The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018803	Histophilus somni strain USDA-ARS-USMARC-63255 chromosome, complete genome	2183391	364520	418552	2183391	terminase,protease,capsid,integrase,transposase	Mannheimia_phage(35.48%)	57	368669:368686	398503:398520
WP_075293630.1|364520_365765_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	6.3e-127
WP_075293629.1|365780_366362_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	9.0e-60
WP_075293628.1|366447_367746_-	trigger factor	NA	NA	NA	NA	NA
WP_075293701.1|368128_369520_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
368669:368686	attL	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_012341088.1|369553_370813_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_075293627.1|370882_371680_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075293626.1|371829_373206_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_075293625.1|373248_374988_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	5.1e-34
WP_075293624.1|375444_376686_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.5	8.8e-89
WP_011609578.1|376647_376833_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.6	1.7e-09
WP_075293623.1|376845_377640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293622.1|377671_378859_-	DNA cytosine methyltransferase	NA	A0A2I7R2G4	Vibrio_phage	46.5	1.6e-95
WP_075293621.1|378887_379616_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	60.2	9.0e-17
WP_087437239.1|379621_380662_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	69.2	7.3e-12
WP_075293619.1|380711_381380_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	74.0	6.4e-94
WP_087437240.1|381372_382308_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	77.6	8.3e-132
WP_011609572.1|382319_382619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|382668_382953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437241.1|383039_383705_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	64.4	2.0e-39
WP_087437242.1|384088_384511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341676.1|384507_384792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437307.1|384878_385586_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	46.6	2.9e-20
WP_075293615.1|386707_386905_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.2	4.3e-14
WP_087437308.1|386907_387126_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_075293614.1|388005_388224_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	79.2	8.1e-22
WP_075293613.1|388247_389270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609568.1|389410_389899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293611.1|390027_390444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437243.1|390440_390620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075290735.1|390889_391078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666559.1|391064_391241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609564.1|391423_391690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087437244.1|392236_393076_-	DNA replication protein DnaD	NA	F5A3D6	Riemerella_phage	39.3	3.1e-45
WP_087437245.1|393132_393819_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	5.5e-40
WP_012341693.1|393921_394149_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	43.1	2.8e-09
WP_087437246.1|394304_394544_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	78.4	1.0e-25
WP_087437247.1|394533_395358_+	DNA replication protein	NA	A0A1X9SFR3	Acinetobacter_phage	41.2	1.8e-37
WP_075293605.1|395354_396047_+	replication protein P	NA	A0A077KCC8	Edwardsiella_phage	34.6	1.9e-24
WP_075293604.1|396056_396587_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	67.2	4.8e-68
WP_075293603.1|396623_397250_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	3.1e-18
WP_075293602.1|397262_397541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293601.1|397619_398207_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	55.1	1.7e-50
WP_075293600.1|398196_398601_+	hypothetical protein	NA	NA	NA	NA	NA
398503:398520	attR	TTGGATATAAGCGAAACA	NA	NA	NA	NA
WP_075293599.1|398751_399591_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.6	1.6e-73
WP_075319826.1|399859_400276_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	7.4e-48
WP_075319827.1|400322_401459_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	56.4	2.6e-119
WP_012341704.1|401747_401984_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.5	2.7e-23
WP_075294024.1|401973_402513_+	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	9.9e-45
WP_075294034.1|402485_402812_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_041604566.1|402840_402984_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	69.8	9.9e-13
WP_075294025.1|403008_403704_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_011609539.1|403703_405251_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.0	6.4e-97
WP_075294026.1|405252_407430_+	hypothetical protein	NA	S4S2T1	Puniceispirillum_phage	25.9	3.4e-43
WP_011609534.1|416008_416311_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026574.1|416395_416590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012341716.1|416667_417531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294028.1|417556_418552_+|capsid	N4-gp56 family major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NZ_CP018803	Histophilus somni strain USDA-ARS-USMARC-63255 chromosome, complete genome	2183391	463164	520123	2183391	protease,integrase,transposase	Escherichia_phage(16.67%)	57	488608:488624	507154:507170
WP_075319814.1|463164_463581_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075319813.1|463627_464764_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075293400.1|465019_465949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293401.1|465967_466414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293402.1|466631_466964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665519.1|467116_467257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293403.1|467333_467981_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_075293405.1|468565_468982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293406.1|469080_469299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293407.1|469422_469887_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_075293408.1|470649_472680_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	1.2e-47
WP_041604434.1|472681_472969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609878.1|473063_473786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293409.1|474071_474323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293410.1|474319_475216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293411.1|475327_475807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293412.1|476707_477922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293413.1|478034_478427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293458.1|479274_480114_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075293414.1|480097_481102_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	27.6	1.2e-19
WP_075293415.1|481723_482146_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075293416.1|482198_482699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293417.1|482701_482899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293459.1|483072_483534_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075293418.1|483896_484307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293419.1|484308_486336_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_075293460.1|486338_487661_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
488608:488624	attL	TAATGTTTTATGATTTT	NA	NA	NA	NA
WP_075293420.1|489743_489938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011609870.1|489941_490151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376608.1|490154_490952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609868.1|491099_491612_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_075293421.1|491652_491922_-	DUF1845 domain-containing protein	NA	NA	NA	NA	NA
WP_081376609.1|492118_493306_+|integrase	site-specific integrase	integrase	A0A1B5FPC6	Escherichia_phage	32.1	6.8e-46
WP_081376610.1|493277_494117_+	nucleoside triphosphate hydrolase	NA	H7BWC4	unidentified_phage	38.5	1.6e-38
WP_041604971.1|494642_494846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_135026463.1|494961_495243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293423.1|495211_495433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075293424.1|495736_495919_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	67.8	2.2e-12
WP_012341117.1|496215_496434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666560.1|496919_497057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012341122.1|497388_497688_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_075293425.1|497898_498417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081376612.1|499323_500553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011609865.1|500715_501267_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_075293427.1|501277_502984_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_135026467.1|502973_504278_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	44.8	3.1e-84
WP_075293428.1|505468_506578_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.0	3.6e-17
WP_011609498.1|506742_507066_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.3e-19
WP_012341146.1|507183_507879_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
507154:507170	attR	AAAATCATAAAACATTA	NA	NA	NA	NA
WP_075293429.1|507965_509207_-	uracil permease	NA	NA	NA	NA	NA
WP_075293430.1|509308_509935_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011609493.1|511094_512444_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_075293431.1|512848_513256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075293432.1|514065_515856_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.2	1.3e-136
WP_012341153.1|515877_516906_-	sugar kinase	NA	NA	NA	NA	NA
WP_075293433.1|517406_518705_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	1.3e-66
WP_075293434.1|518770_520123_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018803	Histophilus somni strain USDA-ARS-USMARC-63255 chromosome, complete genome	2183391	741149	770088	2183391	terminase,integrase,transposase	Burkholderia_phage(18.18%)	31	759859:759888	770567:770596
WP_014325826.1|741149_741914_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_087437258.1|742977_744471_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|744582_744888_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|744915_746130_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|746406_747291_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_014325823.1|747918_749211_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|749373_750219_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|750387_751191_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|751190_752027_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|752362_753178_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|754094_755105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087437310.1|756149_756374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|756452_757352_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|757501_757939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|758670_759249_-	hypothetical protein	NA	NA	NA	NA	NA
759859:759888	attL	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
WP_075294468.1|759998_761246_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	31.5	6.0e-53
WP_075294469.1|761538_761796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294470.1|761805_762315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340798.1|762482_762704_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075294471.1|762713_762959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294472.1|762959_763199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376605.1|763212_763740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294473.1|763891_764374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294474.1|764366_764585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041604074.1|764571_764940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294476.1|765465_767376_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	31.1	3.1e-48
WP_041604501.1|767919_768186_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.5	2.7e-11
WP_011608692.1|768221_768617_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.5	5.6e-05
WP_075294477.1|768755_769049_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	33.8	6.8e-08
WP_075294478.1|769061_769649_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.7	5.0e-10
WP_075294479.1|769641_770088_+|terminase	terminase	terminase	NA	NA	NA	NA
770567:770596	attR	ATTTTAGTAGTATAAATGGTAGTATAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP018803	Histophilus somni strain USDA-ARS-USMARC-63255 chromosome, complete genome	2183391	1652253	1659524	2183391	transposase	Planktothrix_phage(16.67%)	6	NA	NA
WP_075294159.1|1652253_1654206_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-11
WP_012341601.1|1654209_1655016_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	6.3e-19
WP_075294158.1|1655096_1656683_+	FAD-binding protein	NA	M1I0Y3	Acanthocystis_turfacea_Chlorella_virus	23.7	5.7e-08
WP_075319813.1|1656838_1657975_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	53.7	5.2e-112
WP_075319814.1|1658021_1658438_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.5e-48
WP_075294045.1|1658552_1659524_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	19.7	1.2e-05
>prophage 5
NZ_CP018803	Histophilus somni strain USDA-ARS-USMARC-63255 chromosome, complete genome	2183391	1857349	1905773	2183391	holin,plate,head,tail,transposase	Haemophilus_phage(39.47%)	54	NA	NA
WP_075294184.1|1857349_1858150_-|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	31.0	1.7e-08
WP_075294185.1|1858151_1858850_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_075294186.1|1858846_1859779_-	DMT family transporter	NA	NA	NA	NA	NA
WP_081376854.1|1859765_1860569_-	phosphotransferase	NA	NA	NA	NA	NA
WP_075294187.1|1861077_1862082_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011609618.1|1862257_1862725_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.1	8.0e-51
WP_075294188.1|1862740_1864867_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.6	2.6e-258
WP_075294190.1|1867148_1868807_+	putative transporter	NA	NA	NA	NA	NA
WP_012341368.1|1869000_1869213_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_081376598.1|1869264_1869438_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075294192.1|1870126_1870924_-	transcriptional regulator	NA	A0A0M4UKA3	Ralstonia_phage	27.4	8.6e-13
WP_075294193.1|1871046_1871310_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_075294194.1|1873280_1874162_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	85.0	3.7e-134
WP_075294195.1|1874169_1874358_+	hypothetical protein	NA	F6MII8	Haemophilus_phage	80.0	1.3e-20
WP_075294196.1|1874354_1874660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294197.1|1875456_1875672_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135026520.1|1875656_1875899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294199.1|1876036_1876495_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_075294200.1|1876588_1876777_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.7	2.8e-07
WP_075294201.1|1877505_1878174_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	45.3	2.7e-20
WP_075294202.1|1878184_1878391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294203.1|1878515_1878941_+	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	66.4	1.5e-48
WP_075294204.1|1879030_1879573_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	67.2	2.5e-72
WP_075294205.1|1879579_1879810_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	52.7	8.0e-12
WP_075294206.1|1879806_1880064_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_075294207.1|1879987_1880197_+	lipoprotein	NA	F6MIK2	Haemophilus_phage	46.4	1.6e-06
WP_075294208.1|1880180_1880435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075294209.1|1880431_1880686_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	45.0	1.6e-08
WP_075294210.1|1880688_1881198_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	72.2	8.7e-67
WP_075294211.1|1882993_1884613_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	84.1	4.4e-266
WP_075294212.1|1884599_1885871_+|head	phage head morphogenesis protein	head	A0A0M3LSH7	Mannheimia_phage	70.9	2.3e-169
WP_081376597.1|1886112_1886658_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	75.4	1.1e-62
WP_075294213.1|1886657_1887638_+|head	head protein	head	B7SDP1	Haemophilus_phage	73.8	1.2e-133
WP_075294214.1|1887716_1888139_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	64.5	6.5e-44
WP_075294215.1|1888135_1888774_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	70.8	5.0e-80
WP_075294216.1|1888770_1889037_+	hypothetical protein	NA	B7SDP6	Haemophilus_phage	67.1	6.0e-27
WP_075294217.1|1889023_1889197_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	72.7	3.7e-14
WP_075294218.1|1889196_1890618_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	74.8	1.5e-196
WP_075294219.1|1890629_1891004_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	85.5	3.3e-55
WP_087437316.1|1891072_1891360_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	52.8	3.5e-17
WP_075294221.1|1891630_1893763_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	37.0	9.8e-96
WP_087437296.1|1893804_1895160_+	hypothetical protein	NA	F6MIL2	Haemophilus_phage	61.9	1.4e-159
WP_075294228.1|1895170_1896277_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	72.3	1.1e-159
WP_075294223.1|1896273_1896933_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	69.4	1.3e-83
WP_075294224.1|1897035_1897386_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	78.4	9.9e-46
WP_075294225.1|1897398_1898460_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	72.4	1.1e-145
WP_075294226.1|1898459_1899023_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	41.9	4.8e-34
WP_075294227.1|1899025_1899565_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	38.2	2.1e-15
WP_157665525.1|1899542_1900577_+	hypothetical protein	NA	Q94MY0	Haemophilus_virus	49.2	2.5e-60
WP_012341722.1|1900583_1900931_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.9	1.3e-18
WP_012340329.1|1900914_1901166_-	cytotoxic translational repressor of toxin-antitoxin stability system	NA	A0A1S5NR91	Burkholderia_phage	50.6	1.2e-13
WP_075294466.1|1901228_1901855_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	57.2	1.8e-58
WP_011609624.1|1903167_1903857_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_075294465.1|1904051_1905773_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	4.1e-68
