|510_738_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003704747.1|1624_2308_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_087449039.1|2324_2972_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003708772.1|3041_3566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003708777.1|5090_5372_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	39.3	1.8e-05
>prophage 2
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	20209	78982	264403	transposase,protease	Bacillus_phage(16.67%)	47	NA	NA
WP_080564637.1|20209_22030_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	37.0	1.5e-89
WP_003699121.1|22040_22460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087448686.1|22584_23961_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.1e-38
WP_087449045.1|24020_24680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081538411.1|24697_26938_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_034998411.1|26951_28121_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_167370867.1|28324_32335_-	ArdC family protein	NA	NA	NA	NA	NA
WP_003708803.1|32334_32511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449046.1|32713_33712_-	restriction endonuclease subunit S	NA	A0A2H4J4K4	uncultured_Caudovirales_phage	30.1	1.3e-05
WP_003708805.1|33936_34338_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_003704279.1|34337_34559_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_004564436.1|34659_34854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449047.1|44760_45606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174633257.1|45737_46985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003711234.1|47024_48422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003710828.1|48487_48928_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.0	1.1e-41
WP_081538445.1|49541_49682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982193.1|49674_49836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449048.1|49941_51975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708456.1|51990_52413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708458.1|52409_52892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708459.1|52904_53261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449049.1|53987_54302_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_100190621.1|55041_55701_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_003702407.1|56038_56254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034998308.1|56486_57488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708469.1|57502_57979_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_167370875.1|57991_58204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003699163.1|58157_58565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708471.1|58577_59693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087366693.1|59706_60720_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_087448686.1|61155_62532_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.1e-38
WP_157664638.1|62663_62816_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003708474.1|62949_63114_+	Arc family DNA-binding protein	NA	A0A0A8WG21	Clostridium_phage	54.7	3.4e-09
WP_034998310.1|63789_64212_+	helix-turn-helix transcriptional regulator	NA	F0PIH1	Enterococcus_phage	41.4	8.1e-10
WP_002323245.1|64503_65676_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_003699490.1|66623_66926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003708476.1|67183_68062_+	patatin family protein	NA	NA	NA	NA	NA
WP_087449051.1|68246_69536_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	3.6e-45
WP_003708477.1|69662_70499_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_087449052.1|70525_72793_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.3	2.8e-173
WP_167370876.1|73103_73673_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_174633258.1|73884_75309_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_069469549.1|75280_75730_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_167370877.1|75726_76953_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.9	3.1e-110
WP_087449055.1|76939_78190_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003706792.1|78202_78982_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.7	5.7e-09
>prophage 3
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	82389	124022	264403	transposase,integrase,bacteriocin	Staphylococcus_phage(15.38%)	43	90451:90467	120342:120358
WP_087449057.1|82389_85515_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.7	6.3e-67
WP_087449058.1|85611_86682_-	restriction endonuclease subunit S	NA	A0A1V0S9X4	Catovirus	31.0	9.8e-20
WP_003706797.1|86678_87647_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	31.1	5.4e-33
WP_087449059.1|87732_88281_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.4	2.5e-11
WP_087449060.1|88277_88811_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087449061.1|88800_90324_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.5	1.8e-51
90451:90467	attL	TTATTTGCATAAATTTT	NA	NA	NA	NA
WP_087449062.1|90504_91920_-	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	24.7	1.0e-24
WP_087449063.1|91912_92479_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_034982136.1|92670_93720_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003702981.1|93925_94921_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	37.7	3.1e-44
WP_087449064.1|94981_95662_-	fructose-6-phosphate aldolase	NA	A0A0E3EPH4	Synechococcus_phage	30.4	1.9e-21
WP_003699445.1|95728_96109_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_087449065.1|96146_97172_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_087449066.1|97188_97731_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_087449067.1|97742_98240_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_087449068.1|98240_100100_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_081537581.1|100115_100919_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_087449155.1|101220_101517_-	transglycosylase	NA	Q8LTK2	Lactococcus_phage	55.7	7.4e-10
WP_087449069.1|101854_102094_-	hypothetical protein	NA	A0A2P0ZLG0	Lactobacillus_phage	36.4	2.3e-06
WP_087449070.1|102171_102378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449071.1|102400_102634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708516.1|102668_102854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034998323.1|102868_103333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449072.1|103836_104004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081561764.1|104017_104272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449073.1|104274_104559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087366637.1|105402_106299_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_087449074.1|106403_109061_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_081535606.1|109594_111565_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_087449075.1|111909_112731_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003699423.1|112766_113033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003699419.1|114316_114514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003699418.1|114806_115037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449076.1|115073_115868_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003703471.1|117169_117286_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_034984297.1|118071_118314_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003710784.1|118319_118577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141566911.1|119228_119414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449156.1|120463_121111_-	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.2	5.6e-10
120342:120358	attR	AAAATTTATGCAAATAA	NA	NA	NA	NA
WP_167370868.1|121224_121566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167370869.1|121586_121853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449079.1|122213_123491_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.2	1.7e-55
WP_044005747.1|123590_124022_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	45.7	2.0e-27
>prophage 4
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	132518	132956	264403		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_003699392.1|132518_132956_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.7	3.9e-23
>prophage 5
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	139069	209926	264403	transposase,integrase	Streptococcus_phage(24.0%)	65	130703:130720	203406:203423
130703:130720	attL	CAATTTCTCTTTAAATTT	NA	NA	NA	NA
WP_087449085.1|139069_140356_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.7	4.5e-43
WP_011476677.1|140612_140882_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_087449086.1|141140_142262_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.4	1.9e-13
WP_081513040.1|142302_142725_-	fucose isomerase	NA	NA	NA	NA	NA
WP_081513041.1|142729_144064_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_081513042.1|144082_145552_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_081537304.1|145564_147352_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_087449087.1|147494_148253_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	9.7e-22
WP_174633259.1|148421_149201_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_087449089.1|149675_150188_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087449090.1|150512_151322_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	31.4	5.5e-23
WP_087449091.1|151419_152085_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_087449092.1|152261_153551_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	34.7	3.3e-54
WP_087449157.1|153994_155914_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	29.7	4.4e-63
WP_162853948.1|156226_156760_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	37.5	7.3e-24
WP_162853949.1|156732_157011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161022767.1|157585_157702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087449093.1|157800_158328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157664640.1|158617_158761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449159.1|159186_159900_+	helix-turn-helix domain-containing protein	NA	J7KJ52	Streptococcus_phage	41.7	1.4e-38
WP_087449094.1|159922_160252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449095.1|160254_161196_+	3'-5' exoribonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.2	2.8e-47
WP_157664642.1|161673_161823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449096.1|162105_163365_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	39.5	6.2e-74
WP_087449097.1|163492_164545_+	NINE protein	NA	A0A0A8WJ41	Clostridium_phage	31.8	1.2e-17
WP_087449098.1|164839_165370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449099.1|165425_165824_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	42.5	1.2e-18
WP_087449100.1|166433_167246_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_087449101.1|168413_169178_+	replication initiation protein	NA	NA	NA	NA	NA
WP_087449102.1|169462_170455_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_081535655.1|170855_172199_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	39.1	6.4e-69
WP_003699335.1|173652_173988_+	DUF5388 domain-containing protein	NA	F0PIG7	Enterococcus_phage	34.2	1.3e-07
WP_087449103.1|174626_177161_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.5	6.2e-65
WP_087449104.1|177426_178698_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_087449105.1|178694_179432_+	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	28.1	2.4e-17
WP_087449106.1|179545_180820_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_087449107.1|180964_181930_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.7	2.7e-69
WP_003709292.1|181975_182899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	1.2e-50
WP_167370878.1|183086_183941_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.9	2.7e-52
WP_167370872.1|184021_184750_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050754569.1|184918_185389_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_035149339.1|185423_185735_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_087449110.1|185748_187299_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_087449111.1|187304_187544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449112.1|187540_188266_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_167370866.1|188394_188547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449114.1|188585_189005_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_087449115.1|189129_190251_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.9e-13
WP_157664645.1|190428_190608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003699299.1|190705_191356_-	membrane protein	NA	NA	NA	NA	NA
WP_087449117.1|191358_192378_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049176196.1|192645_193905_+	MFS transporter	NA	NA	NA	NA	NA
WP_087449118.1|193925_195383_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_003699292.1|195387_195714_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_087449119.1|195726_196992_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_087449120.1|197079_197895_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_087449121.1|198201_199917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003699286.1|200067_200277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449122.1|200443_201370_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.0	2.9e-76
WP_044005691.1|201586_202144_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087449123.1|202145_203537_+	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	28.4	2.4e-26
203406:203423	attR	AAATTTAAAGAGAAATTG	NA	NA	NA	NA
WP_003699280.1|203554_203797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449124.1|204012_205902_+	site-specific DNA-methyltransferase	NA	S5VTV9	Campylobacter_phage	37.1	1.1e-53
WP_087449125.1|205916_207962_+	site-specific DNA-methyltransferase	NA	A0A0M7Q8J6	Escherichia_phage	40.0	3.0e-65
WP_087449126.1|207976_209926_+	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	38.0	5.9e-55
>prophage 6
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	222819	253793	264403	transposase,integrase	Streptococcus_phage(35.0%)	30	243549:243569	247761:247781
WP_003699254.1|222819_223095_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	62.9	4.1e-23
WP_087449132.1|223401_228027_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.8	2.0e-16
WP_003703258.1|228155_228515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003706971.1|228530_229343_+	SPFH domain-containing protein	NA	S4VT23	Pandoravirus	29.7	1.1e-15
WP_167370873.1|229396_229732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002360685.1|230340_230637_+	hypothetical protein	NA	A0A2K5B2B2	Erysipelothrix_phage	91.8	4.6e-44
WP_087449133.1|230637_231054_+	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	97.1	5.2e-70
WP_000136908.1|231055_232618_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.8	7.8e-260
WP_000205227.1|232760_232985_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000233000.1|232999_233869_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000662263.1|233849_234584_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_002294505.1|234616_235480_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	A0A1X9I6F2	Streptococcus_phage	100.0	8.7e-168
WP_000195429.1|236108_237281_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001028144.1|237410_238850_-	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_000393259.1|238850_239243_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_000195429.1|239299_240472_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_087449134.1|240851_242171_+|transposase	IS1380-like element ISSsu5 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	99.8	3.0e-252
WP_087449135.1|242470_243166_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087449136.1|243323_243755_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.5	3.9e-28
243549:243569	attL	CATATGTACATGGTCTGGCAT	NA	NA	NA	NA
WP_087449137.1|243854_245132_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.9	6.6e-55
WP_087449138.1|245560_246265_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_157664647.1|246468_246561_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157664649.1|246575_246875_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	6.1e-20
WP_087449139.1|247508_247949_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.0	1.1e-41
247761:247781	attR	CATATGTACATGGTCTGGCAT	NA	NA	NA	NA
WP_087449140.1|248014_249412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087449141.1|249649_250402_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.1	6.4e-18
WP_003703247.1|250448_251546_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_087449142.1|251926_252184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449143.1|252507_252732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449144.1|252818_253793_+	choloylglycine hydrolase family protein	NA	M1HWD6	Paramecium_bursaria_Chlorella_virus	31.8	5.6e-22
>prophage 7
NZ_CP020859	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence	264403	257252	258128	264403		Staphylococcus_phage(100.0%)	1	NA	NA
WP_087449147.1|257252_258128_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	8.0e-20
>prophage 1
NZ_CP020860	Ligilactobacillus salivarius strain ZLS006 plasmid unnamed2, complete sequence	19851	0	13517	19851	transposase	Staphylococcus_phage(20.0%)	9	NA	NA
WP_001791010.1|944_1061_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_087449160.1|3771_4689_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	1.7e-41
WP_087449161.1|4869_5484_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	48.4	3.2e-07
WP_087449162.1|6092_6662_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	41.6	6.8e-28
WP_087449163.1|6675_6978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449164.1|7223_7721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449165.1|8484_9693_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	23.5	1.7e-07
WP_157664651.1|10279_10423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087449166.1|12296_13517_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	45.4	3.6e-95
