The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	678184	698315	2754755	terminase,plate,tail	Aeromonas_phage(35.71%)	24	NA	NA
WP_050819337.1|678184_679447_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.3	2.5e-30
WP_087651472.1|679519_679966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651473.1|680088_680658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651474.1|680664_681762_-|tail	phage tail protein	tail	A0A077KC23	Edwardsiella_phage	36.4	5.0e-11
WP_050819333.1|681769_682348_-	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	39.7	7.4e-30
WP_087651475.1|682347_683583_-	hypothetical protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	38.8	7.0e-62
WP_012812542.1|683569_683923_-	hypothetical protein	NA	A0A068CCM1	Acinetobacter_phage	42.1	1.1e-12
WP_087651476.1|683934_684624_-|plate	baseplate assembly protein	plate	Q2NPA1	Xanthomonas_phage	44.9	4.8e-36
WP_050819331.1|684620_685547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819330.1|685543_685864_-	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	35.1	2.0e-05
WP_087651477.1|685860_686574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820339.1|686609_687413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819328.1|687777_688233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819327.1|688271_688709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819326.1|688711_689866_-	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	32.7	9.9e-26
WP_050819325.1|689884_690463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819324.1|690423_690804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819323.1|690794_691301_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.9	5.5e-13
WP_012812531.1|691337_691655_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.4	2.5e-11
WP_087651478.1|691700_692738_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.9	1.5e-78
WP_050819322.1|692737_693238_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.3	1.1e-29
WP_050819321.1|693276_694278_-	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	37.4	4.4e-30
WP_050820337.1|695811_696864_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_087651479.1|696860_698315_-|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.6	7.9e-105
>prophage 2
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	738072	757781	2754755	capsid,terminase,integrase,portal,tail	Rhodobacter_phage(20.0%)	30	732853:732867	767368:767382
732853:732867	attL	GCCATAAGGGTTGCT	NA	NA	NA	NA
WP_087651494.1|738072_739137_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	34.2	2.7e-46
WP_019089951.1|739136_739394_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_087651495.1|739390_739738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651496.1|739713_739998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651497.1|739994_740234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651498.1|740386_740764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668555.1|740881_741382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651500.1|741389_741731_-	helix-turn-helix transcriptional regulator	NA	A0A288WGH2	Bacillus_phage	35.2	2.0e-06
WP_087651501.1|741848_742058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651502.1|742054_742615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668556.1|742532_742934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651503.1|743030_743510_+	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	35.9	2.5e-07
WP_087651504.1|743509_743704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651505.1|743690_743876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651506.1|743868_744288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651507.1|744284_745307_+	hypothetical protein	NA	A0A0U4B0G9	Pseudomonas_phage	36.4	1.1e-12
WP_087651508.1|745260_747192_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087651509.1|747451_747883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651510.1|747997_748318_+	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	31.6	3.5e-05
WP_063353594.1|748517_748979_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXG3	Streptococcus_phage	32.9	4.7e-19
WP_087651511.1|748981_750706_+|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	50.9	1.8e-156
WP_087651512.1|750708_751986_+|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	50.5	2.6e-112
WP_087651513.1|751987_752947_+	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	47.3	6.9e-65
WP_087651514.1|752947_754297_+|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	37.0	3.3e-65
WP_087651515.1|754298_754532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651516.1|754571_755246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651517.1|755245_755569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651518.1|755568_756009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651519.1|756005_756452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651520.1|756494_757781_+|tail	phage tail protein	tail	NA	NA	NA	NA
767368:767382	attR	AGCAACCCTTATGGC	NA	NA	NA	NA
>prophage 3
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	882096	906357	2754755	transposase	Streptococcus_phage(33.33%)	14	NA	NA
WP_087651559.1|882096_882309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087651560.1|882402_882693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_070325589.1|882711_883791_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812390.1|884444_885830_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_157668561.1|888078_889265_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087652121.1|889369_890671_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_087651563.1|892093_893560_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_087651564.1|893637_895089_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.4e-53
WP_087651565.1|895550_896453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651566.1|896777_898328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651567.1|898896_904239_-	glycosyltransferase	NA	G9E6D1	Micromonas_pusilla_virus	23.2	4.0e-05
WP_087651568.1|904255_905224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651569.1|905667_905853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007400224.1|905997_906357_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	1076865	1137816	2754755	tRNA,integrase,transposase,protease	Aeromonas_phage(14.29%)	53	1075444:1075459	1145230:1145245
1075444:1075459	attL	TCATTTTCTGGATGGC	NA	NA	NA	NA
WP_087651418.1|1076865_1077620_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_087651613.1|1077855_1078503_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_087651614.1|1078499_1079792_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_087651615.1|1079945_1081061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668563.1|1081160_1083164_-	lytic transglycosylase domain-containing protein	NA	H9C0W9	Aeromonas_phage	29.8	1.2e-21
WP_157668564.1|1083322_1083844_-	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	28.8	1.8e-06
WP_087651617.1|1084344_1086789_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_087651618.1|1086808_1087792_-	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	31.3	4.9e-18
WP_087651619.1|1087930_1088227_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_157668565.1|1088240_1089062_-	hypothetical protein	NA	W5VKI0	Buzura_suppressaria_nuclear_polyhedrosis_virus	30.2	3.0e-16
WP_087651621.1|1089941_1090352_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	34.7	2.4e-06
WP_050818748.1|1090790_1091102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651623.1|1091107_1091401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651624.1|1091442_1091775_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_006116155.1|1091771_1092026_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_087651625.1|1092091_1093030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651626.1|1093317_1094529_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	41.5	9.2e-83
WP_050818754.1|1094755_1096549_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	4.2e-31
WP_050820284.1|1096617_1097475_+	endonuclease III	NA	NA	NA	NA	NA
WP_050818756.1|1097514_1098543_-	ferrochelatase	NA	NA	NA	NA	NA
WP_050818758.1|1098545_1099619_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_050818759.1|1099629_1100169_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_050818760.1|1100355_1100577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820285.1|1100648_1101743_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_080986716.1|1101982_1102519_+	DUF3576 domain-containing protein	NA	NA	NA	NA	NA
WP_087651627.1|1102578_1105197_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.3	7.2e-149
WP_050818763.1|1105196_1105892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050818764.1|1105907_1106921_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_157668562.1|1110608_1110749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651628.1|1113090_1114680_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_050818766.1|1114763_1115405_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050818767.1|1115481_1116408_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_019088899.1|1116410_1117160_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_087651629.1|1117223_1118861_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_050818769.1|1118973_1119651_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_050818770.1|1119787_1121173_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_087651630.1|1121181_1122015_-	OmpW family protein	NA	NA	NA	NA	NA
WP_050818772.1|1122293_1123106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050818773.1|1123174_1124743_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	6.2e-23
WP_050818774.1|1124918_1125374_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_050818776.1|1125873_1126605_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_050818778.1|1126601_1127378_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_050818780.1|1127377_1127962_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_087651631.1|1128039_1128597_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	62.6	7.1e-38
WP_050818784.1|1128660_1129935_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_003626519.1|1130150_1130564_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_070325589.1|1131359_1132439_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668566.1|1132611_1133346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651633.1|1133332_1133917_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.3	2.6e-22
WP_087652127.1|1134235_1134904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651570.1|1135438_1137049_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|1137112_1137460_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|1137456_1137816_-|transposase	transposase	transposase	NA	NA	NA	NA
1145230:1145245	attR	GCCATCCAGAAAATGA	NA	NA	NA	NA
>prophage 5
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	1565441	1598477	2754755	plate,integrase,transposase,tail	Aeromonas_phage(16.67%)	42	1556133:1556147	1580115:1580129
1556133:1556147	attL	TGATGACATGGTGCG	NA	NA	NA	NA
WP_050819146.1|1565441_1567319_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	4.4e-100
WP_087651709.1|1567424_1568351_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_087651710.1|1568624_1569734_-|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	26.7	7.0e-21
WP_087651711.1|1569920_1570514_-	3'-5' exonuclease	NA	A0A1W6DWR2	Sphingobium_phage	39.9	1.5e-30
WP_087651712.1|1570510_1571122_-	hypothetical protein	NA	G9FH01	Rhodococcus_phage	48.4	2.8e-35
WP_087651713.1|1571121_1571817_-	hypothetical protein	NA	A0A2L0HJW4	Mycobacterium_phage	36.9	7.7e-42
WP_087651714.1|1571816_1572041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651715.1|1572037_1572358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651716.1|1572436_1572670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651717.1|1572681_1573413_-	hypothetical protein	NA	U5P4K5	Shigella_phage	48.2	3.1e-17
WP_087651718.1|1573862_1574357_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	34.5	4.7e-09
WP_087651720.1|1574851_1575238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124298034.1|1575315_1575561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651721.1|1575557_1575944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651722.1|1575943_1576609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651723.1|1576610_1576850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668570.1|1576898_1577297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044583033.1|1577409_1577604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652134.1|1577615_1577879_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	59.2	2.9e-18
WP_070323763.1|1577882_1578086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652135.1|1578166_1578505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651724.1|1578626_1579355_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	56.1	2.9e-31
WP_012812390.1|1579497_1580883_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
1580115:1580129	attR	CGCACCATGTCATCA	NA	NA	NA	NA
WP_157668571.1|1583310_1583805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652136.1|1583830_1584184_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_087651726.1|1584562_1585426_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_087651727.1|1585499_1585772_-	superinfection immunity protein	NA	E5FIG5	Escherichia_phage	41.7	3.5e-06
WP_087651728.1|1585849_1586296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668572.1|1586310_1586676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|1586818_1588204_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_087651730.1|1588303_1588711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651731.1|1588710_1589019_+	hypothetical protein	NA	K4I3B0	Acinetobacter_phage	37.5	2.9e-09
WP_087651732.1|1589011_1589977_+	hypothetical protein	NA	H9C0X5	Aeromonas_phage	24.3	3.6e-13
WP_087652137.1|1590059_1590593_+|plate	baseplate assembly protein	plate	A0A1X9SFI8	Acinetobacter_phage	38.4	3.2e-27
WP_087651734.1|1590971_1592255_+	hypothetical protein	NA	H9C0X9	Aeromonas_phage	38.8	8.6e-63
WP_087651735.1|1592256_1592832_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	41.6	2.4e-28
WP_087651736.1|1592831_1593974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652138.1|1594613_1595336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651737.1|1595343_1596420_+|tail	tail fiber domain-containing protein	tail	A0A218MLC9	uncultured_virus	27.9	8.7e-08
WP_087651738.1|1596419_1596830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651739.1|1596822_1597137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|1597226_1598477_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	1843155	1855213	2754755	terminase,transposase	Aeromonas_phage(33.33%)	15	NA	NA
WP_087651763.1|1843155_1844541_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_087651807.1|1844637_1844865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652145.1|1845078_1845267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651808.1|1845235_1846663_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	48.2	1.7e-120
WP_087651809.1|1846662_1848189_+	DUF1073 domain-containing protein	NA	H9C0V0	Aeromonas_phage	34.4	4.9e-73
WP_087651810.1|1848175_1849027_+	hypothetical protein	NA	H9C0V1	Aeromonas_phage	34.4	1.5e-31
WP_087651811.1|1849023_1850154_+	DUF2213 domain-containing protein	NA	A0A077KBZ2	Edwardsiella_phage	36.7	3.9e-35
WP_087651812.1|1850156_1850630_+	hypothetical protein	NA	I2GUD6	Acinetobacter_phage	34.8	7.4e-12
WP_087651813.1|1850633_1851689_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	36.4	8.7e-53
WP_087651814.1|1851691_1852054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651815.1|1852056_1852548_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_157668578.1|1852544_1853138_+	hypothetical protein	NA	A0A0S3UFX9	Pseudomonas_phage	35.5	5.8e-06
WP_087651817.1|1853134_1853524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668579.1|1853562_1854060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651818.1|1854025_1855213_+	DUF3383 family protein	NA	Q6UKE8	Burkholderia_virus	27.6	1.2e-21
>prophage 7
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	1859159	1868460	2754755		Edwardsiella_phage(37.5%)	14	NA	NA
WP_087651823.1|1859159_1859453_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	40.6	6.6e-11
WP_087651824.1|1859449_1859860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651826.1|1860180_1860660_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	30.7	1.8e-10
WP_087651827.1|1860921_1861101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668580.1|1861237_1861774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668581.1|1861906_1862179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651830.1|1862165_1862978_+	KilA-N domain-containing protein	NA	A0A2H4IZE1	uncultured_Caudovirales_phage	35.8	2.4e-34
WP_087651831.1|1863028_1863220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651832.1|1863324_1864377_+	hypothetical protein	NA	A0A2R3UAK8	Myoviridae_environmental_samples	34.0	7.6e-25
WP_087651833.1|1864376_1865012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651834.1|1865011_1865362_+	hypothetical protein	NA	H9C0X7	Aeromonas_phage	42.5	1.0e-10
WP_087651835.1|1865348_1866584_+	hypothetical protein	NA	H9C0X9	Aeromonas_phage	38.5	1.0e-57
WP_087651836.1|1866580_1867156_+	DUF2612 domain-containing protein	NA	Q2NPA3	Xanthomonas_phage	40.4	3.9e-31
WP_087651837.1|1867152_1868460_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	42.2	6.4e-13
>prophage 8
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	2157760	2207624	2754755	transposase	uncultured_virus(23.08%)	37	NA	NA
WP_087651570.1|2157760_2159371_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|2159434_2159782_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|2159778_2160138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087651908.1|2162900_2163440_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_157668585.1|2165169_2166489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651910.1|2167964_2170208_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_087652151.1|2170251_2172294_-	phosphatase	NA	NA	NA	NA	NA
WP_003625762.1|2172661_2174302_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.0	2.8e-175
WP_050820441.1|2174355_2174649_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	57.0	1.9e-21
WP_087651911.1|2174859_2175528_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003625755.1|2175671_2175875_+	cold-shock protein	NA	A0A218MMZ6	uncultured_virus	51.5	1.3e-13
WP_087652152.1|2175893_2178851_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	32.6	3.3e-09
WP_087652153.1|2178983_2179814_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003625750.1|2179859_2180426_-	elongation factor P	NA	NA	NA	NA	NA
WP_157668586.1|2181653_2181857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668587.1|2183110_2183455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087652154.1|2184830_2185826_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_087651914.1|2186136_2186694_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_087651915.1|2187515_2188091_-	DedA family protein	NA	NA	NA	NA	NA
WP_087651916.1|2188446_2189697_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_087651917.1|2189699_2190569_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_050820156.1|2190652_2190991_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_087651918.1|2191273_2192614_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	4.5e-70
WP_087651919.1|2192753_2192999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651920.1|2193100_2193352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986824.1|2193391_2194060_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_087651921.1|2194144_2195530_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003629580.1|2195588_2196074_+	xanthine phosphoribosyltransferase	NA	M4T1R9	Cellulophaga_phage	26.4	8.7e-08
WP_087651922.1|2196232_2196538_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_087651923.1|2197659_2197980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668588.1|2198058_2199741_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_087651925.1|2200367_2202197_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087651926.1|2202334_2203486_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	42.1	1.0e-78
WP_087651927.1|2203537_2205025_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	27.1	8.5e-30
WP_007400224.1|2205246_2205606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010510701.1|2205602_2205950_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_087651570.1|2206013_2207624_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
>prophage 9
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	2395791	2466538	2754755	holin,transposase	Tupanvirus(22.22%)	43	NA	NA
WP_035366691.1|2395791_2396787_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_012812328.1|2396999_2398250_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_050820026.1|2399225_2399690_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_050820025.1|2399899_2400970_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	1.6e-75
WP_087651988.1|2401058_2403572_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	40.6	1.7e-17
WP_050820024.1|2403948_2404269_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_087652162.1|2404326_2406567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651989.1|2407197_2408142_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820022.1|2408311_2409934_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	1.3e-60
WP_080986818.1|2410316_2410700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820424.1|2410886_2412020_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_087651990.1|2412016_2412748_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_080986816.1|2412744_2413377_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087651991.1|2415069_2416761_+	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_050820019.1|2416786_2418376_+	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_050820018.1|2418492_2419593_+	asparaginase	NA	NA	NA	NA	NA
WP_087651992.1|2419624_2420614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080986815.1|2420837_2421416_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012813230.1|2422660_2424046_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_087651994.1|2424722_2427161_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050820423.1|2427254_2427944_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.8	2.6e-21
WP_080986814.1|2428378_2430067_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	34.5	3.4e-27
WP_087651995.1|2430063_2431755_+	thiol reductant ABC exporter subunit CydC	NA	A0A1M7XV31	Cedratvirus	32.5	5.7e-14
WP_087651996.1|2431819_2433433_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_050820010.1|2433447_2434587_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_019087756.1|2434600_2434795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820009.1|2435138_2436479_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_080986813.1|2436802_2437621_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_050820008.1|2437822_2440099_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087651997.1|2440863_2442249_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_087651998.1|2442933_2444517_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_050820005.1|2444538_2446164_-	TolC family protein	NA	NA	NA	NA	NA
WP_087651999.1|2446160_2447987_-	fusaric acid resistance protein	NA	NA	NA	NA	NA
WP_050820003.1|2447967_2449017_-	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
WP_080986812.1|2449016_2449295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820002.1|2449632_2451993_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050820001.1|2452293_2452884_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080986864.1|2452915_2453539_+	DUF1442 domain-containing protein	NA	NA	NA	NA	NA
WP_087651741.1|2455784_2457170_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_050819998.1|2458669_2459866_+	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_050819997.1|2459889_2460408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652000.1|2461339_2463781_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087652001.1|2464048_2466538_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 10
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	2483195	2508027	2754755	capsid,head,terminase,integrase,portal	Xylella_phage(20.0%)	43	2480654:2480667	2501058:2501071
2480654:2480667	attL	GATCTGCATCCAGC	NA	NA	NA	NA
WP_087652006.1|2483195_2484359_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1ITF8	uncultured_Mediterranean_phage	23.5	1.6e-07
WP_157668589.1|2484769_2484973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668590.1|2484969_2485365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652164.1|2485429_2485672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652009.1|2485671_2485854_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_087652010.1|2485850_2486126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631324.1|2486122_2486326_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	46.3	1.1e-09
WP_087652011.1|2486322_2486739_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087652012.1|2486707_2487091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652013.1|2487087_2487324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652014.1|2487320_2487578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652015.1|2487574_2487916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652016.1|2488007_2488193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652017.1|2488233_2488554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668591.1|2488644_2489007_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087652019.1|2489069_2489291_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087652020.1|2489395_2490226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652021.1|2490330_2490792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668592.1|2490791_2491214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652023.1|2491210_2491528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668593.1|2491513_2491999_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_087652025.1|2492225_2492453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652026.1|2492449_2492935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668594.1|2492909_2493110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652028.1|2493212_2493713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652029.1|2493797_2494970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652030.1|2494966_2495530_+	hypothetical protein	NA	W5RVC2	Staphylococcus_phage	32.8	2.7e-21
WP_087652032.1|2495759_2495981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652165.1|2496403_2496712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652033.1|2496834_2497242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020944003.1|2497626_2498502_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	32.9	2.7e-07
WP_087652034.1|2498506_2499139_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	45.0	1.3e-43
WP_157668595.1|2499135_2499300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652035.1|2499296_2499503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652166.1|2499772_2500429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820195.1|2500575_2501100_+	hypothetical protein	NA	NA	NA	NA	NA
2501058:2501071	attR	GCTGGATGCAGATC	NA	NA	NA	NA
WP_087652036.1|2501062_2503081_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.3	3.1e-139
WP_003630354.1|2503092_2503395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652037.1|2503394_2505044_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	36.3	1.5e-80
WP_087652038.1|2505040_2505871_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	40.1	4.3e-39
WP_157668596.1|2505915_2506497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820190.1|2506493_2506883_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	33.3	8.8e-11
WP_087652040.1|2506917_2508027_+|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	35.1	1.9e-50
>prophage 11
NZ_CP021509	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 chromosome, complete genome	2754755	2579356	2640474	2754755	transposase	Streptococcus_phage(25.0%)	40	NA	NA
WP_081500468.1|2579356_2580970_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_050819876.1|2581212_2582661_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_050819875.1|2582704_2583241_-	Dabb family protein	NA	NA	NA	NA	NA
WP_050820411.1|2583411_2584644_+	precorrin-3B synthase	NA	NA	NA	NA	NA
WP_003630816.1|2584630_2585260_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_050819874.1|2585260_2585986_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_087652065.1|2585982_2586741_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_087652066.1|2586710_2587514_-	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_050819871.1|2587603_2588848_+	bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_050819870.1|2588844_2589219_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_050819869.1|2589219_2589978_+	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_087652067.1|2589982_2591056_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_087652068.1|2591158_2592514_-	MFS transporter	NA	NA	NA	NA	NA
WP_050819866.1|2593206_2593851_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_087652069.1|2593975_2594629_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_050819864.1|2594801_2596058_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_050819863.1|2596181_2598695_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.3	2.6e-156
WP_157668562.1|2600985_2601126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652070.1|2606148_2607783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651570.1|2609181_2610792_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.4	1.8e-110
WP_010510701.1|2610855_2611203_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_007400224.1|2611199_2611559_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087652071.1|2612705_2613323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651468.1|2613437_2614823_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	2.5e-31
WP_087652072.1|2615052_2615514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819849.1|2615578_2615995_-	cytochrome c	NA	NA	NA	NA	NA
WP_080986797.1|2615994_2617596_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_050819847.1|2617687_2620327_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.1	1.7e-12
WP_087652073.1|2620756_2621302_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_050819845.1|2621298_2621997_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_050819844.1|2622134_2623286_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_087652074.1|2623497_2629530_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_050819842.1|2629649_2630555_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.7	1.5e-24
WP_087652075.1|2630754_2632140_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_087652171.1|2632847_2634296_+	TolC family protein	NA	NA	NA	NA	NA
WP_087652076.1|2634314_2635631_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_087652077.1|2635687_2636335_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_087652078.1|2636355_2637111_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_087652079.1|2637140_2638901_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	28.8	3.4e-09
WP_087652080.1|2639088_2640474_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.4e-31
>prophage 1
NZ_CP021511	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-2, complete sequence	190983	2748	134558	190983	integrase,transposase	uncultured_Caudovirales_phage(22.86%)	111	66162:66221	134470:135556
WP_035366691.1|2748_3744_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_012812328.1|3956_5207_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_003631418.1|5398_6172_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_087652182.1|7088_8175_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	2.3e-40
WP_007397858.1|9063_9213_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_006115550.1|9199_10219_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_006115551.1|10221_11655_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_087651741.1|12609_13995_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_087651741.1|14759_16145_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_087652183.1|16335_17517_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012812328.1|18492_19743_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_035366691.1|19955_20951_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_157668605.1|20960_21200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087651741.1|21450_22836_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_081461410.1|23061_23397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039891571.1|23484_23742_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087652186.1|23828_24851_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_012813095.1|25394_26435_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006117547.1|27458_28661_-	porin	NA	NA	NA	NA	NA
WP_019088957.1|28647_28947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652187.1|29713_31936_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_012813207.1|32012_32543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117544.1|32594_32774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652188.1|32871_33864_+	TonB family protein	NA	NA	NA	NA	NA
WP_087652189.1|34107_35187_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_087652190.1|36143_36635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117538.1|36636_37104_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_006117537.1|37177_38494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|39215_40466_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_087652191.1|42293_43679_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.9e-31
WP_006115869.1|48033_48423_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_087652192.1|48419_48692_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_010512346.1|48705_48921_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_006115867.1|48956_49535_+	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	40.0	5.1e-23
WP_157668606.1|49670_50198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006115571.1|50231_50870_-	HPP family protein	NA	NA	NA	NA	NA
WP_041247961.1|51188_52148_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_041633342.1|54226_55210_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_087652194.1|55237_56266_+	methionine synthase	NA	NA	NA	NA	NA
WP_052583250.1|56375_57302_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087651418.1|57362_58116_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_006115735.1|58259_58556_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813272.1|58552_58894_-	translation repressor RelE/RelB/StbE	NA	NA	NA	NA	NA
WP_087652195.1|59207_60287_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.5	5.9e-81
WP_014095369.1|60295_60994_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.2	8.2e-84
WP_087652196.1|61017_62313_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.5	3.0e-132
WP_006115730.1|62312_62735_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_006115729.1|62731_63085_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012813242.1|63527_65141_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.8	2.5e-43
WP_012813241.1|65140_65542_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_006115724.1|65538_65859_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_035366691.1|66156_67152_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
66162:66221	attL	TGTCAGGTTGTGAGACGTCATTGGCGTAATCAAGGATTTCGTCGACCTGTTTCATGATGT	NA	NA	NA	NA
WP_087636501.1|67317_67650_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_087652197.1|67652_68144_+	type II toxin-antitoxin system YhaV family toxin	NA	Q8HA46	Vibrio_phage	41.8	1.9e-23
WP_012813162.1|68578_68851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652198.1|69128_70514_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.4e-31
WP_087652186.1|70775_71798_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_012813095.1|72341_73382_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087652199.1|73896_74436_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012812328.1|74398_75649_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_087652154.1|75764_76760_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_087652201.1|77088_77469_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_035362983.1|77456_77741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652202.1|78058_79060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652203.1|79052_79976_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042786503.1|79978_81643_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_063355018.1|81997_82396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007284432.1|82469_83120_+	cation transporter	NA	NA	NA	NA	NA
WP_087652231.1|83295_84555_+	TolC family protein	NA	NA	NA	NA	NA
WP_007284430.1|84551_85586_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_087652204.1|85585_88720_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	8.0e-62
WP_087652232.1|88746_88944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652205.1|89312_89666_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087652206.1|89662_90085_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	5.2e-49
WP_087652196.1|90084_91380_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.5	3.0e-132
WP_014095369.1|91403_92102_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.2	8.2e-84
WP_087652207.1|92110_93190_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.2	2.2e-80
WP_087652233.1|93465_94146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813192.1|94285_94735_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_087652208.1|94969_96180_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.9e-96
WP_012813340.1|96455_96680_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087652209.1|96785_98219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652234.1|98341_98842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652191.1|99773_101159_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.9e-31
WP_087652211.1|102023_103067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668607.1|103066_103531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039891566.1|103523_103934_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087652213.1|104379_105459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081461411.1|105689_105983_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_087652214.1|105986_106265_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	46.7	1.4e-15
WP_006115562.1|106360_107071_-	phage antirepressor	NA	A0A0C5AEJ9	Bacteriophage	49.5	3.3e-24
WP_087652215.1|107381_108170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039891563.1|108286_109135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039891560.1|109137_109602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039891573.1|110988_111210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813212.1|111338_111539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813213.1|111595_111925_-	endoribonuclease MazF	NA	NA	NA	NA	NA
WP_006115554.1|111926_112181_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087652235.1|112279_112630_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_012813095.1|112667_113708_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087652186.1|114251_115274_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_087652198.1|115535_116921_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.4e-31
WP_006115745.1|117825_119316_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003631062.1|119807_120731_+	plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_019088965.1|121461_122160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081461418.1|122156_122792_-	ParA family protein	NA	W0LIU2	Mycobacterium_phage	30.9	2.7e-09
WP_087652216.1|123246_128373_+	lactate dehydrogenase	NA	I6WLR1	Burkholderia_virus	39.5	0.0e+00
WP_087652217.1|128560_129673_+	chromosome partitioning protein ParB	NA	A0A142KA42	Gordonia_phage	34.4	3.2e-05
WP_012813351.1|129650_129986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813347.1|132162_133392_+	sugar transporter	NA	NA	NA	NA	NA
WP_087652236.1|133538_134558_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
134470:135556	attR	ACATCATGAAACAGGTCGACGAAATCCTTGATTACGCCAATGACGTCTCACAACCTGACACCTACCACTACAGTTGCATTTTGTGTTGAGTTCTGAATCTATGGGTAACCATGATTCAGGATATGATGAGTGGCGGTACGTCTGTTGAAGAGACGCTGGAATTATGGACGTGCTTTTCGGCTCCTGAACATTCTGGATGACTTCAATCGTGAAGGACTGGCGATCGAGGGTGATTTTTCCCTGCCAGCCTGTCGGGTTGTCCGCTGTCTGGAACAGGTTATGGAGTGGCGTGGCAGGCCAGAAGCCATCCGAATGGATAATGGCCCTGAATATGTCAGTCATACGTTGGTTTCATGGGCCGAAAAACAGGGGATTACCCTGATCTATACGCAACCGGGTAATCCGCAGCAGAACGCCTATATTGAACGCTACAACAGAACTGTCCGGCAGGAATGGCTGGAGCAGTATTTGTTTGAAAGCATTCAGGACGTGCAGGAGGTCGCAACACAATGGCTCTGGACATATAATCATGACAGACCCAACATGGGGAACAGCGGGCTAACCCCCGCCCAGAAACTAAAAACAGCTGCCTGAATTCTCATTCAATGCCCCACTAAAAATGGGGGGATTACCGAGGGAAATCAGGGAGAACCTCGATCAAGGTGCCATTTGCAAGATCATCGGCAAATCCATAGCGTGGAACCTGCACGATGCCAAAACCGAGCCTGGCTGCTTCGGCATAGGTATCCACGCCCCCGACCAACAAACGTGCAGGGAGTGACCTCTCAATCACATCCTCTCCGCGCGTAAACTCCAATGGCAGGGGCTGGCCGGTACGTGAGGATACGAAGCCGATCATCTGATGCCCCTCGAGATCGTCAGGAGAGGCAGGCATTCCGTGCCGCGCCAGATAGGTTGGGCTGGCGAGCGTCACCTCCTCCATCACGCCGAGAGGCCGGACGATCATGTCGCTGTCCGACAGGCTTCCAGCCCGTACAACGCAGTCCACCCCTTCGCGCACCAAATCAACAAACCGTTCGCCCTCACCGAGATGAACGGTCAATGCCGGATGCCTTGTCATAAAATC	NA	NA	NA	NA
>prophage 1
NZ_CP021512	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-3, complete sequence	256755	2880	145452	256755	integrase,transposase,tRNA	Streptococcus_phage(17.07%)	115	NA	NA
WP_041247961.1|2880_3840_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003627483.1|3948_4329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035362983.1|4316_4601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652202.1|4918_5920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652203.1|5912_6836_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042786503.1|6838_8503_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_087652237.1|8861_9665_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_064775998.1|9671_10499_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012813329.1|10550_11120_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813137.1|11423_12107_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	9.3e-24
WP_087652238.1|12103_14791_-	sensor histidine kinase KdpD	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.5	2.8e-07
WP_012813135.1|14790_15414_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_087652239.1|15424_17533_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	30.3	1.2e-34
WP_014095382.1|17547_19254_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_041247966.1|19256_19346_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012813132.1|19621_20944_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012813131.1|20980_21430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652240.1|21772_22732_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003631146.1|22978_24370_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003631147.1|24454_25612_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012813128.1|25699_26293_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087652241.1|26885_28096_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.9e-96
WP_064775954.1|29302_30082_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.2	8.1e-32
WP_081500468.1|30189_31803_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_087652242.1|32029_33952_-	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	32.9	3.3e-74
WP_087652243.1|34145_35233_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	6.9e-45
WP_087652244.1|35446_36406_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010511145.1|36876_37908_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_087652246.1|39289_40390_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_087652247.1|40443_42078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652248.1|42074_42392_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_087652249.1|42837_43593_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.2	2.4e-60
WP_157668608.1|43589_44471_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_087652251.1|44880_45609_+	hypothetical protein	NA	A0A1I9KF49	Aeromonas_phage	30.0	8.2e-10
WP_083824502.1|45741_46659_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_157668623.1|47521_49888_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087652254.1|49899_51252_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_087652255.1|51254_51896_-	SCO family protein	NA	NA	NA	NA	NA
WP_087652256.1|52331_53945_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.2	1.2e-42
WP_087652257.1|53944_54346_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_087652258.1|54342_54648_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087652259.1|54640_55939_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087652260.1|55935_59121_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.3	3.9e-72
WP_087652349.1|59359_59890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035366454.1|60072_60270_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_064776191.1|60269_60683_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_061507517.1|61065_61566_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.3	5.8e-23
WP_087652261.1|61642_62395_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.1	1.3e-21
WP_087652262.1|62847_63120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813095.1|63951_64992_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041247965.1|65535_66558_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_012813230.1|66819_68205_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	2.5e-31
WP_087652264.1|68270_68783_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.7	2.7e-15
WP_003631418.1|69096_69870_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_157668561.1|71440_72626_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.8	9.8e-29
WP_087652265.1|72923_73256_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813161.1|73258_73750_+	type II toxin-antitoxin system YhaV family toxin	NA	Q8HA46	Vibrio_phage	42.5	1.5e-23
WP_157668624.1|74184_74463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813229.1|74548_75934_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_087652267.1|76195_77218_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_087652269.1|78360_78720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082179784.1|78719_78986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652350.1|79504_79867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813169.1|80651_81386_-	CbtA family protein	NA	NA	NA	NA	NA
WP_003627697.1|81409_81628_-	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_087652270.1|81773_83366_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_087652271.1|83918_85649_+	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.7	6.7e-10
WP_041633238.1|85635_86145_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_012813165.1|86336_87710_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_012813162.1|89362_89635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813161.1|90914_91406_-	type II toxin-antitoxin system YhaV family toxin	NA	Q8HA46	Vibrio_phage	42.5	1.5e-23
WP_012813160.1|91408_91741_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_087652272.1|93616_95002_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	9.4e-31
WP_087652273.1|95067_95791_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	45.0	1.8e-17
WP_087652274.1|96397_97051_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_157668609.1|97041_97251_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087652276.1|97443_98829_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_087652277.1|99090_100113_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_157668610.1|100329_100668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652279.1|100887_102273_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	6.5e-32
WP_087652277.1|102534_103557_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_087652209.1|104688_106122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813340.1|106227_106452_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003630720.1|106451_106856_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_080587162.1|107018_107264_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_042788970.1|107264_107570_+	CcdB family protein	NA	NA	NA	NA	NA
WP_012813117.1|109026_109950_+	plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_012813118.1|110159_111215_+	DUF1870 family protein	NA	F0PIG8	Enterococcus_phage	27.8	3.2e-15
WP_012813119.1|111201_112074_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	32.3	1.5e-10
WP_087652282.1|112500_117627_+	lactate dehydrogenase	NA	I6WLR1	Burkholderia_virus	39.8	0.0e+00
WP_087652283.1|117814_119731_+	chromosome partitioning protein ParB	NA	A0A142KA42	Gordonia_phage	35.2	2.5e-05
WP_064775785.1|119805_120297_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_087652284.1|120534_120936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652285.1|121426_121798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668611.1|122155_122317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652286.1|122339_123245_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	1.4e-56
WP_064776428.1|123675_124071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652287.1|124332_124728_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	38.8	2.3e-14
WP_087652288.1|125163_126351_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_157668612.1|126475_127045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652289.1|127041_127557_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	42.9	5.8e-10
WP_157668613.1|127750_128161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064776400.1|128193_128505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652291.1|128986_130372_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	3.8e-32
WP_087652292.1|130586_131096_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_081273946.1|131102_131414_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_064776398.1|131423_132389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064776397.1|132449_133967_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_087652294.1|134639_135849_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.1e-96
WP_080986795.1|138060_139278_+	hypothetical protein	NA	A7KV33	Bacillus_phage	31.6	6.5e-44
WP_157668614.1|139519_140371_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	31.0	4.1e-21
WP_003630469.1|140468_140678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064776315.1|140788_141748_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003631298.1|142236_143349_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.8	1.9e-10
WP_087652296.1|144365_145452_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.2	4.0e-45
>prophage 2
NZ_CP021512	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-3, complete sequence	256755	168485	217889	256755	transposase	Streptococcus_phage(50.0%)	41	NA	NA
WP_087652272.1|168485_169871_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	9.4e-31
WP_087652309.1|170013_172050_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_012813300.1|172053_172686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652310.1|172698_173847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813302.1|173843_174359_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_087652311.1|174358_174793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652312.1|175037_176204_-	secretion protein	NA	NA	NA	NA	NA
WP_012813305.1|176200_177235_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_012813306.1|177227_177686_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_012813307.1|178380_178650_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012813308.1|178651_178927_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_087652313.1|179149_182233_-	secretion protein	NA	NA	NA	NA	NA
WP_042788885.1|182245_182872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095045944.1|182883_183249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042788888.1|183421_183958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668620.1|183968_184841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652315.1|185219_186455_-	type IV secretion protein DotG	NA	NA	NA	NA	NA
WP_087652316.1|186454_187435_-	type IV secretion protein DotH	NA	NA	NA	NA	NA
WP_087652353.1|187439_188075_-	type IV secretion protein DotI	NA	NA	NA	NA	NA
WP_157668621.1|188207_189095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064776538.1|189512_190358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064776550.1|190851_191043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062144919.1|191450_192014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652318.1|192013_193189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652319.1|197004_197400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652321.1|197781_198396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652322.1|198392_199406_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_082247082.1|199475_199823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061498202.1|200091_200370_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	55.7	4.0e-18
WP_087652323.1|201125_202445_+	replication protein C	NA	NA	NA	NA	NA
WP_061491194.1|202598_202892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652324.1|202888_203935_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_064775968.1|203947_205033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652325.1|205384_207358_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.9	3.6e-36
WP_087652277.1|208776_209799_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_070325589.1|210031_211111_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812390.1|211339_212725_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_081273853.1|212775_213027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081273854.1|213635_214322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775780.1|214398_214977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652326.1|216503_217889_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	6.5e-32
>prophage 1
NZ_CP021513	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-4, complete sequence	19899	11329	19544	19899	transposase	Salmonella_phage(50.0%)	8	NA	NA
WP_087652356.1|11329_12715_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_087652358.1|12857_13436_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	1.4e-36
WP_087652357.1|13561_16453_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	1.3e-186
WP_064775892.1|16490_17051_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	58.7	1.4e-30
WP_064775893.1|17115_17445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062247727.1|17432_17711_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_064775894.1|17887_18301_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	65.7	4.9e-44
WP_064775895.1|18323_19544_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	43.7	3.8e-84
>prophage 1
NZ_CP021514	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101342 plasmid pAP1342-5, complete sequence	43021	34020	41738	43021	portal,capsid	uncultured_Caudovirales_phage(37.5%)	12	NA	NA
WP_042789027.1|34020_34317_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	41.3	9.9e-15
WP_042789025.1|34306_34552_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_087652394.1|34671_34959_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	42.5	9.7e-07
WP_087652405.1|34918_35179_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	37.9	5.1e-07
WP_087652395.1|35401_36862_-|capsid	phage major capsid protein	capsid	Q8W6U5	Burkholderia_virus	26.7	6.4e-14
WP_087652396.1|37024_37681_-	hypothetical protein	NA	B6DZX5	Stx2-converting_phage	28.2	4.8e-09
WP_087652397.1|37698_38979_-|portal	phage portal protein	portal	A0A1X9I6U5	Streptococcus_phage	28.8	4.9e-34
WP_087652398.1|39645_39825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668629.1|39840_40161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087652400.1|40351_40729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087652401.1|40740_41193_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	44.9	9.2e-20
WP_157668630.1|41225_41738_+	NAD synthetase	NA	A0A0H4INK3	Stenotrophomonas_phage	47.0	1.4e-19
