The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	1232454	1304362	5398926	capsid,head,holin,protease,plate,terminase,tail,integrase,portal	Stenotrophomonas_phage(57.5%)	76	1225727:1225744	1265136:1265153
1225727:1225744	attL	GGCAAGACCACGCTGCTG	NA	NA	NA	NA
WP_003490845.1|1232454_1234536_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_124632115.1|1235140_1235209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011050660.1|1235413_1236058_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016849001.1|1236326_1237625_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029828204.1|1237692_1238727_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016850314.1|1238940_1239687_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|1239717_1241184_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_033482896.1|1241379_1242204_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_016850317.1|1242347_1242557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828209.1|1244175_1244595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849994.1|1244780_1245524_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011050667.1|1246003_1246546_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016849993.1|1246526_1247663_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033482898.1|1247885_1249412_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003483747.1|1249583_1251686_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005915906.1|1251798_1253127_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
WP_003483753.1|1253199_1253889_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_033482899.1|1254071_1255718_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005915911.1|1255867_1256176_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	3.6e-07
WP_003483760.1|1256172_1256568_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003483762.1|1256793_1257801_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_016850996.1|1257940_1258702_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_016850997.1|1259398_1260016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007201.1|1260032_1261214_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.0	2.3e-123
WP_078585787.1|1261213_1261435_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
WP_016851001.1|1261906_1262131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851002.1|1262127_1262400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014091203.1|1262392_1262575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007203.1|1262567_1262993_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.2	5.1e-20
WP_016849270.1|1263071_1263344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849269.1|1263343_1263631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472861.1|1263627_1263846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828224.1|1264166_1266863_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
1265136:1265153	attR	CAGCAGCGTGGTCTTGCC	NA	NA	NA	NA
WP_016851008.1|1266871_1267084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851009.1|1267080_1267359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008572766.1|1267369_1267690_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_164517434.1|1267692_1267953_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_029828228.1|1268026_1268458_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
WP_016851031.1|1269064_1270051_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
WP_016851032.1|1270047_1270449_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
WP_029828231.1|1270461_1273332_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
WP_005922203.1|1273361_1273475_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029828232.1|1273483_1273786_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_016850450.1|1273831_1274341_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_029828235.1|1274370_1275537_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	1.1e-133
WP_016850452.1|1275548_1275908_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
WP_016850453.1|1275904_1276468_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
WP_016850454.1|1276610_1277285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850455.1|1277287_1277581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850456.1|1277654_1279454_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
WP_029828239.1|1279466_1280009_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
WP_016851159.1|1280001_1280892_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_078585788.1|1280987_1282526_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016851160.1|1282707_1283157_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
WP_016851161.1|1283144_1283564_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
WP_016851162.1|1283560_1284049_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	1.2e-28
WP_029828241.1|1284048_1284687_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
WP_005922189.1|1284686_1284962_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005929454.1|1284954_1285311_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|1285315_1285525_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029828243.1|1285524_1285992_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
WP_016851153.1|1286090_1286810_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
WP_029828245.1|1286813_1287827_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
WP_029828246.1|1287873_1288716_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
WP_033482900.1|1288837_1290622_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.5	7.3e-270
WP_016850658.1|1290621_1291635_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
WP_078585599.1|1291660_1291906_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
WP_029828252.1|1291823_1292525_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
WP_078585598.1|1292697_1293114_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026007262.1|1294041_1294941_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_016851285.1|1296082_1297204_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
WP_016851284.1|1298211_1298541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851283.1|1298726_1298924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851282.1|1300938_1302231_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1302323_1302950_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|1303075_1304362_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 2
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	2765256	2786910	5398926	terminase,tail,head	Siphoviridae_environmental_samples(25.0%)	20	NA	NA
WP_016850927.1|2765256_2769654_-	hypothetical protein	NA	C4ML20	Xanthomonas_virus	50.1	0.0e+00
WP_016850926.1|2769644_2770037_-	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	52.0	1.6e-31
WP_016850925.1|2770036_2770498_-	DUF1833 family protein	NA	Q52PL0	Xanthomonas_phage	45.1	6.1e-35
WP_016850924.1|2770494_2770851_-	hypothetical protein	NA	I7H418	Xanthomonas_virus	43.2	7.2e-20
WP_016850923.1|2770850_2774204_-|tail	phage tail tape measure protein	tail	A0A2R3UAA7	Siphoviridae_environmental_samples	32.7	8.5e-78
WP_016850922.1|2774207_2774522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850921.1|2774550_2774943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850920.1|2775040_2775508_-	hypothetical protein	NA	W6EKF5	Rhizobium_phage	50.0	5.6e-36
WP_016850919.1|2775582_2775981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050990055.1|2775977_2776403_-	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	39.6	7.3e-19
WP_088091913.1|2776383_2777481_-|head	head morphogenesis protein	head	A0A2H4IY91	uncultured_Caudovirales_phage	39.3	6.9e-61
WP_016850917.1|2777480_2777837_-	hypothetical protein	NA	A0A2D0W9H2	Bordetella_phage	29.4	7.8e-06
WP_016850916.1|2777833_2778346_-	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	54.1	4.8e-41
WP_016850915.1|2778348_2778879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007186.1|2778928_2779876_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	70.5	1.6e-122
WP_016850913.1|2779889_2780330_-	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	69.3	7.5e-43
WP_026007185.1|2780333_2781428_-	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	59.1	3.6e-110
WP_050990057.1|2781484_2782750_-	SGNH/GDSL hydrolase family protein	NA	Q52PM7	Xanthomonas_phage	37.0	3.1e-57
WP_016850910.1|2783527_2785342_-	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	54.6	1.6e-176
WP_087944856.1|2785341_2786910_-|terminase	phage terminase large subunit	terminase	A0A1P8VVI4	Erythrobacter_phage	40.6	3.5e-90
>prophage 3
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	2792231	2799735	5398926		Planktothrix_phage(14.29%)	13	NA	NA
WP_016850898.1|2792231_2792753_-	hypothetical protein	NA	G9BW80	Planktothrix_phage	36.5	1.4e-19
WP_016850897.1|2792749_2792971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850896.1|2792967_2793141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124632072.1|2793137_2793533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850894.1|2793616_2794216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850893.1|2794212_2794854_-	hypothetical protein	NA	A0A0U1W0G1	Pseudomonas_phage	40.6	1.5e-28
WP_016850892.1|2794850_2796344_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	37.8	2.5e-66
WP_050990052.1|2796340_2797276_-	hypothetical protein	NA	V5URT9	Shigella_phage	62.6	3.3e-48
WP_016850891.1|2797268_2797472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850890.1|2797468_2797945_-	hypothetical protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	44.7	1.0e-21
WP_016850889.1|2798216_2798447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850888.1|2798736_2798976_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	40.8	4.0e-06
WP_016850887.1|2799060_2799735_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	31.4	3.7e-17
>prophage 4
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	3813392	3921653	5398926	capsid,transposase,tRNA,holin,head,plate,terminase,tail,integrase,portal	Stenotrophomonas_phage(44.68%)	111	3854373:3854417	3892397:3892441
WP_003482499.1|3813392_3814112_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003482501.1|3814125_3816150_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	6.7e-94
WP_003482503.1|3816423_3816948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482504.1|3816961_3819406_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_029829319.1|3819645_3821730_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_029829321.1|3822086_3823529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088091919.1|3823790_3825950_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_078585717.1|3826255_3826336_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_003482510.1|3826419_3827319_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_005921461.1|3827315_3828068_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_016849287.1|3828064_3828343_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_003482516.1|3828339_3829458_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_015463489.1|3829520_3830033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849289.1|3830469_3831984_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_016849290.1|3832284_3833319_+	ROK family protein	NA	NA	NA	NA	NA
WP_016849291.1|3833419_3836056_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_029829327.1|3836272_3840394_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.4	2.0e-44
WP_003482535.1|3840496_3841045_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011052052.1|3841525_3843322_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	1.5e-81
WP_005913671.1|3843460_3843958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851165.1|3844036_3844441_+	response regulator	NA	NA	NA	NA	NA
WP_154666349.1|3844622_3844799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011052054.1|3845908_3846619_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_016851168.1|3846827_3847034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851169.1|3847544_3849713_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_026007238.1|3850078_3850705_-	amino acid transporter	NA	NA	NA	NA	NA
WP_016851171.1|3850806_3851709_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003482555.1|3851981_3852341_-	response regulator	NA	NA	NA	NA	NA
WP_016851172.1|3852337_3853345_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_016851173.1|3853619_3854294_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	33.8	4.1e-24
3854373:3854417	attL	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_026007239.1|3854562_3855762_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
WP_016851175.1|3855761_3855983_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	1.4e-18
WP_016851176.1|3855979_3856186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851177.1|3856182_3856455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851178.1|3856451_3856697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026007240.1|3856693_3856969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164517441.1|3856961_3857138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851181.1|3857130_3857541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|3857619_3857883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851183.1|3857879_3858158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851184.1|3858154_3858373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851185.1|3858666_3861354_-	hypothetical protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011038118.1|3861357_3861597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033483125.1|3861593_3861797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573074.1|3861897_3862209_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
WP_016851187.1|3862215_3862470_-	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_026007241.1|3862536_3862965_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
WP_162098678.1|3863271_3863661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157382238.1|3863740_3864064_-	DUF4325 domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.7e-07
WP_162098679.1|3864044_3865193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851189.1|3865278_3866265_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
WP_016851190.1|3866261_3866663_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_029996349.1|3866675_3869546_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
WP_005922203.1|3869575_3869689_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_016851198.1|3869697_3870000_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_016851197.1|3870045_3870555_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
WP_016851114.1|3870585_3871752_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
WP_016851115.1|3871763_3872123_-|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
WP_016851116.1|3872119_3872683_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_016851117.1|3872761_3872989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851118.1|3872990_3874196_-	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
WP_026007225.1|3874199_3874748_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_016851120.1|3874740_3875631_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
WP_042761698.1|3876037_3876511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080573070.1|3876522_3877347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851121.1|3877519_3877975_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.3e-37
WP_016851122.1|3877962_3878382_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
WP_016851123.1|3878378_3878867_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
WP_164673266.1|3878866_3879505_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	62.1	9.2e-50
WP_005922189.1|3879504_3879780_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_005917737.1|3879772_3880129_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005917735.1|3880133_3880343_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_029996352.1|3880342_3880810_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
WP_016851435.1|3880908_3881628_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
WP_016851436.1|3881631_3882645_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	1.0e-135
WP_088091921.1|3882691_3883534_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	4.5e-68
WP_033483117.1|3883655_3885440_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_088091922.1|3885439_3886462_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	1.2e-139
WP_053503138.1|3886487_3886733_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_029996358.1|3886650_3887346_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
WP_016851201.1|3887377_3887845_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_088091923.1|3887844_3889071_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016850467.1|3891077_3891563_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
WP_011038085.1|3891906_3892242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850466.1|3892678_3893362_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
3892397:3892441	attR	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
WP_011052060.1|3893404_3894223_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003482562.1|3894229_3894748_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003482565.1|3894805_3896125_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_029829330.1|3896310_3897351_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_016849299.1|3897340_3897790_-	protein TolR	NA	NA	NA	NA	NA
WP_003482569.1|3897947_3898727_-	protein TolQ	NA	NA	NA	NA	NA
WP_003482571.1|3898738_3899197_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003482572.1|3899249_3900290_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_016849298.1|3900329_3900560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921446.1|3900562_3902467_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
WP_003482577.1|3902663_3903248_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003482580.1|3903366_3903891_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482581.1|3904020_3904749_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029829331.1|3904838_3905516_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005913643.1|3905613_3906141_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016850983.1|3906563_3908330_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016850980.1|3910180_3910465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007196.1|3910622_3911162_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
WP_016850978.1|3911209_3911359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098477664.1|3911434_3912537_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	7.7e-44
WP_087943921.1|3913550_3914695_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_078585900.1|3914758_3915211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124632122.1|3915244_3915640_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_070996149.1|3916025_3919520_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_070996147.1|3919827_3920358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|3920508_3921653_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
>prophage 5
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	4454013	4465783	5398926		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913455.1|4454013_4455360_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_016850199.1|4455406_4456810_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-48
WP_016850197.1|4457092_4458259_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
WP_029829443.1|4458599_4459499_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
WP_016851441.1|4459495_4460053_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_005913450.1|4460049_4460937_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_005920787.1|4460988_4462044_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
WP_016851442.1|4462263_4463010_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_016851443.1|4463009_4463954_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005920793.1|4464117_4464846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005913435.1|4464826_4465783_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
>prophage 6
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	4676934	4731414	5398926	capsid,tRNA,head,holin,plate,terminase,tail,integrase,portal	Stenotrophomonas_phage(66.67%)	67	4699226:4699242	4716440:4716456
WP_070996132.1|4676934_4678179_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	56.2	2.6e-120
WP_016851204.1|4678450_4678795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851203.1|4678791_4678959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050990064.1|4679590_4680817_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016851201.1|4680816_4681284_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_029829505.1|4681315_4682020_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	79.1	9.4e-112
WP_078560558.1|4681937_4682183_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.8	2.8e-15
WP_029829507.1|4682208_4683222_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	2.4e-140
WP_033837534.1|4683221_4685006_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.1	1.9e-270
WP_029829511.1|4685127_4685970_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	9.9e-68
WP_016851152.1|4686016_4687030_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	3.2e-137
WP_029829513.1|4687033_4687753_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	61.6	6.5e-68
WP_029829514.1|4687851_4688319_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.8e-31
WP_005917735.1|4688318_4688528_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005917737.1|4688532_4688889_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_015471780.1|4688881_4689157_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	2.3e-21
WP_029829516.1|4689156_4689795_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	62.1	9.2e-50
WP_016850284.1|4689794_4690283_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.3	1.3e-27
WP_016850283.1|4690279_4690699_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_016850282.1|4690686_4691142_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	57.4	4.4e-38
WP_078539024.1|4691411_4692242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124632104.1|4692253_4692694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850281.1|4692923_4693814_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	2.0e-82
WP_029829518.1|4693806_4694352_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	57.1	2.9e-52
WP_016850985.1|4694364_4696164_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.5	1.2e-81
WP_026007198.1|4696240_4696534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850987.1|4696536_4697211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850988.1|4697354_4697918_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.5	2.8e-26
WP_016850989.1|4697914_4698274_+|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	63.6	2.1e-35
WP_029829520.1|4698285_4699452_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.8	6.5e-134
4699226:4699242	attL	TGATCGAAACGATCAAC	NA	NA	NA	NA
WP_016851113.1|4699482_4699992_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	3.4e-71
WP_016851112.1|4700037_4700340_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	3.7e-25
WP_005922203.1|4700348_4700462_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029829524.1|4700491_4703362_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	50.3	3.3e-187
WP_016851191.1|4703374_4703776_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	58.3	7.4e-37
WP_016851192.1|4703772_4704759_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.4	5.0e-95
WP_016851193.1|4704835_4705135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029829526.1|4706392_4706824_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	33.1	2.4e-09
WP_164673267.1|4706897_4707155_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015472857.1|4707157_4707478_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.8	7.4e-24
WP_016849266.1|4707488_4707767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849267.1|4707763_4707976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029829528.1|4707985_4710682_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_026007204.1|4711005_4711224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851005.1|4711220_4711508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851004.1|4711507_4711780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026006878.1|4711858_4712284_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	47.4	3.3e-19
WP_016849272.1|4712276_4712459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849273.1|4712451_4712724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|4712720_4712945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026006879.1|4712941_4713214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849275.1|4713416_4713641_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	64.3	3.4e-15
WP_078585863.1|4713640_4714828_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	52.6	9.9e-114
WP_011052523.1|4715464_4715785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005921936.1|4715977_4717855_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
4716440:4716456	attR	GTTGATCGTTTCGATCA	NA	NA	NA	NA
WP_003484398.1|4717963_4718404_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_033482975.1|4718504_4719419_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_003484403.1|4719586_4720108_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016849278.1|4720353_4721487_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	3.6e-28
WP_003484425.1|4721625_4722102_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_016849279.1|4722098_4723604_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003484429.1|4723888_4724944_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016849281.1|4724947_4725772_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003484433.1|4725965_4727243_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_016849282.1|4727408_4729130_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016849283.1|4729180_4730491_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_005921922.1|4730490_4731414_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP015972	Xanthomonas citri pv. glycines str. 12-2 chromosome, complete genome	5398926	5064309	5103505	5398926	transposase,plate	Leptospira_phage(40.0%)	23	NA	NA
WP_026007049.1|5064309_5065644_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016850250.1|5066222_5067539_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_029829631.1|5067825_5068374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850542.1|5068370_5070338_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.4	1.2e-36
WP_016850541.1|5070488_5071820_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014091406.1|5072055_5072370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029996410.1|5072413_5074933_-	tetratricopeptide repeat protein	NA	A0A2P1EMR8	Moumouvirus	29.2	1.4e-11
WP_003487343.1|5074911_5075451_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005926389.1|5075799_5076327_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_029829634.1|5076323_5077394_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_016850017.1|5077859_5080745_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_029829635.1|5080848_5082150_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_164517442.1|5082450_5083565_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	9.5e-42
WP_078585917.1|5084210_5088017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164517443.1|5088798_5089913_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	9.5e-42
WP_016849978.1|5091726_5092461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849977.1|5092868_5094896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849976.1|5095209_5095473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124632107.1|5096270_5097287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016849975.1|5097273_5100054_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.6	2.1e-82
WP_029829650.1|5100109_5101150_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_029829651.1|5101113_5102997_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016849786.1|5103001_5103505_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
