The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	540178	596958	4882599	portal,holin,lysis,integrase,transposase,terminase,coat,protease	Salmonella_phage(49.23%)	78	543695:543711	606173:606189
WP_000502119.1|540178_540637_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001247039.1|541099_541858_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_000766837.1|541904_542303_-	outer membrane protein	NA	NA	NA	NA	NA
WP_001675688.1|542993_543266_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
WP_000859023.1|543210_544176_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
543695:543711	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000105593.1|544209_545124_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000780210.1|545123_546002_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000379343.1|546016_546643_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_001274854.1|546644_548066_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_012543325.1|548197_549436_-	MFS transporter	NA	NA	NA	NA	NA
WP_001539227.1|549776_550100_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_126790267.1|552624_552900_+	GtrA family protein	NA	A0A1R3Y5Q2	Salmonella_virus	96.7	1.6e-43
WP_024143049.1|552971_554894_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	97.2	0.0e+00
WP_020899468.1|554929_556900_-	hypothetical protein	NA	T1SBJ2	Salmonella_phage	96.6	3.8e-304
WP_031306894.1|557011_557785_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	8.0e-80
WP_031306893.1|557868_558507_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	5.3e-98
WP_023972978.1|558580_558754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972977.1|558853_559495_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023167446.1|559555_559885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023167447.1|559902_561720_-	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_023893010.1|561719_563090_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.4	1.3e-242
WP_023167449.1|563099_563789_-	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
WP_000627703.1|563791_564247_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167450.1|564246_564948_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_001122424.1|564951_566370_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|566329_566830_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_023167451.1|566813_567374_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_023893008.1|567414_568707_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	99.1	1.4e-241
WP_023167453.1|568706_569618_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023170969.1|569631_571809_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023893007.1|571808_573308_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	99.8	1.1e-306
WP_000729925.1|573285_573774_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|573777_574182_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|574184_574427_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|574750_575272_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|575484_575934_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|575951_576389_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|576372_576699_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|577133_577757_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_023170970.1|577753_577933_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	4.6e-23
WP_000149925.1|577913_578117_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_001748048.1|578113_578338_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	98.6	2.4e-37
WP_001129733.1|578334_578946_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|578938_579115_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|579107_579440_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|579442_579619_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_024140156.1|579585_579759_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	96.5	7.5e-31
WP_001748047.1|579755_580202_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	8.6e-79
WP_023170971.1|580158_580377_-	restriction alleviation protein, Lar family	NA	A0A0P0ZEB1	Stx2-converting_phage	50.0	1.9e-10
WP_024159706.1|580379_580643_-	hypothetical protein	NA	I6R992	Salmonella_phage	95.3	5.0e-42
WP_001750243.1|580654_580849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023170974.1|580863_581070_-	hypothetical protein	NA	A0A192Y802	Salmonella_phage	97.1	1.2e-30
WP_000158322.1|581141_581420_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.6	8.7e-45
WP_001248406.1|581416_582793_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|582789_583605_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|583597_583744_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|583778_584057_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|584163_584349_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|584429_585080_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_023893006.1|585433_585736_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	3.1e-48
WP_001682202.1|585756_586335_-	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_087526167.1|586527_587142_+	pentapeptide repeat-containing protein	NA	B9UDG8	Salmonella_phage	73.5	3.1e-42
WP_023167636.1|587458_587632_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_000156731.1|587612_587801_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_058685122.1|587790_587934_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	93.6	3.5e-18
WP_023167638.1|587930_588638_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_001253478.1|588637_588922_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630922.1|588968_589262_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_023167639.1|589272_589437_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630920.1|589433_589832_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_022630919.1|589828_590128_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630918.1|590129_590579_+	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630917.1|590578_591052_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.3e-68
WP_153266261.1|591518_591659_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	100.0	3.2e-16
WP_022630914.1|591888_593052_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	98.2	2.1e-225
WP_000893231.1|593257_594508_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|594519_595623_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|595905_596958_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
606173:606189	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 2
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	1352524	1395293	4882599	plate,tail,tRNA	Burkholderia_phage(45.0%)	44	NA	NA
WP_001182237.1|1352524_1353523_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|1353610_1354921_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1355167_1355683_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1355781_1355991_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1356012_1356126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|1356122_1357448_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1357626_1358235_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|1358343_1358712_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1358882_1361303_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1361401_1362274_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1362287_1362785_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|1362965_1363883_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|1364046_1365405_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1365493_1366603_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|1366964_1368155_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|1368286_1369831_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|1369845_1370736_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|1370901_1371312_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_071953675.1|1371454_1373551_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|1373550_1374288_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|1374284_1374953_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1374986_1375229_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|1375672_1377322_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_085341482.1|1377666_1379016_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1379148_1379496_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|1380071_1380359_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|1380361_1380967_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|1380979_1381294_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000875314.1|1381904_1382102_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|1382091_1383519_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|1383518_1384043_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|1384094_1384412_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1384371_1384500_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_085341483.1|1384596_1386951_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	1.2e-65
WP_000271423.1|1386950_1387904_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|1387903_1388113_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|1388100_1389144_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|1389153_1389876_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|1390203_1390566_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|1390562_1391492_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|1391491_1393039_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|1393202_1393562_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|1393552_1394668_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|1394660_1395293_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
>prophage 3
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	2992850	3069046	4882599	holin,portal,lysis,tail,transposase,terminase,head,capsid,integrase,tRNA,protease	Salmonella_phage(36.84%)	86	2984931:2984947	3074892:3074908
2984931:2984947	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|2992850_2993888_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|2994003_2994693_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|2995011_2995395_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|2995456_2996044_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|2996146_2997046_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|2997063_2998398_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|2998528_2999266_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|2999250_3000873_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|3001136_3001301_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|3001297_3001873_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|3001904_3002555_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|3002554_3003511_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|3003507_3003987_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|3004484_3005714_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|3005691_3005976_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|3006016_3006256_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|3006298_3007456_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|3007418_3010346_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_080069573.1|3010472_3010823_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	98.3	3.7e-61
WP_000917562.1|3010844_3011003_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000373338.1|3011401_3011608_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_023224301.1|3011636_3012746_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.2e-118
WP_085341529.1|3012884_3013352_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.1	7.4e-65
WP_000145711.1|3013365_3013593_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|3013558_3013933_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_085341528.1|3014024_3014909_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|3014905_3015601_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|3015614_3016313_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|3016420_3017053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|3017295_3017529_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|3017645_3017894_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|3017928_3018531_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|3018739_3019351_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|3019347_3019488_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|3019484_3020162_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|3020434_3020998_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|3021504_3021693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|3021907_3022594_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|3022869_3023199_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|3023182_3023635_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|3023652_3024105_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|3024339_3024741_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|3025027_3025573_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|3025544_3027476_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|3027459_3027663_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|3027659_3029240_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|3029229_3030726_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|3030738_3031086_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|3031140_3032169_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|3032226_3032586_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|3032596_3032980_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|3033007_3033586_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|3033634_3034765_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|3034873_3035275_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|3035282_3036029_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|3036079_3036475_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|3036471_3036810_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|3036781_3039877_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|3039879_3040209_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000662739.1|3040923_3041661_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|3041558_3042206_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|3042267_3045630_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|3045668_3045911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344380.1|3045964_3048337_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.3	1.1e-90
WP_000593433.1|3048333_3049158_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|3049147_3049726_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|3049822_3050050_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|3050156_3050369_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|3051121_3051241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|3051953_3052091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|3052569_3054063_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|3054467_3056267_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|3056283_3057258_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|3057531_3058212_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|3058208_3059114_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|3059125_3059854_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|3059865_3060597_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|3060596_3060977_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|3061088_3061349_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|3061386_3062313_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|3062428_3063625_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|3063646_3064564_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|3064602_3065451_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361663.1|3066469_3067831_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|3067834_3068470_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|3068494_3069046_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
3074892:3074908	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	3422480	3452072	4882599	protease,tail,holin	Salmonella_phage(41.67%)	31	NA	NA
WP_000781589.1|3422480_3422975_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|3423388_3423880_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|3423869_3424133_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|3424129_3426616_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|3426622_3427318_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|3427304_3428174_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|3428289_3428739_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|3428748_3429351_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888528.1|3429371_3429989_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	3.1e-10
WP_000990028.1|3429985_3430645_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|3430696_3431434_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|3431430_3431643_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_087526174.1|3431639_3432119_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|3432115_3434047_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|3434043_3434601_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|3434597_3435641_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|3435684_3436332_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|3437061_3437625_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|3437816_3438020_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|3438322_3439114_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|3439410_3439614_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001202279.1|3442476_3443466_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|3443480_3443849_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|3443877_3445209_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|3445505_3445835_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|3446427_3447669_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|3447671_3448199_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|3448576_3449020_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|3449073_3450903_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|3451250_3451541_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|3451568_3452072_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	3524124	3533295	4882599	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3524124_3525072_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|3525055_3525787_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3525767_3525875_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3525934_3526666_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|3526888_3528574_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|3528570_3529290_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3529336_3529804_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|3529860_3530391_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3530562_3531021_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3531261_3533295_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	3601601	3612107	4882599		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|3601601_3603005_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|3603182_3604076_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|3604452_3605538_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|3605537_3606437_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|3606484_3607363_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|3607363_3607915_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|3607920_3608913_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|3608909_3609683_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|3609687_3610767_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|3610793_3612107_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	3698099	3748165	4882599	plate,portal,holin,tail,terminase,head,capsid,integrase,protease	Salmonella_phage(86.15%)	69	3692677:3692691	3708807:3708821
3692677:3692691	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|3698099_3698573_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|3699882_3700680_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|3700971_3701961_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|3701962_3702190_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|3702229_3702799_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|3702802_3703384_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|3703394_3703652_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|3703653_3704187_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|3704257_3704797_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|3704933_3705761_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|3705818_3706190_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|3706729_3706954_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|3706916_3707255_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|3707460_3708156_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|3708253_3708478_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|3708506_3709061_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
3708807:3708821	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|3709057_3710215_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|3710211_3710436_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|3710432_3711251_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|3711252_3711735_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|3711734_3712628_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|3712624_3713014_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_020899399.1|3713030_3713891_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_020899400.1|3713898_3714888_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899401.1|3714901_3715654_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|3715804_3716062_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|3716207_3716594_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|3716580_3716862_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|3716861_3717476_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|3717472_3717865_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|3718327_3718660_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|3718710_3719061_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|3719186_3719681_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000088175.1|3719677_3721411_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|3721422_3721605_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_020899404.1|3721604_3722846_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_001193639.1|3722823_3723474_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|3723488_3724694_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|3724744_3724945_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|3724947_3725271_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|3725267_3725672_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_023892996.1|3725643_3726156_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	99.4	1.3e-91
WP_000779216.1|3726152_3726713_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|3726716_3726881_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_001007996.1|3726870_3728367_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000515952.1|3728366_3728723_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_022742746.1|3728752_3729046_+	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000785390.1|3729130_3731059_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000863827.1|3731092_3732433_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_001066630.1|3732429_3733488_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273648.1|3733487_3734021_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|3734025_3734439_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|3734431_3735511_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|3735513_3736101_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_020899405.1|3736087_3737650_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_022742744.1|3737619_3738225_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|3738338_3738572_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|3738646_3738760_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|3738807_3739221_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|3739217_3739430_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|3740623_3740785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|3740911_3741331_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_071953501.1|3741333_3742602_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.7e-226
WP_000208509.1|3743056_3743269_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3743279_3743468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|3743728_3744925_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|3745574_3745874_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|3745965_3746661_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|3746734_3748165_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	3852208	3859017	4882599	integrase,tail	Salmonella_phage(33.33%)	11	3854418:3854440	3864133:3864155
WP_000856224.1|3852208_3852439_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|3852576_3852951_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|3852951_3853827_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|3853843_3854197_+	YebY family protein	NA	NA	NA	NA	NA
3854418:3854440	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|3854570_3855425_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|3855484_3855979_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|3856168_3856399_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|3856452_3856986_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|3857242_3857410_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|3857474_3857663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|3858135_3859017_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
3864133:3864155	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	4643629	4742435	4882599	portal,holin,lysis,tail,protease,tRNA	Salmonella_phage(41.82%)	96	NA	NA
WP_000938191.1|4643629_4644310_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|4644930_4645590_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|4645676_4646006_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|4646002_4646284_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|4646332_4647112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|4647137_4647686_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|4647900_4649112_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|4649169_4649487_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|4649531_4649945_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|4650118_4650781_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|4650875_4651334_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|4651369_4653424_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|4653547_4653994_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|4654012_4656166_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|4656152_4656758_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|4656974_4657484_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|4657840_4658893_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|4658964_4659417_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|4659602_4661363_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|4661431_4661950_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|4662049_4662217_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|4662472_4663036_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|4663032_4664673_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|4664677_4665931_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|4665945_4667853_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|4667865_4669974_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|4670072_4671182_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|4671178_4671721_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|4671886_4672897_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|4673104_4675717_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|4676143_4676335_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000334547.1|4677644_4678271_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|4678918_4679887_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|4680362_4680944_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|4680943_4683382_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|4683435_4683678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170919158.1|4683716_4684592_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000246065.1|4687136_4687841_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|4687738_4688476_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|4688485_4689181_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|4689270_4689804_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_071953433.1|4689920_4690418_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	30.0	8.0e-09
WP_000978296.1|4690516_4690849_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|4690845_4693833_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|4693912_4694242_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|4694238_4694637_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_071953432.1|4694682_4695432_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	1.4e-89
WP_000196702.1|4695443_4695845_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_085341525.1|4695841_4696408_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|4696388_4696688_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|4696680_4697004_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|4697094_4699176_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|4699099_4700647_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|4700643_4700850_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000371784.1|4702942_4703476_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|4703683_4704163_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|4704180_4704633_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|4704616_4704946_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_080090202.1|4705221_4705908_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	7.9e-132
WP_000798705.1|4706268_4706718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|4706853_4706979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|4707152_4707470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|4707536_4708334_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|4708323_4708470_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|4708466_4709078_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|4709286_4709889_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001217665.1|4710303_4710537_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|4710828_4711119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|4711196_4711508_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|4711504_4711852_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|4711862_4712612_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|4712614_4713598_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|4713682_4714057_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|4714022_4714262_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|4714381_4714792_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_078008757.1|4714841_4715102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|4715094_4715253_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_079821108.1|4715274_4715574_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	83.6	2.4e-48
WP_000017133.1|4715700_4718586_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|4718548_4719706_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|4719748_4719988_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|4720028_4720277_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|4720321_4721614_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|4721808_4723011_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_071953431.1|4724768_4725983_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|4726299_4726761_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|4726961_4728362_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|4728968_4730060_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|4730244_4731435_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|4731496_4732144_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|4732171_4732720_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|4732979_4734821_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_085341507.1|4735165_4739632_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|4739631_4740336_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|4740316_4741639_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|4741631_4742435_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP020922	Salmonella enterica subsp. enterica strain 16A242 chromosome, complete genome	4882599	4792497	4801229	4882599	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|4792497_4793752_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|4794215_4794674_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_071953427.1|4794865_4797142_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|4797172_4797493_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|4797816_4798038_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|4798167_4800114_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|4800110_4801229_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP020923	Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence	116677	63699	72995	116677	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_085341514.1|63699_64380_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.8e-28
WP_000369839.1|64761_65118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|65110_65581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|66091_66514_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|66513_67788_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_071953349.1|67869_68844_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
WP_000427676.1|68843_70049_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|70463_71405_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|71436_72003_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|72059_72395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|72578_72995_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
