The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	560116	624709	2440326	holin,tRNA,protease,transposase	Streptococcus_phage(21.74%)	59	NA	NA
WP_015473415.1|560116_561166_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_011667383.1|561246_562425_-	MFS transporter	NA	NA	NA	NA	NA
WP_011667384.1|562482_562779_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011667385.1|562887_564840_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	4.2e-53
WP_011667386.1|565072_565711_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011667387.1|565891_566176_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	43.0	2.6e-12
WP_011667388.1|566231_567857_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	53.5	7.4e-152
WP_015473419.1|568248_570084_+	APC family permease	NA	NA	NA	NA	NA
WP_011667390.1|570337_571144_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_080504821.1|571188_571557_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_011667399.1|572035_573130_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_087609310.1|573183_573843_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.6	4.9e-38
WP_087609311.1|573917_575237_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.6	3.8e-58
WP_011667403.1|576045_576606_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_011667404.1|576807_579171_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_107696456.1|579247_580363_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_107696455.1|580407_581628_+|protease	serine protease	protease	NA	NA	NA	NA
WP_021741445.1|581632_582340_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.3	7.1e-43
WP_024525621.1|582336_583680_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	34.1	4.8e-24
WP_024748245.1|583829_584753_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	3.7e-31
WP_011667410.1|584989_585871_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011667411.1|585871_586798_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011667412.1|586797_587682_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011667413.1|587694_588519_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	2.4e-13
WP_011667414.1|588534_589293_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.7	3.6e-16
WP_011667415.1|589304_589985_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011667416.1|590178_590508_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_015473430.1|590508_590880_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011667418.1|590968_591904_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_011667419.1|591909_592773_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011667420.1|592788_593802_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011667421.1|593839_594745_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.8	1.6e-71
WP_011667422.1|594816_595758_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	4.2e-83
WP_011667423.1|595851_596493_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015473432.1|596489_597014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667425.1|597130_599137_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_087609312.1|599156_602012_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.7	7.8e-306
WP_011667427.1|602167_602713_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_011667428.1|602859_603744_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	2.1e-07
WP_015473435.1|603740_604751_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	52.8	1.3e-93
WP_087609313.1|604753_605692_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.7	4.5e-53
WP_011667431.1|605815_606412_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.8	2.2e-53
WP_087609314.1|606645_607089_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011373852.1|607032_607953_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_011667433.1|608170_608884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667434.1|609117_609729_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_087609315.1|610149_611178_+	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011667436.1|611246_612257_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011667437.1|612436_613639_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011667438.1|613783_614542_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_011667439.1|614649_615969_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	68.8	4.1e-169
WP_047021316.1|616083_617184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473442.1|617250_618807_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_011667442.1|618903_619140_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_011667443.1|619224_619983_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011667444.1|619986_622380_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	1.3e-88
WP_011667445.1|622395_622869_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.1	1.9e-44
WP_011667446.1|622937_623675_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	8.3e-10
WP_011373852.1|623788_624709_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 2
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	674575	682442	2440326	transposase,integrase	Thermus_phage(16.67%)	11	674286:674305	685966:685985
674286:674305	attL	AAAATAAAAACTGCCAGCTA	NA	NA	NA	NA
WP_087609328.1|674575_675730_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.3	2.3e-54
WP_087609329.1|675779_676676_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087609330.1|676819_677038_+	helix-turn-helix transcriptional regulator	NA	D7RWM4	Brochothrix_phage	60.0	1.8e-13
WP_087609331.1|677039_677489_+	Rha family transcriptional regulator	NA	Q9AZH8	Lactococcus_phage	41.5	1.6e-16
WP_011373852.1|677573_678494_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_041815234.1|678761_679046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815237.1|679356_679713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473487.1|679705_680020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473488.1|680012_680237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473489.1|680239_681028_+	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	33.6	1.4e-18
WP_087609332.1|681032_682442_+	virulence protein	NA	A0A2I6PF19	Staphylococcus_phage	37.7	3.8e-72
685966:685985	attR	AAAATAAAAACTGCCAGCTA	NA	NA	NA	NA
>prophage 3
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	706878	747840	2440326	integrase,capsid,plate,holin,terminase,tail	Lactobacillus_phage(89.74%)	55	745475:745490	748870:748885
WP_157128260.1|706878_707037_+	hypothetical protein	NA	D6PST6	Lactobacillus_phage	78.8	3.3e-17
WP_087609344.1|707146_707440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015474119.1|707430_707646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609345.1|707646_708708_+	recombinase RecT	NA	D7RWF9	Brochothrix_phage	49.4	2.0e-57
WP_087609346.1|708634_709498_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.3	7.0e-77
WP_015474116.1|709509_710298_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_087609347.1|710309_711020_+	antA/AntB antirepressor family protein	NA	A0A059NT90	Lactococcus_phage	35.2	3.7e-31
WP_051053382.1|711012_711456_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	61.8	5.8e-43
WP_087609348.1|711571_712000_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	63.4	2.2e-23
WP_157662841.1|712155_712362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157662853.1|712362_712593_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	80.8	2.6e-31
WP_087609350.1|712585_713056_+	DUF1642 domain-containing protein	NA	A0A2K9V535	Lactobacillus_phage	46.6	2.3e-29
WP_087609351.1|713052_713292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609352.1|713339_713639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042749401.1|713830_714310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084994700.1|714916_715993_+	hypothetical protein	NA	A0A1S5S8Z0	Streptococcus_phage	34.5	1.6e-06
WP_069360247.1|716604_717051_-	universal stress protein	NA	NA	NA	NA	NA
WP_087609354.1|717121_717340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024855813.1|717336_717696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609355.1|717833_718040_+	hypothetical protein	NA	D6PSW6	Lactobacillus_phage	98.0	1.5e-22
WP_087609356.1|718078_718855_+	TerS	NA	D6PSW8	Lactobacillus_phage	91.7	1.8e-108
WP_191980901.1|718823_720155_+|terminase	PBSX family phage terminase large subunit	terminase	D6PSX1	Lactobacillus_phage	98.6	4.3e-166
WP_087609358.1|720171_721533_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	98.7	4.4e-259
WP_087609359.1|721535_722363_+|capsid	minor capsid protein	capsid	D6PSX3	Lactobacillus_phage	97.9	2.1e-131
WP_157662842.1|722385_722655_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSX4	Lactobacillus_phage	100.0	2.5e-25
WP_087609361.1|722666_723770_+	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	98.6	4.5e-177
WP_087609362.1|723784_724249_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	96.8	2.1e-75
WP_087609363.1|724263_725142_+	encapsulin	NA	D6PSX7	Lactobacillus_phage	98.6	1.4e-160
WP_015474101.1|725152_725515_+	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	100.0	3.6e-59
WP_087609364.1|725526_725853_+	DUF4054 domain-containing protein	NA	D6PSX9	Lactobacillus_phage	95.4	5.0e-52
WP_086231916.1|725849_726452_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	88.9	1.3e-98
WP_087609365.1|726451_726826_+	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	98.4	2.9e-67
WP_087609366.1|726818_727289_+	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	97.5	8.6e-61
WP_087609367.1|727301_727637_+	hypothetical protein	NA	D6PSY3	Lactobacillus_phage	89.4	6.6e-39
WP_087609687.1|727759_728083_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	94.4	2.0e-56
WP_155275711.1|728093_728264_+	hypothetical protein	NA	D6PSY6	Lactobacillus_phage	98.1	8.7e-24
WP_087609368.1|728278_734026_+|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	94.5	2.2e-158
WP_015474091.1|734025_734673_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.1	3.4e-108
WP_164508917.1|734684_735077_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	98.5	6.0e-68
WP_191980899.1|735027_736308_+	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	89.3	4.2e-203
WP_043022744.1|736307_736652_+	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	95.6	2.3e-55
WP_087609371.1|736651_737050_+	DUF2634 domain-containing protein	NA	D6PSZ8	Lactobacillus_phage	78.6	1.7e-49
WP_087609372.1|737036_738215_+|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	81.6	2.5e-181
WP_087609373.1|738204_738864_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	82.4	1.4e-72
WP_087609374.1|738866_740399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609375.1|740477_740885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157662844.1|740896_741064_+	XkdX family protein	NA	NA	NA	NA	NA
WP_085763730.1|741167_741521_+	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	67.3	6.5e-37
WP_087609376.1|741510_741873_+	hypothetical protein	NA	D6PSS0	Lactobacillus_phage	63.3	8.4e-32
WP_087609377.1|741884_742403_+|holin	phage holin	holin	D6PSS1	Lactobacillus_phage	92.4	2.0e-79
WP_087609378.1|742402_743455_+	Lyzozyme M1 (1,4-beta-N-acetylmuramidase)	NA	D6PSS2	Lactobacillus_phage	95.7	1.8e-175
WP_087609379.1|743630_744665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609380.1|745107_745479_-	hypothetical protein	NA	NA	NA	NA	NA
745475:745490	attL	TTCATAGGATCACCTC	NA	NA	NA	NA
WP_087609381.1|745489_745792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609382.1|746682_747840_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.1	4.4e-66
748870:748885	attR	GAGGTGATCCTATGAA	NA	NA	NA	NA
>prophage 4
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	752346	768248	2440326	head,capsid,transposase,portal,terminase,tail	Staphylococcus_phage(22.22%)	18	NA	NA
WP_157662846.1|752346_752688_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	38.0	1.2e-11
WP_087609388.1|752901_753312_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	46.6	3.5e-18
WP_086231834.1|754121_754595_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_087609389.1|754591_756289_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	1.1e-121
WP_087609390.1|756248_756446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609391.1|756442_757549_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.3	8.8e-48
WP_087609392.1|757538_759113_+|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	35.0	2.5e-40
WP_087609393.1|759211_759586_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_087609394.1|759600_759870_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_087609395.1|760043_760415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042522391.1|760533_760734_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	1.6e-21
WP_011667984.1|761433_762399_+	VIP2 family actin-ADP-ribosylating toxin	NA	NA	NA	NA	NA
WP_011667983.1|762537_763641_-	anion permease	NA	NA	NA	NA	NA
WP_011667982.1|763710_764373_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_107696654.1|764936_765731_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.3	7.5e-17
WP_011667978.1|765809_766016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041815243.1|766078_767341_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.5e-47
WP_087609396.1|767318_768248_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	3.2e-19
>prophage 5
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	902358	934358	2440326	portal,terminase,capsid,integrase	Lactobacillus_phage(64.0%)	49	913310:913328	924780:924798
WP_087609408.1|902358_903822_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042254516.1|904043_904661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039105853.1|904720_905200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042521213.1|905868_906084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609409.1|906096_906855_+	Rha family transcriptional regulator	NA	A0A1B0YEA7	Lactobacillus_phage	49.0	1.1e-33
WP_087609410.1|907020_907272_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_087609411.1|907340_907595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254508.1|907683_907962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254506.1|908090_908354_+	helix-turn-helix transcriptional regulator	NA	Q8SDV8	Staphylococcus_phage	45.6	1.6e-08
WP_042254504.1|908509_908689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254502.1|908681_909575_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	30.7	1.0e-25
WP_042254500.1|909575_910274_+	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	73.9	1.4e-88
WP_060416827.1|910270_910855_+	DUF669 domain-containing protein	NA	D2KRE3	Lactobacillus_phage	44.4	1.1e-30
WP_042254496.1|910924_911113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060416826.1|911118_911871_+	conserved phage C-terminal domain-containing protein	NA	U5U793	Lactobacillus_phage	38.3	1.3e-31
WP_087609412.1|911871_913116_+	hypothetical protein	NA	A0A2D1GP91	Lactobacillus_phage	35.5	5.8e-56
WP_042254491.1|913108_913522_+	hypothetical protein	NA	NA	NA	NA	NA
913310:913328	attL	GCTAGTTATGTCTGGGATG	NA	NA	NA	NA
WP_052415610.1|913522_914224_+	hypothetical protein	NA	A0A0D4DC57	Staphylococcus_phage	34.4	4.2e-27
WP_087609413.1|914235_914655_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	54.9	1.6e-18
WP_042254487.1|914647_914863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609414.1|914874_915072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609416.1|915240_915486_+	hypothetical protein	NA	D6PSU9	Lactobacillus_phage	59.3	2.6e-16
WP_060463306.1|915482_915944_+	DUF1064 domain-containing protein	NA	A0A2P0ZKV6	Lactobacillus_phage	46.9	1.1e-25
WP_047021008.1|915957_916164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609417.1|916179_916431_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	68.4	1.8e-20
WP_087609418.1|916431_916683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609419.1|916686_917166_+	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	69.8	5.8e-65
WP_087609420.1|917761_918106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609421.1|918140_918437_+	hypothetical protein	NA	O03924	Lactobacillus_phage	65.3	9.3e-29
WP_087609422.1|918449_918773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108477668.1|918869_919322_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.9	3.7e-45
WP_087609423.1|920745_921072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609424.1|921109_922087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609425.1|922113_922872_+|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	51.4	2.1e-61
WP_087609426.1|922877_923465_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.5	2.6e-22
WP_087609427.1|923609_924926_+|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	62.1	4.1e-161
924780:924798	attR	GCTAGTTATGTCTGGGATG	NA	NA	NA	NA
WP_157662847.1|924937_926461_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	38.0	3.3e-77
WP_087609429.1|926381_927317_+	hypothetical protein	NA	A1EAE3	Streptococcus_phage	24.1	6.6e-12
WP_011667862.1|927510_928164_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	53.1	3.5e-28
WP_087609430.1|928175_928577_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	32.7	5.0e-09
WP_087609431.1|928594_929716_+|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	33.5	3.4e-47
WP_087609432.1|929888_930239_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_042254456.1|930235_930748_+	hypothetical protein	NA	L7TME2	Rhizobium_phage	34.1	2.4e-08
WP_087609433.1|930762_931062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254452.1|931076_931460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667855.1|931443_931932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609434.1|931949_933101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042254448.1|933118_933601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609435.1|933731_934358_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	43.2	1.0e-13
>prophage 6
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	1225956	1236634	2440326	tRNA,transposase	Staphylococcus_phage(37.5%)	10	NA	NA
WP_015473763.1|1225956_1226808_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	1.7e-14
WP_087609482.1|1226976_1227618_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_082265283.1|1227904_1229167_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	3.2e-46
WP_024855005.1|1229219_1229711_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.8	1.5e-23
WP_015473768.1|1229727_1230678_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_087609484.1|1230689_1232582_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	3.0e-48
WP_024855004.1|1232610_1233804_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.2	1.9e-35
WP_191980889.1|1233979_1234876_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	1.6e-52
WP_087609486.1|1234993_1236253_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011667553.1|1236358_1236634_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
>prophage 7
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	1284678	1333655	2440326	tRNA,protease,transposase	Bacillus_phage(23.08%)	46	NA	NA
WP_011667510.1|1284678_1286481_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_087609493.1|1286494_1287790_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_114639862.1|1288097_1288640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667506.1|1288808_1289660_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	37.3	1.1e-18
WP_024854989.1|1289683_1290526_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_015473803.1|1290609_1291143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087609254.1|1291139_1292039_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	2.4e-43
WP_011667504.1|1292109_1292751_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_024854988.1|1292862_1293306_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_024854987.1|1293325_1295560_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	43.6	6.2e-08
WP_011667501.1|1295588_1295924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667500.1|1295991_1296744_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_011667499.1|1296746_1297697_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_011667498.1|1297799_1298117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667497.1|1298456_1298840_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011667496.1|1299063_1299426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667495.1|1299921_1300173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082265289.1|1300674_1301856_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_134800309.1|1302498_1303392_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.3	6.2e-60
WP_021357756.1|1303367_1303628_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	46.5	2.8e-13
WP_011667492.1|1303711_1304071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080952784.1|1304113_1304272_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_080504809.1|1304579_1304681_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_015473476.1|1305063_1305993_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	8.5e-20
WP_011667997.1|1306762_1308595_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	27.5	8.6e-24
WP_024855607.1|1308775_1310065_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011667999.1|1310068_1310302_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_011668000.1|1310339_1311548_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.8	1.1e-22
WP_087609495.1|1311547_1313074_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.9	7.4e-37
WP_011668002.1|1313113_1313263_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_087609496.1|1313563_1314703_-	molecular chaperone DnaJ	NA	M1PC06	Moumouvirus	63.6	1.1e-16
WP_011668004.1|1314819_1316679_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.2	2.8e-131
WP_011668005.1|1316718_1317303_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011668006.1|1317323_1318361_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_011668007.1|1318612_1319560_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_011668008.1|1319580_1320492_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011668009.1|1320572_1320923_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015473817.1|1320942_1323285_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	5.1e-21
WP_011668011.1|1323332_1323635_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_011668012.1|1323627_1323924_-	YlxR family protein	NA	NA	NA	NA	NA
WP_087609497.1|1323950_1325156_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011668014.1|1325179_1325653_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_011668015.1|1325779_1326055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668016.1|1326203_1330541_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.6	1.0e-19
WP_011668017.1|1330632_1332342_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015473823.1|1332377_1333655_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 8
NZ_CP021674	Lactobacillus brevis strain SRCM101106 chromosome, complete genome	2440326	1445484	1501833	2440326	tRNA,protease,transposase	unidentified_phage(25.0%)	53	NA	NA
WP_011668185.1|1445484_1445997_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011668186.1|1446296_1447151_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011668187.1|1447137_1448325_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_035464564.1|1448423_1449047_+	copper resistance protein	NA	NA	NA	NA	NA
WP_035465312.1|1449109_1450372_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	5.0e-47
WP_011668189.1|1450824_1452330_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011668190.1|1452358_1453882_-	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_015473902.1|1453915_1454122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191980890.1|1454137_1454500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021741809.1|1454554_1454911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668194.1|1454942_1455332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087609510.1|1455792_1456716_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.4	6.2e-31
WP_087609511.1|1457083_1457980_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_021740943.1|1457976_1458780_-	NAD kinase	NA	NA	NA	NA	NA
WP_011668198.1|1458781_1459441_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_011668199.1|1459754_1460393_+	DsbA family protein	NA	NA	NA	NA	NA
WP_085769115.1|1460554_1461418_+	DegV family protein	NA	NA	NA	NA	NA
WP_015473911.1|1461471_1463277_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_015473912.1|1463343_1464438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473913.1|1464564_1465212_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011668204.1|1465277_1466069_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_011668205.1|1466130_1467357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011668206.1|1467353_1468088_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.5e-23
WP_011668207.1|1468297_1468756_+	HIT family protein	NA	NA	NA	NA	NA
WP_015473917.1|1468758_1469079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668209.1|1469191_1470109_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_015473919.1|1470172_1471147_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_082265308.1|1471159_1473784_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082265492.1|1473773_1474988_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_015473922.1|1475070_1475415_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_087609512.1|1475505_1477602_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011668215.1|1477767_1478235_-	arginine repressor	NA	NA	NA	NA	NA
WP_011668216.1|1478469_1480161_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.0	7.6e-75
WP_011668217.1|1480632_1480854_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_011668218.1|1481187_1482447_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	40.0	1.8e-17
WP_087609513.1|1482507_1483041_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_011668220.1|1483107_1483449_+	YisL family protein	NA	NA	NA	NA	NA
WP_011668221.1|1483662_1484376_-	amino acid racemase	NA	NA	NA	NA	NA
WP_011668222.1|1484382_1485639_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_011668223.1|1485773_1487657_-	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_021742205.1|1487800_1488529_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011668225.1|1488637_1490047_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_011668226.1|1490116_1490353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609514.1|1490500_1492303_-	cell surface protein	NA	NA	NA	NA	NA
WP_011668228.1|1492854_1493106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668230.1|1493841_1496352_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.4	2.9e-139
WP_087609254.1|1496557_1497457_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	2.4e-43
WP_087609515.1|1497453_1497984_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024748245.1|1498069_1498993_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	3.7e-31
WP_011668232.1|1499323_1499617_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015473929.1|1499607_1500126_-	VanZ family protein	NA	NA	NA	NA	NA
WP_011668234.1|1500681_1501158_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107696657.1|1501209_1501833_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP021675	Lactobacillus brevis strain SRCM101106 plasmid pLB1106-3	36203	20147	30671	36203	holin,transposase	Enterococcus_phage(25.0%)	11	NA	NA
WP_011669002.1|20147_20933_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	37.2	5.9e-38
WP_011669001.1|20936_21176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082265520.1|21486_22416_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.4e-25
WP_108477762.1|22856_23669_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.0	7.2e-15
WP_082265522.1|23796_24747_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	1.2e-98
WP_021729931.1|24761_25688_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	31.4	1.9e-35
WP_082265534.1|25794_27942_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.5	7.2e-256
WP_191980908.1|27969_28428_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_021353390.1|28981_29071_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_024272198.1|29196_29556_-	hydrolase	NA	A0A1Q1PP35	Noumeavirus	33.7	6.6e-05
WP_011373852.1|29750_30671_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
