The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	591037	639948	4070574	terminase,portal,protease,tail,tRNA,integrase,head	Bacillus_phage(30.23%)	70	599624:599643	643693:643712
WP_013351180.1|591037_592078_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	1.2e-62
WP_065118608.1|592302_594231_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	2.7e-60
WP_003155986.1|594370_594883_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013351182.1|594879_595527_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|595545_595716_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_088030482.1|595722_596484_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|596522_596714_-	YdiK family protein	NA	NA	NA	NA	NA
WP_013351184.1|596710_597445_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013351185.1|597681_597966_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
WP_013351186.1|598007_599642_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
599624:599643	attL	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
WP_013351187.1|599720_600932_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	41.8	4.0e-78
WP_041481597.1|600943_601417_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013351188.1|601608_601956_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.1	5.1e-18
WP_013351189.1|601969_602491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351190.1|602758_603139_-	helix-turn-helix domain-containing protein	NA	A8ATJ9	Listeria_phage	41.2	7.8e-12
WP_041481598.1|603308_603551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041481599.1|603563_603878_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.5	1.6e-15
WP_013351191.1|603874_604645_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.0	1.9e-73
WP_003155916.1|604754_605327_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_013351192.1|605323_605581_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	3.5e-08
WP_013351193.1|605577_605775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351194.1|605876_606062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471495.1|606061_607012_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.0	2.8e-135
WP_013351197.1|607014_607854_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.9	1.8e-122
WP_013351198.1|608018_608735_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.5	2.1e-42
WP_127721204.1|608643_609591_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	4.0e-57
WP_013351201.1|609876_610329_+	hypothetical protein	NA	A0A059T7V5	Listeria_phage	33.6	5.4e-12
WP_013351202.1|610315_610774_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	6.0e-59
WP_003155894.1|611127_611331_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_013351204.1|611362_611704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351205.1|611700_611955_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
WP_013351206.1|611959_613336_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	1.2e-142
WP_013351207.1|613347_613671_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
WP_013351208.1|613667_614267_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	38.5	6.0e-27
WP_013351209.1|614266_614629_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	65.9	1.3e-05
WP_013351210.1|614625_614901_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	5.2e-18
WP_013351211.1|614897_615311_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	53.4	1.5e-32
WP_041481602.1|615307_615862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351213.1|615854_616235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351214.1|616231_616423_+	hypothetical protein	NA	A0A217ERD8	Bacillus_phage	67.2	4.6e-13
WP_013351215.1|616468_616687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481603.1|616692_617127_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_157670098.1|617275_617650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044051884.1|617681_618269_+	VanZ family protein	NA	NA	NA	NA	NA
WP_013351217.1|618533_619049_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.8	4.0e-27
WP_013351218.1|619389_619581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|619588_619801_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_041481605.1|619934_620123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351219.1|620258_620489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351220.1|620533_621289_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	62.0	3.4e-51
WP_013351221.1|621275_622550_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	72.3	6.5e-180
WP_013351222.1|622571_624023_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.4	1.3e-128
WP_013351223.1|624009_624933_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	1.0e-81
WP_013351224.1|624936_625206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351225.1|625359_626025_+	scaffold protein	NA	I1TLE1	Bacillus_phage	49.3	4.5e-23
WP_013351226.1|626037_627024_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	2.7e-48
WP_076983707.1|627001_627286_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	65.4	3.3e-23
WP_013351227.1|627286_627478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351228.1|627482_627779_+	hypothetical protein	NA	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
WP_013351229.1|627775_628114_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014471518.1|628106_628523_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_013351231.1|628541_628940_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	2.4e-24
WP_013351232.1|628953_629466_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013351233.1|629407_629722_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	79.0	5.4e-27
WP_076983168.1|629735_629978_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_003155845.1|630034_630541_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
WP_041481705.1|630588_630897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351235.1|630901_635977_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	27.2	1.2e-35
WP_013351236.1|635973_636738_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013351237.1|636750_639948_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	45.9	6.3e-131
643693:643712	attR	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
>prophage 2
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	684926	694822	4070574		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|684926_686219_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_013351277.1|686299_687019_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.3e-47
WP_013351278.1|687018_687273_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	37.0	4.2e-06
WP_013351279.1|687269_687953_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013351280.1|687936_690165_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	7.7e-160
WP_088030483.1|690140_691571_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	3.7e-54
WP_013351282.1|691662_692703_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
WP_013351283.1|692699_693287_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	7.7e-27
WP_013351284.1|693283_694822_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.4	1.5e-77
>prophage 3
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	886492	948780	4070574	terminase,portal,protease,holin,capsid,plate,tail,integrase,head	Bacillus_phage(41.18%)	68	912443:912463	950857:950877
WP_013351438.1|886492_887407_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003155495.1|887543_887696_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_013351439.1|887819_888089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351440.1|888220_888748_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_061573694.1|888833_889169_+	SdpI family protein	NA	NA	NA	NA	NA
WP_013351445.1|890110_891091_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.7	1.5e-59
WP_013351446.1|891127_893713_+	YfhO family protein	NA	NA	NA	NA	NA
WP_013351447.1|893709_894693_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_013351494.1|894918_896016_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_013351495.1|896022_896247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351496.1|896329_897082_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_013351497.1|897149_897320_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003155476.1|897480_897747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155475.1|897882_898413_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013351498.1|898494_900237_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	9.6e-49
WP_013351499.1|900313_901378_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_013351500.1|901587_902877_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013351501.1|903033_903507_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013351502.1|903631_904069_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_013351503.1|904103_904457_-	YgzB family protein	NA	NA	NA	NA	NA
WP_013351504.1|904659_905544_+	hypothetical protein	NA	NA	NA	NA	NA
912443:912463	attL	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
WP_061573984.1|912598_913714_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	59.5	1.3e-120
WP_061573985.1|913946_915047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061573986.1|915474_915873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061573987.1|916036_916243_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017417255.1|916299_916623_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
WP_061573988.1|916851_917724_+	replication protein	NA	V5UQV4	Oenococcus_phage	45.2	6.5e-46
WP_061574028.1|917707_918541_+	DNA replication protein	NA	Q2I8C8	Bacillus_phage	34.4	2.7e-33
WP_061573989.1|918856_919405_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_015387918.1|919512_919653_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_061573990.1|919900_920104_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.7	5.2e-15
WP_013351204.1|920135_920477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387922.1|920473_920875_+	hypothetical protein	NA	X2JNJ3	Bacillus_phage	45.6	1.3e-28
WP_061573991.1|920887_921145_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.0	6.2e-05
WP_088030489.1|921149_922526_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.1	9.0e-143
WP_061573993.1|922537_922861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417267.1|922857_923541_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	4.8e-36
WP_061573994.1|923540_923933_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	63.4	2.5e-05
WP_157670100.1|923992_924307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061573996.1|924303_924492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417278.1|924794_925247_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_038458303.1|925243_925786_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_061573997.1|926273_926486_+	hypothetical protein	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	6.7e-05
WP_061573998.1|926680_926968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061573999.1|927096_927336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073982117.1|927338_927647_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	58.3	1.5e-29
WP_061574000.1|927752_928124_+	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	53.6	9.5e-23
WP_061574001.1|928120_929812_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.8	8.8e-249
WP_088030490.1|929830_931090_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	59.8	2.6e-120
WP_081111169.1|930980_931715_+|protease	Clp protease ClpP	protease	A0A0A8WFM9	Clostridium_phage	57.9	5.6e-67
WP_061574002.1|931737_932991_+|capsid	phage major capsid protein	capsid	R9TQG7	Paenibacillus_phage	48.0	1.7e-84
WP_061574003.1|933017_933233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061574004.1|933229_933505_+	DNA-packaging protein	NA	A0A290FZN8	Caldibacillus_phage	45.2	2.9e-16
WP_061574005.1|933497_933800_+|head	phage head closure protein	head	A0A0S2SXM4	Bacillus_phage	38.5	9.8e-10
WP_064504609.1|933804_934134_+	hypothetical protein	NA	E3W8G0	Leuconostoc_phage	34.9	6.9e-09
WP_061574007.1|934133_934544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061574008.1|934564_935188_+	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	31.2	1.5e-12
WP_061574009.1|935187_935559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157670102.1|935615_935762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061574010.1|935774_940010_+	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	31.3	6.8e-64
WP_061574011.1|940017_940848_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_061574012.1|940860_942747_+	autolysin	NA	M5AC19	Bacillus_phage	35.8	3.8e-35
WP_061574013.1|942751_945328_+	peptidase G2	NA	D6R401	Bacillus_phage	51.3	6.4e-243
WP_061574014.1|945341_946574_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.7	1.5e-144
WP_061574015.1|946570_946954_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	55.8	2.0e-28
WP_017417296.1|946955_947111_+	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	53.5	7.5e-06
WP_015239640.1|947146_947569_+|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_017417297.1|947616_948780_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	6.6e-70
950857:950877	attR	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
>prophage 4
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1199792	1246251	4070574	integrase,tRNA,coat	Bacillus_phage(33.33%)	53	1232171:1232185	1249433:1249447
WP_012117281.1|1199792_1200785_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|1201529_1203164_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|1203270_1204206_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351826.1|1204209_1205127_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1205139_1206216_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014470613.1|1206208_1207126_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_013351829.1|1207233_1208421_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1208538_1209117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1209294_1209690_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1209747_1210404_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1210679_1211336_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1211487_1212648_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1212876_1214706_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_013351835.1|1215193_1216096_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013351836.1|1216092_1216491_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1216715_1217402_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1217406_1217979_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1218103_1218469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1218496_1219132_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1219149_1219950_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1219964_1220858_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_013351843.1|1220891_1221641_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
WP_014470611.1|1221866_1223711_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_013351845.1|1223959_1224670_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1224644_1225262_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1225245_1226355_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1226351_1226555_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1226551_1227322_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1227318_1228329_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1228351_1229164_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1229294_1230071_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_013351852.1|1230168_1230756_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1230813_1231257_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|1231405_1231888_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1232037_1232538_-|coat	spore coat protein	coat	NA	NA	NA	NA
1232171:1232185	attL	ATTTGTTTGTTAGCT	NA	NA	NA	NA
WP_013351856.1|1232630_1232945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470608.1|1232982_1233369_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351858.1|1233539_1233896_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_013351859.1|1234184_1234382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610678.1|1234473_1234635_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013351860.1|1234801_1235056_+	sporulation protein	NA	NA	NA	NA	NA
WP_013351861.1|1235123_1237409_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	32.9	3.2e-84
WP_013351862.1|1237529_1237784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351863.1|1237849_1238602_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013351864.1|1238638_1239361_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351865.1|1239353_1240091_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	6.7e-28
WP_013351866.1|1240091_1240325_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013351867.1|1240482_1240914_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351868.1|1240918_1241434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351869.1|1241459_1242182_-	esterase family protein	NA	NA	NA	NA	NA
WP_014470603.1|1242551_1243673_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013351871.1|1243665_1244841_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_017417527.1|1245120_1246251_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	36.8	4.5e-55
1249433:1249447	attR	AGCTAACAAACAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1252320	1274406	4070574	tail,transposase,portal	Bacillus_phage(61.54%)	18	NA	NA
WP_025649596.1|1252320_1255224_+	hypothetical protein	NA	O64076	Bacillus_phage	46.9	3.2e-222
WP_014417453.1|1255551_1255770_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_017417539.1|1256357_1256834_+	hypothetical protein	NA	O64060	Bacillus_phage	45.5	1.7e-32
WP_017417540.1|1256833_1257547_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	7.4e-48
WP_017417541.1|1257570_1258356_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	49.0	5.0e-37
WP_017417542.1|1258364_1258952_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	1.3e-37
WP_014417458.1|1258951_1259179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417459.1|1259213_1259687_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	6.5e-24
WP_014721012.1|1260279_1260492_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
WP_014417460.1|1260575_1260983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014417461.1|1260999_1261563_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
WP_014417462.1|1261915_1263673_+	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.5	3.5e-147
WP_014417463.1|1263687_1265022_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
WP_014417464.1|1265129_1265729_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
WP_014417465.1|1265757_1266576_+	hypothetical protein	NA	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
WP_025649600.1|1266783_1267101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025649601.1|1267111_1267450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030495.1|1267527_1274406_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	55.0	0.0e+00
>prophage 6
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1294926	1297932	4070574		Bacillus_phage(100.0%)	6	NA	NA
WP_013351882.1|1294926_1295085_-	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
WP_013351883.1|1295244_1295574_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351884.1|1295566_1295959_+	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351885.1|1296608_1296884_-	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_014470521.1|1297334_1297544_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351886.1|1297557_1297932_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
>prophage 7
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1333281	1368446	4070574	terminase,portal,holin,plate,tail	Bacillus_phage(32.26%)	44	NA	NA
WP_013351926.1|1333281_1334634_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	6.0e-14
WP_014470507.1|1335060_1335252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1335419_1336184_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1336327_1336795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030497.1|1336999_1338136_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_003154881.1|1338125_1338260_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1338403_1339357_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1339394_1339772_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1339881_1340484_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1340626_1341217_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1341364_1341703_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1341893_1342073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1342062_1342890_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_013351937.1|1342789_1343590_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.3	2.3e-58
WP_013351938.1|1343854_1344196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1344185_1344389_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1344501_1345011_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_013351941.1|1345125_1345923_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.2e-59
WP_013351942.1|1345919_1347218_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1347266_1348658_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1348677_1349520_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1349546_1350482_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_013351946.1|1350877_1351234_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1351230_1351734_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351948.1|1351730_1352177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351949.1|1352173_1352383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1352382_1353780_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1353781_1354225_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1354299_1354746_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1354787_1354940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030498.1|1354927_1360132_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	9.0e-42
WP_013351953.1|1360124_1360784_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1360797_1361775_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1361774_1362041_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_041481725.1|1362190_1362616_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	34.1	5.6e-11
WP_013351957.1|1362608_1363649_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	9.4e-68
WP_013351958.1|1363632_1364211_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	2.4e-12
WP_013351959.1|1364207_1364480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065118566.1|1364482_1366447_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.5	5.0e-54
WP_013351961.1|1366459_1366858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351962.1|1366844_1367042_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	1.5e-14
WP_013351963.1|1367090_1367852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1367905_1368169_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_013351965.1|1368182_1368446_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	5.2e-23
>prophage 8
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1865167	1942997	4070574	terminase,portal,protease,holin,capsid,plate,transposase,tail,tRNA,integrase,head	Bacillus_phage(43.9%)	72	1860901:1860915	1888143:1888157
1860901:1860915	attL	TTTGTTTAATACCTT	NA	NA	NA	NA
WP_013352351.1|1865167_1866112_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003154064.1|1866151_1866373_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_013352352.1|1866470_1866746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352353.1|1866828_1867044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352354.1|1867303_1867696_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.0	1.7e-30
WP_013352355.1|1867655_1869758_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.5	0.0e+00
WP_013352356.1|1869775_1870765_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	5.1e-156
WP_013352357.1|1870813_1871434_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.7e-46
WP_080565288.1|1872273_1872513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462785.1|1872545_1873514_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_013352360.1|1873643_1874906_+	GTPase HflX	NA	NA	NA	NA	NA
WP_013352361.1|1874922_1876188_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013352362.1|1876297_1876699_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013352363.1|1876756_1878091_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	23.8	1.8e-07
WP_088030681.1|1878203_1879361_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	37.9	3.5e-63
WP_088030682.1|1879397_1880465_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_088030510.1|1880445_1880838_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	47.6	4.7e-12
WP_088030511.1|1880967_1881186_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	62.0	3.2e-18
WP_088030512.1|1881300_1882065_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	50.9	3.1e-52
WP_088030513.1|1882079_1882382_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_088030683.1|1882454_1882643_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	65.2	2.0e-08
WP_088030515.1|1883201_1883597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030516.1|1883593_1884772_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.1	1.5e-133
WP_013353517.1|1884802_1885372_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-76
WP_013353516.1|1885430_1885979_+	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.8e-23
WP_088030517.1|1885975_1887922_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	66.9	8.3e-251
WP_014472243.1|1888037_1888802_+	DNA methylase	NA	A0A0K2CYZ1	Paenibacillus_phage	52.6	5.6e-70
1888143:1888157	attR	AAGGTATTAAACAAA	NA	NA	NA	NA
WP_041915585.1|1888877_1889081_+	hypothetical protein	NA	O64114	Bacillus_phage	77.1	5.2e-15
WP_041915584.1|1889104_1891516_+	phage-like protein	NA	A0A0A7RTG3	Clostridium_phage	56.5	2.6e-278
WP_032864196.1|1891822_1892137_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.6	2.4e-19
WP_041915583.1|1892096_1893452_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.3	1.4e-180
WP_013353512.1|1893448_1893829_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
WP_014472238.1|1894913_1895408_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
WP_014472237.1|1895400_1897107_+|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.4	2.4e-121
WP_071181973.1|1897123_1897330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030518.1|1897334_1898561_+|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.2	3.2e-67
WP_047936177.1|1898553_1899150_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.6	4.7e-48
WP_088030519.1|1899198_1900398_+|capsid	phage major capsid protein	capsid	H9A115	Staphylococcus_phage	49.5	4.1e-75
WP_088030520.1|1900425_1900893_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	60.1	1.4e-10
WP_014472232.1|1900944_1901238_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_088030521.1|1901227_1901554_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_088030522.1|1901553_1901943_+	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	36.7	2.6e-10
WP_014472229.1|1901939_1902332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472228.1|1902351_1902930_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.9	7.4e-30
WP_014472227.1|1902987_1903350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472226.1|1903361_1903544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030523.1|1903604_1907351_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	52.0	1.7e-106
WP_088030524.1|1907351_1908188_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	1.0e-109
WP_088030525.1|1908200_1909919_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.6	2.2e-223
WP_088030526.1|1909951_1912516_+	peptidase G2	NA	D6R401	Bacillus_phage	57.7	1.1e-290
WP_088030527.1|1912528_1913665_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	73.9	4.8e-142
WP_088030528.1|1913661_1914024_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.0	1.2e-54
WP_013353491.1|1914020_1914209_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_015239640.1|1914258_1914681_+|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_088030529.1|1914726_1915698_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	63.8	8.5e-63
WP_088030530.1|1915713_1916799_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_014470376.1|1918125_1918560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470374.1|1919566_1920175_+	histidine kinase	NA	NA	NA	NA	NA
WP_014470371.1|1920706_1921348_+	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_014470370.1|1921451_1922687_+	cytochrome P450	NA	NA	NA	NA	NA
WP_014471853.1|1922863_1923031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470369.1|1923330_1924722_+	MFS transporter	NA	NA	NA	NA	NA
WP_014470368.1|1924763_1926365_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014470366.1|1927949_1929287_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014471855.1|1929438_1930938_+	xylulokinase	NA	NA	NA	NA	NA
WP_014470364.1|1931168_1931867_+	glycoside hydrolase family 11 protein	NA	NA	NA	NA	NA
WP_014470362.1|1935143_1935680_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013352381.1|1935863_1936886_+	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_038462791.1|1937655_1937778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065118553.1|1937774_1938890_-	aspartate phosphatase	NA	D6R410	Bacillus_phage	47.3	3.1e-93
WP_014470361.1|1939402_1939501_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000684982.1|1940030_1942997_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.7	7.5e-211
>prophage 9
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	1962837	1973234	4070574		Bacillus_phage(71.43%)	12	NA	NA
WP_013352403.1|1962837_1963458_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
WP_016935991.1|1963619_1963709_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352404.1|1964125_1964662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065118515.1|1965317_1967735_-	peptidase G2	NA	D6R401	Bacillus_phage	49.9	3.2e-220
WP_013352407.1|1968022_1968262_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352408.1|1968432_1968867_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352409.1|1968917_1969103_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352410.1|1969308_1970130_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352412.1|1970372_1971203_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352413.1|1971230_1971680_-	YndM family protein	NA	NA	NA	NA	NA
WP_013352414.1|1971836_1972265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611720.1|1972613_1973234_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 10
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	2332212	2338465	4070574		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352726.1|2332212_2332806_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2332795_2333551_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2333758_2333848_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352728.1|2333935_2334457_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013352729.1|2334522_2334897_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2335013_2335478_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2335510_2336707_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_014470033.1|2336721_2337369_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2337349_2338465_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 11
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	2583548	2689171	4070574	terminase,portal,protease,holin,capsid,plate,tail,tRNA,integrase,head	Bacillus_phage(35.56%)	110	2623869:2623906	2660811:2660848
WP_088030689.1|2583548_2583818_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_080565289.1|2584263_2584371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352973.1|2584374_2585226_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.1	2.6e-55
WP_013352974.1|2585396_2585840_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088030542.1|2586946_2587789_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_013352982.1|2589245_2589782_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041481659.1|2589941_2590160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352984.1|2590258_2591635_-	Tet(L)/Tet(K)/Tet(45) family tetracycline efflux MFS transporter	NA	NA	NA	NA	NA
WP_124984736.1|2591668_2591806_-	tetracycline resistance efflux system leader peptide	NA	NA	NA	NA	NA
WP_013352985.1|2591843_2592365_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	50.6	8.6e-46
WP_013352986.1|2592506_2593007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352987.1|2593202_2593487_-	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
WP_013352988.1|2593727_2594531_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013352991.1|2595612_2596338_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013352992.1|2596423_2597371_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_013352993.1|2597385_2599344_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_013352994.1|2599496_2601449_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_013352995.1|2601678_2602596_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013352996.1|2602642_2603125_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003152795.1|2603192_2604077_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013352997.1|2604201_2605410_+	MFS transporter	NA	NA	NA	NA	NA
WP_013352998.1|2605559_2608721_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	36.7	4.6e-73
WP_003152789.1|2608748_2609315_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013352999.1|2609524_2610064_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152787.1|2610565_2610706_-	YrzI family small protein	NA	NA	NA	NA	NA
WP_013353001.1|2611095_2611896_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003152783.1|2612160_2612529_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_088030690.1|2612835_2615778_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003152780.1|2615795_2616287_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_013353003.1|2616325_2616556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152778.1|2616639_2617782_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	2.8e-20
WP_013353004.1|2617783_2618707_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	6.4e-60
WP_003152774.1|2618751_2619447_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_013353005.1|2619467_2620109_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003152771.1|2620292_2620496_+	DUF2536 family protein	NA	NA	NA	NA	NA
WP_013353007.1|2620535_2621252_-	YrrS family protein	NA	NA	NA	NA	NA
WP_013353008.1|2621315_2623070_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003152766.1|2623122_2623596_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
2623869:2623906	attL	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
WP_088030543.1|2625204_2626026_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	72.1	4.5e-65
WP_088030544.1|2626073_2626496_-|holin	holin	holin	D6R405	Bacillus_phage	88.6	9.4e-59
WP_013353491.1|2626546_2626735_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_088030545.1|2626731_2627094_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	88.3	1.0e-53
WP_088030546.1|2627090_2628272_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	73.9	3.4e-146
WP_088030547.1|2628284_2630849_-	peptidase G2	NA	D6R401	Bacillus_phage	57.6	1.4e-290
WP_088030548.1|2630881_2632600_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.8	1.1e-222
WP_088030524.1|2632612_2633449_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	1.0e-109
WP_088030549.1|2633449_2637196_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	63.8	1.3e-106
WP_061861531.1|2637256_2637439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030550.1|2637450_2637813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030551.1|2637870_2638449_-|tail	major tail protein	tail	J7KKC8	Streptococcus_phage	39.3	2.1e-29
WP_088030552.1|2638467_2638857_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_088030553.1|2638853_2639243_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	35.0	2.2e-09
WP_013353503.1|2639242_2639569_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|2639558_2639852_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_088030554.1|2639903_2640371_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	60.6	2.1e-11
WP_088030555.1|2640398_2641598_-|capsid	phage major capsid protein	capsid	H9A115	Staphylococcus_phage	49.8	1.1e-75
WP_017418258.1|2641646_2642243_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.6	4.7e-48
WP_088030556.1|2642235_2643462_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	2.7e-66
WP_071181973.1|2643466_2643673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472237.1|2643689_2645396_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.4	2.4e-121
WP_014472238.1|2645388_2645883_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
WP_088030557.1|2646651_2646939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030558.1|2647132_2647345_-	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	42.4	3.9e-05
WP_038458303.1|2647832_2648375_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_017417278.1|2648371_2648824_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_061573996.1|2649126_2649315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157670100.1|2649311_2649626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061573994.1|2649685_2650078_-	hypothetical protein	NA	H6WU17	Pseudomonas_phage	63.4	2.5e-05
WP_017417267.1|2650077_2650761_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	4.8e-36
WP_088030559.1|2650757_2651081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471503.1|2651092_2652469_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	4.5e-142
WP_015387923.1|2652473_2652731_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_024085436.1|2653395_2653599_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_014721586.1|2653846_2653987_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_088030560.1|2654095_2654644_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_088030692.1|2654959_2655790_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	2.4e-34
WP_088030561.1|2655773_2656652_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.2e-60
WP_041481795.1|2656665_2656983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157670113.1|2657024_2657216_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088030563.1|2657423_2657813_+	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	28.4	2.0e-07
WP_088030564.1|2658168_2659266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030565.1|2659570_2660731_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.3	2.9e-65
WP_088030566.1|2660794_2661427_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	3.2e-34
2660811:2660848	attR	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
WP_003152759.1|2661433_2662702_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
WP_003152757.1|2662719_2663649_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_013353009.1|2663655_2664309_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_013353010.1|2664460_2665552_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003152751.1|2665662_2665944_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003152750.1|2665956_2666373_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_012118070.1|2666381_2666648_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_013353011.1|2666732_2669369_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
WP_013353012.1|2669700_2670762_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013353013.1|2670977_2671706_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.1e-35
WP_013353014.1|2671726_2672554_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061573720.1|2672611_2673262_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013353016.1|2673280_2673937_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003152741.1|2673970_2674102_-	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
WP_003152738.1|2674123_2674315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481661.1|2674327_2674786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353018.1|2674896_2677275_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.5	3.8e-80
WP_088030693.1|2677293_2677914_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013353020.1|2678001_2679117_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013353021.1|2679153_2680293_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_013353022.1|2680311_2680728_-	cysteine metabolism transcriptional regulator CymR	NA	NA	NA	NA	NA
WP_013353023.1|2680922_2682191_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.7	2.6e-112
WP_013353024.1|2682308_2683073_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.5	7.0e-20
WP_013353025.1|2683399_2685178_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	28.4	2.5e-12
WP_013353026.1|2685192_2686467_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013353028.1|2687147_2688701_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.6e-13
WP_013353029.1|2688727_2689171_-|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	2972856	3035893	4070574	terminase,portal,protease,holin,capsid,plate,tail,head	Bacillus_phage(53.85%)	60	NA	NA
WP_014470850.1|2972856_2973261_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2973396_2973834_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2973958_2974108_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2974104_2974548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353278.1|2974664_2975138_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2975263_2975491_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2975487_2976057_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2976183_2976432_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2976628_2977960_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2977982_2979023_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2979080_2979239_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2979411_2980527_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_013353286.1|2980523_2981987_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	2.4e-77
WP_013353287.1|2982074_2982893_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2982951_2983776_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_013353289.1|2983763_2985500_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2985496_2986909_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2987192_2987912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353292.1|2988055_2988526_+	membrane protein	NA	NA	NA	NA	NA
WP_014470856.1|2995873_2996455_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2996486_2998016_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2998035_2998566_-	membrane protein	NA	NA	NA	NA	NA
WP_013353296.1|2998712_2999201_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2999202_2999784_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2999854_3001063_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|3001080_3002553_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|3002753_3003314_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|3003480_3004020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353302.1|3004183_3004852_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|3004875_3005721_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|3005860_3007036_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|3007952_3008276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|3008968_3010099_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|3010486_3010690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030572.1|3010992_3011784_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.0	4.4e-17
WP_013351586.1|3011920_3012127_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088030573.1|3012186_3012522_+	YolD-like family protein	NA	O64030	Bacillus_phage	35.7	8.9e-12
WP_088030574.1|3012539_3013052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030575.1|3013177_3013435_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.5e-22
WP_088030576.1|3013455_3014394_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.3	5.6e-96
WP_013351581.1|3014475_3014685_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_069473329.1|3014688_3014877_-	XkdX family protein	NA	NA	NA	NA	NA
WP_088030577.1|3014877_3015147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030694.1|3015161_3016595_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	50.8	4.6e-65
WP_088030578.1|3016611_3019173_-	peptidase G2	NA	D6R401	Bacillus_phage	61.6	7.2e-303
WP_088030579.1|3019187_3020717_-	hypothetical protein	NA	A0A0U4JID8	Exiguobacterium_phage	34.7	3.2e-48
WP_088030580.1|3020728_3021547_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	42.8	1.2e-57
WP_088030581.1|3021546_3027039_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	44.7	6.4e-107
WP_065180464.1|3027702_3028290_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088030582.1|3028307_3028652_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	48.7	1.8e-23
WP_088030695.1|3028648_3029050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030583.1|3029073_3029415_-|head	phage head closure protein	head	A6M954	Geobacillus_virus	46.7	2.4e-20
WP_088030584.1|3029420_3029660_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	48.6	1.2e-10
WP_088030585.1|3029662_3030151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030586.1|3030191_3031346_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.5	2.9e-126
WP_088030587.1|3031345_3032092_-|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	7.5e-59
WP_088030588.1|3032045_3033344_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	43.9	3.0e-87
WP_088030589.1|3033355_3035137_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	66.8	1.3e-245
WP_088030590.1|3035111_3035435_-|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	72.0	3.7e-31
WP_088030591.1|3035557_3035893_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	58.2	8.9e-28
>prophage 13
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	3039651	3079204	4070574	integrase	Bacillus_phage(57.14%)	50	3068770:3068784	3084493:3084507
WP_157670117.1|3039651_3040662_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	44.0	2.1e-11
WP_088030599.1|3040772_3040997_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	4.7e-09
WP_088030600.1|3041127_3041925_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	50.4	2.3e-58
WP_088030601.1|3041924_3043688_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.7	1.4e-148
WP_088030602.1|3044050_3044254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030603.1|3044359_3044797_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.8	1.7e-50
WP_088030604.1|3044927_3045107_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_088030605.1|3045231_3045660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088030607.1|3045909_3046539_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	40.3	4.0e-13
WP_147797320.1|3046914_3047481_-	hypothetical protein	NA	A0A0A0RNA9	Bacillus_phage	54.5	3.8e-23
WP_088030609.1|3047561_3047960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030610.1|3047935_3049153_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	78.0	1.3e-140
WP_088030611.1|3049149_3049719_-	hypothetical protein	NA	J9Q953	Bacillus_phage	41.5	2.7e-37
WP_088030612.1|3049715_3050570_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	43.3	1.1e-21
WP_088030613.1|3050570_3050768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030614.1|3050783_3051350_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	57.8	3.7e-26
WP_088030615.1|3051376_3052072_-	FAD-dependent thymidylate synthase	NA	M1IQ81	Bacillus_virus	68.6	1.1e-85
WP_088030617.1|3052293_3052836_-	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	57.6	4.2e-43
WP_157670119.1|3052832_3052979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030696.1|3053058_3054024_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.4	1.5e-144
WP_157670125.1|3054203_3055520_-	ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	77.6	8.5e-199
WP_013351534.1|3055581_3056313_-	endonuclease	NA	A0A024FSJ1	Bacillus_phage	72.5	1.2e-72
WP_088030619.1|3056464_3057259_-	hypothetical protein	NA	A0A217ER63	Bacillus_phage	80.5	4.0e-119
WP_088030620.1|3057242_3057599_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.1	2.9e-29
WP_025851616.1|3057604_3057790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030621.1|3057786_3058032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030622.1|3058037_3058400_-	DUF1523 domain-containing protein	NA	A0A140HLL8	Bacillus_phage	35.1	1.1e-10
WP_088030623.1|3058399_3058933_-	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	4.3e-32
WP_088030625.1|3059183_3060242_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.7	3.9e-77
WP_088030626.1|3060242_3060947_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	43.8	2.3e-33
WP_088030627.1|3060946_3063103_-	hypothetical protein	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	53.1	1.0e-209
WP_157670121.1|3063137_3063302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030628.1|3063467_3064745_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	26.6	4.8e-21
WP_033575316.1|3064745_3065180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030629.1|3065214_3065970_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	51.1	1.0e-55
WP_088030630.1|3066207_3066726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030631.1|3067020_3067629_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088030632.1|3067938_3069165_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	38.0	1.9e-67
3068770:3068784	attL	TTCAAAACCGCTCAA	NA	NA	NA	NA
WP_088030633.1|3069314_3069560_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.3e-07
WP_088030634.1|3069576_3070572_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.7	1.3e-71
WP_088030635.1|3070706_3072101_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.5	3.7e-128
WP_088030636.1|3072145_3072847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030637.1|3072843_3073371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030638.1|3073367_3074147_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.8	2.7e-75
WP_088030639.1|3074139_3074319_-	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	68.8	8.1e-12
WP_088030640.1|3074485_3075541_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	39.4	3.3e-52
WP_088030641.1|3075570_3075921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030642.1|3076632_3077052_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	1.6e-34
WP_088030643.1|3077048_3077996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030644.1|3078145_3079204_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.9e-16
3084493:3084507	attR	TTGAGCGGTTTTGAA	NA	NA	NA	NA
>prophage 14
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	3738711	3788642	4070574	lysis,coat,holin	Bacillus_phage(25.0%)	55	NA	NA
WP_014471193.1|3738711_3739167_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013353997.1|3739163_3740012_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	3.5e-36
WP_013353998.1|3740032_3740980_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.0e-68
WP_013353999.1|3740982_3741720_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	6.5e-47
WP_013354000.1|3741747_3742752_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014472356.1|3742753_3743494_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013354002.1|3743486_3744608_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013354003.1|3744607_3745471_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013354004.1|3745471_3746641_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_013354005.1|3746663_3748088_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_013354006.1|3748092_3748863_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	30.7	7.6e-06
WP_013354007.1|3749143_3749695_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_013354008.1|3749741_3750113_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_013354009.1|3750176_3751496_-	purine permease	NA	NA	NA	NA	NA
WP_013354010.1|3751514_3751937_-	YwdI family protein	NA	NA	NA	NA	NA
WP_013354011.1|3751995_3752679_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_013354012.1|3752693_3753500_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013354013.1|3753583_3753778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013354014.1|3753861_3754674_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014471205.1|3754705_3754945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013354016.1|3755045_3756485_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.7	2.4e-21
WP_013354017.1|3756481_3757864_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_013354018.1|3758081_3758912_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_013354019.1|3758935_3759250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013354020.1|3759775_3762187_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	2.9e-19
WP_088030657.1|3762228_3763230_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013354022.1|3763580_3764510_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.6	3.2e-11
WP_041481684.1|3764586_3765387_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013354024.1|3765411_3765828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013354025.1|3765814_3766102_+	Dabb family protein	NA	NA	NA	NA	NA
WP_014471208.1|3766400_3767150_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_013354027.1|3767252_3768440_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_014471209.1|3768675_3769134_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150937.1|3769428_3769689_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_013354029.1|3769732_3770101_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_013354030.1|3770102_3770717_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_013354031.1|3770731_3772681_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_088030703.1|3772708_3773674_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003150926.1|3774176_3774422_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_013354033.1|3774437_3775979_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_013354034.1|3775968_3777153_-	galactokinase	NA	NA	NA	NA	NA
WP_038463302.1|3777216_3777603_-	GtrA family protein	NA	NA	NA	NA	NA
WP_013354036.1|3777681_3778305_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013354037.1|3778640_3778802_+	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_088030658.1|3779019_3779700_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013354039.1|3779699_3780374_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_013354040.1|3780393_3780996_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_013354041.1|3781083_3782340_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_013354042.1|3782359_3783511_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_013354043.1|3783507_3784956_-	iron transporter	NA	NA	NA	NA	NA
WP_013354044.1|3785091_3785760_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_013354045.1|3785756_3786575_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_013354046.1|3786578_3787487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407725.1|3787593_3787980_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_013354048.1|3787961_3788642_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 15
NZ_CP021505	Bacillus amyloliquefaciens strain SRCM101267 chromosome, complete genome	4070574	4036936	4044955	4070574		Streptococcus_phage(50.0%)	12	NA	NA
WP_025649954.1|4036936_4037173_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	55.7	1.9e-16
WP_088030663.1|4037449_4038505_-	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	38.7	1.3e-61
WP_082634605.1|4038497_4039319_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	47.0	2.5e-63
WP_088030707.1|4039311_4040739_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	50.8	1.5e-116
WP_017418452.1|4040982_4041357_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	47.2	3.3e-15
WP_127695929.1|4041373_4041520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418451.1|4041721_4041982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418450.1|4042035_4042296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418449.1|4042292_4042472_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	50.0	2.1e-07
WP_017418448.1|4042766_4043150_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	44.4	2.1e-20
WP_088030664.1|4043146_4043677_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_088030665.1|4043788_4044955_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	33.1	1.1e-48
