The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021484	Pediococcus acidilactici strain SRCM100424 chromosome, complete genome	2025714	516700	526185	2025714		Enterococcus_phage(33.33%)	8	NA	NA
WP_065124524.1|516700_518128_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.8	8.5e-11
WP_008841791.1|518138_518714_-	ABC superfamily ATP-binding cassette transporter membrane protein	NA	NA	NA	NA	NA
WP_002831168.1|519163_519904_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	3.1e-17
WP_065124525.1|520426_522577_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	4.7e-255
WP_065124526.1|522587_523175_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.4	1.0e-50
WP_065124527.1|523189_523966_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	3.1e-07
WP_065124528.1|523946_525008_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_065124529.1|525009_526185_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	5.2e-83
>prophage 2
NZ_CP021484	Pediococcus acidilactici strain SRCM100424 chromosome, complete genome	2025714	850624	902113	2025714	tail,terminase,portal,holin,tRNA,plate,capsid	Lactobacillus_phage(56.0%)	66	NA	NA
WP_005916670.1|850624_851362_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005916672.1|851542_852208_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.0	2.7e-20
WP_004165726.1|852191_852947_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_002831503.1|853062_853434_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_065124819.1|853668_854259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831506.1|854556_854883_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	34.3	1.2e-05
WP_065124818.1|854904_855237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831508.1|855633_856083_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_005916684.1|856095_857055_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002831510.1|857081_857318_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_065124817.1|857344_858289_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_065124816.1|858373_859102_+	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	28.2	1.7e-07
WP_065124815.1|859117_860344_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_065124814.1|860348_860774_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_002831515.1|860785_861196_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002831516.1|861212_862580_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_008842117.1|862569_863394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831518.1|863410_864178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124813.1|864194_864953_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_065124812.1|866353_867160_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_081276413.1|867161_867986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081276412.1|868027_869224_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	39.1	4.6e-18
WP_065124811.1|869296_869704_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_008840853.1|869715_870078_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.2e-15
WP_065124810.1|870220_870451_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008840855.1|870447_870585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124809.1|870587_870812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124808.1|870878_871094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124825.1|871196_871643_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065124807.1|871643_871925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157420393.1|871926_872070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124806.1|872162_873056_+	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	31.1	2.9e-25
WP_065124805.1|873058_873895_+	hypothetical protein	NA	Q9G0C9	Lactococcus_phage	42.7	1.2e-12
WP_065124804.1|873887_874721_+	helix-turn-helix domain-containing protein	NA	A0A097BYA5	Leuconostoc_phage	53.5	2.9e-43
WP_021361655.1|874725_875448_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	67.0	4.1e-86
WP_065124803.1|875392_875800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124802.1|875802_876249_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	62.5	2.8e-37
WP_065124801.1|876259_876607_+	DUF1642 domain-containing protein	NA	NA	NA	NA	NA
WP_065124800.1|876603_876828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153903504.1|876847_877006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124799.1|877345_877777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124798.1|878389_879058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032540563.1|879126_879813_+|terminase	terminase	terminase	V5URT8	Oenococcus_phage	42.5	2.5e-16
WP_021361666.1|879796_881110_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	60.5	3.3e-150
WP_050585101.1|881121_882651_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	54.2	2.3e-147
WP_081276410.1|882647_883781_+	hypothetical protein	NA	U3PFU0	Lactobacillus_phage	30.6	6.9e-40
WP_021361667.1|883880_884453_+	phage minor structural GP20 family protein	NA	Q9T1B8	Listeria_phage	39.0	3.5e-24
WP_065124797.1|884465_885335_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	66.8	8.6e-107
WP_065124796.1|885405_885822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124795.1|885818_886169_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	57.1	3.9e-26
WP_065124794.1|886168_886513_+	hypothetical protein	NA	O03933	Lactobacillus_phage	43.2	1.4e-15
WP_065124793.1|886512_886908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124791.1|887536_888004_+	Ig domain-containing protein	NA	A0A220BZ11	Staphylococcus_phage	48.4	3.0e-21
WP_065124790.1|888079_888472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124789.1|888481_889102_+	hypothetical protein	NA	O03936	Lactobacillus_phage	41.6	7.1e-31
WP_065124788.1|889135_894253_+	tape measure protein	NA	O03937	Lactobacillus_phage	29.4	7.5e-25
WP_065124787.1|894254_895079_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	25.9	3.0e-16
WP_065124786.1|895090_896206_+	hypothetical protein	NA	O03938	Lactobacillus_phage	42.1	2.2e-78
WP_065124785.1|896198_896429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124784.1|896409_896820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124783.1|896809_897847_+|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	35.5	6.8e-18
WP_065124782.1|897859_898681_+	collagen-like protein	NA	NA	NA	NA	NA
WP_065124781.1|898696_900187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124780.1|900244_900508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124779.1|900507_900762_+|holin	holin	holin	NA	NA	NA	NA
WP_065124778.1|900745_902113_+	1,4-beta-N-acetylmuramidase	NA	A0A1X9IGI4	Lactococcus_phage	60.5	2.7e-78
>prophage 3
NZ_CP021484	Pediococcus acidilactici strain SRCM100424 chromosome, complete genome	2025714	1058378	1066941	2025714		Synechococcus_phage(33.33%)	9	NA	NA
WP_008840996.1|1058378_1058960_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	8.8e-23
WP_008840997.1|1058959_1060006_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	38.7	2.7e-54
WP_065124110.1|1060008_1061478_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	3.6e-57
WP_065124111.1|1061462_1063667_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	1.1e-145
WP_065124112.1|1063684_1064359_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_065124113.1|1064355_1064616_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_065124114.1|1064602_1065337_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	4.8e-42
WP_138492686.1|1065314_1066478_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_065124116.1|1066458_1066941_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	7.0e-18
>prophage 4
NZ_CP021484	Pediococcus acidilactici strain SRCM100424 chromosome, complete genome	2025714	1107424	1114746	2025714	tRNA	Staphylococcus_phage(28.57%)	7	NA	NA
WP_008841054.1|1107424_1108270_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
WP_008841056.1|1108666_1109149_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	39.1	3.6e-22
WP_005917050.1|1109166_1110117_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.0e-113
WP_008841057.1|1110121_1112017_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.9e-50
WP_065124147.1|1112019_1113228_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.5	2.9e-44
WP_008841059.1|1113343_1114213_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.8	1.2e-55
WP_065124148.1|1114275_1114746_-	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
>prophage 5
NZ_CP021484	Pediococcus acidilactici strain SRCM100424 chromosome, complete genome	2025714	1181040	1241239	2025714	transposase,tail,terminase,portal,head,holin,integrase,protease,capsid	Lactobacillus_phage(71.79%)	79	1198811:1198841	1241371:1241401
WP_144235580.1|1181040_1182324_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	1.6e-45
WP_065124177.1|1182374_1183133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124178.1|1183230_1183755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124179.1|1183899_1184568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124180.1|1184568_1185087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124181.1|1185052_1186315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124182.1|1186691_1187186_-	hypothetical protein	NA	A0A097BY45	Enterococcus_phage	34.8	6.5e-19
WP_065124183.1|1187230_1187437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124184.1|1187439_1187718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124185.1|1187714_1187900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157420395.1|1187884_1188046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124186.1|1188196_1188421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124188.1|1188625_1188895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124190.1|1189074_1190010_-	DnaD domain protein	NA	Q9AZA0	Lactobacillus_prophage	49.5	2.8e-39
WP_065124191.1|1190026_1190488_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	66.2	1.7e-37
WP_065124192.1|1190631_1191444_+	DUF4393 domain-containing protein	NA	A0A0N7GFI3	Staphylococcus_phage	24.3	3.8e-08
WP_065124193.1|1191423_1191669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124194.1|1191722_1192061_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_065124195.1|1193023_1193521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124196.1|1193483_1193690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124197.1|1193697_1194147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124198.1|1194143_1194377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124199.1|1194646_1195027_+	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	39.3	2.8e-14
WP_157420397.1|1195039_1195177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157420399.1|1195208_1195457_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065124200.1|1195512_1196049_+	hypothetical protein	NA	Q38183	Lactococcus_phage	47.6	1.4e-35
WP_065124201.1|1196210_1196765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124202.1|1196905_1197214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124203.1|1197358_1198507_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.2	4.8e-89
1198811:1198841	attL	AGGTACTAATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
WP_024862287.1|1199918_1200161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024862286.1|1200278_1200638_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	5.4e-15
WP_002830385.1|1200653_1200917_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	82.8	8.8e-31
WP_036672440.1|1200916_1202047_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.4	2.4e-45
WP_002830387.1|1202091_1202451_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	78.2	1.1e-44
WP_002830389.1|1202465_1202714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830391.1|1202755_1202965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830394.1|1202957_1203185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830396.1|1206311_1208696_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	89.9	0.0e+00
WP_002830397.1|1208760_1210530_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	89.3	0.0e+00
WP_065124204.1|1210606_1215457_-	transglycosylase SLT domain-containing protein	NA	A0A2P0ZLG0	Lactobacillus_phage	51.8	9.8e-293
WP_002831798.1|1215486_1215672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002831799.1|1215716_1216091_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	96.0	3.2e-58
WP_002831800.1|1216167_1216857_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.2	1.0e-107
WP_065124205.1|1216870_1217251_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	4.1e-61
WP_002831803.1|1217250_1217658_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	87.9	3.9e-62
WP_002831805.1|1217660_1218008_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	67.0	1.8e-39
WP_002831807.1|1217997_1218330_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.2	1.0e-44
WP_002831808.1|1218402_1219635_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	92.9	4.1e-211
WP_065124206.1|1219634_1220378_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	95.1	9.2e-126
WP_065124207.1|1220355_1221519_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	93.2	1.4e-208
WP_065124208.1|1221521_1221716_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	6.3e-26
WP_065124209.1|1221705_1223604_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.5	0.0e+00
WP_065124210.1|1223606_1224056_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.3	3.0e-79
WP_081276383.1|1224260_1224728_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	1.8e-82
WP_065124212.1|1225234_1225678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036672512.1|1225878_1226067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124213.1|1226253_1226502_-	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	59.5	3.7e-23
WP_036672515.1|1226888_1227134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058121180.1|1227134_1227428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830736.1|1227594_1227966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609172.1|1228144_1228780_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_065124215.1|1228779_1229007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124216.1|1229006_1229438_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	55.6	1.5e-40
WP_065124217.1|1229434_1229851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124218.1|1229850_1231083_-	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	36.6	7.7e-61
WP_065124219.1|1231072_1231867_-	hypothetical protein	NA	A0A0A0RQ10	Bacillus_phage	53.4	1.0e-34
WP_065124220.1|1231887_1232415_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	48.5	1.1e-29
WP_065124221.1|1232414_1233170_-	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	55.3	4.4e-67
WP_081276381.1|1233170_1233626_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_065124223.1|1233852_1234470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124224.1|1234739_1235069_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002830432.1|1235082_1235805_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	51.1	2.2e-55
WP_065124225.1|1235818_1236028_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065124226.1|1236283_1236625_+	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	38.1	2.3e-15
WP_036672412.1|1236633_1237041_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.1	6.8e-14
WP_002830434.1|1237103_1238231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036672414.1|1238377_1238575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002830435.1|1238981_1239983_+	Abi family protein	NA	M1PS09	Streptococcus_phage	35.7	1.2e-48
WP_002830436.1|1240123_1241239_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	51.9	2.2e-99
1241371:1241401	attR	AGGTACTAATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
