The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021434	Tumebacillus avium strain AR23208 chromosome, complete genome	5249768	1903441	1911798	5249768		Gordonia_phage(16.67%)	8	NA	NA
WP_087456547.1|1903441_1904734_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.9	5.9e-19
WP_087459175.1|1904839_1905556_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	45.4	2.2e-47
WP_087456548.1|1905552_1905801_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_087456549.1|1905804_1906485_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_087459176.1|1906573_1908712_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-155
WP_087459177.1|1908720_1910139_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.5	1.8e-53
WP_087456550.1|1910150_1911185_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.0e-69
WP_087456551.1|1911189_1911798_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	9.2e-23
>prophage 2
NZ_CP021434	Tumebacillus avium strain AR23208 chromosome, complete genome	5249768	2254971	2263898	5249768		Streptococcus_phage(33.33%)	7	NA	NA
WP_087456824.1|2254971_2255916_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.6	9.1e-86
WP_087456825.1|2255931_2257833_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	33.1	2.5e-26
WP_087459198.1|2258080_2258533_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_087456826.1|2258697_2260752_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	22.9	3.0e-09
WP_087456827.1|2260889_2261759_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.9	1.2e-07
WP_087459199.1|2261951_2262932_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.3	4.4e-59
WP_087456828.1|2262953_2263898_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.0	3.0e-49
>prophage 3
NZ_CP021434	Tumebacillus avium strain AR23208 chromosome, complete genome	5249768	3007038	3071418	5249768	tRNA,transposase,integrase,protease	Bacillus_phage(16.67%)	45	3058504:3058532	3078824:3078852
WP_087457429.1|3007038_3009363_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_087457430.1|3009528_3011874_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_087459249.1|3012085_3013861_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_087457431.1|3013906_3014131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087457432.1|3014530_3015031_+|protease	protease	protease	NA	NA	NA	NA
WP_087457433.1|3015055_3016555_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.3	2.7e-07
WP_087457434.1|3016679_3017861_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087457435.1|3017857_3019489_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_087457436.1|3019523_3021191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457437.1|3021239_3021869_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	43.3	5.4e-26
WP_087457438.1|3021840_3022554_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_087457439.1|3022603_3022825_+	DUF3892 domain-containing protein	NA	A0A127AW17	Bacillus_phage	45.3	7.4e-07
WP_087457440.1|3023250_3023910_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_087457441.1|3023947_3025531_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	59.6	3.9e-182
WP_157721954.1|3025780_3026617_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_087457443.1|3026804_3039737_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.7	5.8e-167
WP_087457444.1|3039754_3040747_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087457445.1|3040739_3041666_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	3.2e-35
WP_087457446.1|3041760_3042603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457447.1|3042671_3043316_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_087457448.1|3043389_3044667_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	35.9	3.7e-58
WP_087457449.1|3045039_3047547_+	U32 family peptidase	NA	Q6DW11	Phage_TP	33.6	5.8e-31
WP_087457450.1|3047742_3048246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459250.1|3048333_3049722_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_087457451.1|3049839_3050349_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_087459251.1|3050452_3051904_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	33.8	7.3e-42
WP_087457452.1|3051900_3052488_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.6	7.9e-64
WP_087457453.1|3052472_3053291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457454.1|3054384_3054609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157721955.1|3054660_3055191_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_087457456.1|3055322_3055568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457457.1|3055572_3055806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457458.1|3055923_3056172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087459252.1|3056347_3057040_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_087457459.1|3057070_3057730_+	CoA transferase subunit B	NA	NA	NA	NA	NA
3058504:3058532	attL	CCGATAGGAGCAATCCTGTCGGTTTTTTG	NA	NA	NA	NA
WP_157721956.1|3058568_3059609_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	29.9	1.0e-37
WP_087457461.1|3059953_3060907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157721957.1|3061357_3062659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087457463.1|3062831_3064121_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157721958.1|3064132_3064504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087457465.1|3064882_3065425_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	51.3	5.8e-45
WP_087457466.1|3065656_3066976_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_157721959.1|3066968_3067901_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_087455883.1|3069269_3070070_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087455884.1|3070062_3071418_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
3078824:3078852	attR	CCGATAGGAGCAATCCTGTCGGTTTTTTG	NA	NA	NA	NA
