The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	1512013	1523667	5402261	integrase	Enterobacteria_phage(70.0%)	13	1500147:1500161	1523204:1523218
1500147:1500161	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1512013_1514347_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1514358_1514679_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1514675_1514903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1514899_1515457_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1515453_1515720_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1516261_1516999_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1516995_1517241_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1517258_1517825_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|1518393_1518819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1518818_1519769_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1519756_1520947_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1521299_1522553_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1522563_1523667_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1523204:1523218	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	1733222	1780798	5402261	lysis,head,tRNA,transposase	Escherichia_phage(25.93%)	64	NA	NA
WP_004143010.1|1733222_1734608_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1734653_1734866_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1734867_1735734_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_000019445.1|1737411_1738392_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_032431351.1|1738437_1738740_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1738741_1738957_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1738958_1739177_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1739173_1739941_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1739937_1740594_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1740590_1740749_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1740745_1741426_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1741422_1742268_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1742283_1742568_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1742656_1742851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1742950_1743166_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1743516_1744206_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1744333_1744567_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1744607_1744829_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|1745053_1745953_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|1745942_1747373_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|1747372_1747666_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1747662_1748169_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1748275_1749118_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|1749290_1749938_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1750438_1750894_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1750893_1751064_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1751056_1751692_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1751688_1751826_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1751818_1752349_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1752345_1753035_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_022644626.1|1753262_1754309_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151282.1|1755045_1755294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|1755296_1755827_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1755823_1756288_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1756393_1756723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1757093_1757696_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1757695_1759168_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1759180_1760602_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1760576_1761581_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1761622_1762099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1762171_1763557_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1763560_1763989_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1764000_1765095_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1765105_1765345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1765347_1765728_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1765727_1765901_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1765900_1766263_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1766265_1766691_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1766687_1767080_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1767148_1767901_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1767953_1768631_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1768806_1769562_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1769564_1769819_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1770112_1770583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1770599_1770959_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1771058_1771229_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1771218_1771932_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1771997_1772783_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1772910_1773414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1773506_1776953_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|1777052_1777472_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|1777471_1777942_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1777938_1778334_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1778320_1780798_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 3
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	2225907	2263243	5402261	terminase,tail,plate,portal,capsid,head,lysis,integrase	Salmonella_phage(84.62%)	46	2225815:2225833	2263315:2263333
2225815:2225833	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|2225907_2226960_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|2227378_2228863_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|2228961_2229906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2229917_2230796_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|2230941_2231163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|2231195_2231705_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|2231712_2231913_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_087758653.1|2231876_2232218_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_004150864.1|2232285_2232519_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|2232518_2232746_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|2232742_2233600_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|2233596_2236011_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|2236164_2236353_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|2236363_2236597_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|2236711_2237389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|2237664_2239407_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|2239468_2240494_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|2240493_2242260_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|2242402_2243236_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|2243252_2244311_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|2244314_2244965_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|2245060_2245525_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|2245524_2245728_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|2245731_2245947_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|2245927_2246437_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|2246441_2246825_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|2246821_2247250_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|2247345_2247777_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|2247769_2248216_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|2248212_2248905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|2248999_2249572_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|2249568_2249931_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|2249917_2250826_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|2250818_2251418_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|2251419_2254371_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|2254374_2255106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|2255102_2255306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|2255335_2256412_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|2256550_2257723_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|2257732_2258248_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|2258300_2258600_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|2258614_2258734_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|2258726_2261354_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|2261350_2261836_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|2261832_2262933_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|2263024_2263243_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
2263315:2263333	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	2297659	2307123	5402261	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|2297659_2298775_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|2298771_2300712_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|2300788_2301010_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2301335_2301653_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2301683_2303963_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2304083_2304302_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|2304655_2305357_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_087758654.1|2305401_2307123_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.8	3.4e-14
>prophage 5
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	2695929	2746821	5402261	holin,terminase,tail,transposase,integrase	Klebsiella_phage(23.4%)	61	2687907:2687922	2710746:2710761
2687907:2687922	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004140269.1|2695929_2696739_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2696740_2697733_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2697732_2698623_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|2698799_2699987_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|2700194_2700857_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2700853_2701282_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2701278_2701959_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2701960_2702248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2702244_2703090_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2703105_2703390_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2703478_2703673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2704101_2704305_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2704386_2705463_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|2705608_2705728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|2705750_2706449_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2706560_2706788_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2706828_2707050_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2707135_2707996_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2707992_2708841_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2708837_2709140_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2709195_2709441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2709648_2710677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|2711197_2711665_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
2710746:2710761	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004243010.1|2711645_2711813_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2711809_2712478_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2712470_2713109_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2713105_2713246_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2713245_2713935_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|2714584_2714884_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2714880_2715420_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|2715416_2715761_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2715757_2716033_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2716991_2717237_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2718099_2719104_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|2719081_2720389_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|2720388_2721789_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|2721772_2722885_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004217351.1|2723415_2724201_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2724211_2725165_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217348.1|2725486_2725882_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|2725883_2726138_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|2726147_2726381_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2726367_2726751_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|2726752_2727304_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|2727300_2727693_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2727716_2728889_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2728942_2729425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|2729562_2729769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2729845_2730202_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|2730426_2730618_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|2730879_2733777_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|2733860_2734196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2734510_2734975_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2735155_2735638_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2735647_2736028_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2736024_2739093_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|2739169_2742124_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|2742127_2742859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2743083_2743683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2743924_2745868_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2746116_2746821_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	2751086	2761566	5402261	transposase	Escherichia_phage(22.22%)	9	NA	NA
WP_001389365.1|2751086_2751851_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|2752027_2752732_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|2753324_2753747_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|2754644_2756129_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|2756554_2758039_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2758118_2758538_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2758539_2759805_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2759880_2760708_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2760894_2761566_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 7
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	2794499	2834271	5402261	terminase,transposase,integrase	uncultured_Caudovirales_phage(35.42%)	57	2792580:2792594	2801520:2801534
2792580:2792594	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2794499_2795261_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2795477_2797010_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2797208_2797757_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2797953_2799135_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2799115_2799358_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2799536_2800016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2800012_2800225_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2800221_2800446_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2800435_2801146_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2801151_2801670_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2801520:2801534	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2801774_2802602_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2802598_2802793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2802789_2803215_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2803211_2803430_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2803401_2803656_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2803648_2804014_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2804183_2804372_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2804364_2804679_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2804849_2805518_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2805615_2805837_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2806413_2808072_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2808073_2809036_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2809032_2809509_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2809505_2810288_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2810693_2810942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2810944_2811475_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2811471_2811861_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2812095_2812416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2812517_2813270_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2813220_2814621_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2814858_2816310_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2816365_2816914_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2816965_2818168_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2818171_2818666_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2818677_2819619_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2819658_2819940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2819908_2820328_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2820324_2820831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2820830_2821217_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2821311_2821752_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2821755_2822901_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2822911_2823202_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2823142_2824335_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2824661_2825087_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2825122_2825275_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2825264_2827268_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2827267_2827867_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2827867_2828170_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2828172_2829195_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2829194_2829536_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2829585_2829768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2829810_2830377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2830430_2831084_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2831085_2831439_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2831438_2832635_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2832631_2833405_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2833404_2834271_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 8
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	3057489	3070565	5402261	transposase	Escherichia_phage(88.89%)	11	NA	NA
WP_000019473.1|3057489_3058470_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004160175.1|3058891_3059674_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_002210516.1|3059678_3060299_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|3060291_3061557_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|3061568_3062471_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|3062731_3063493_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|3063513_3064374_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|3064671_3064932_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|3065018_3066107_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|3066137_3067403_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|3067457_3070565_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 9
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	3726887	3769986	5402261	tRNA,transposase,plate	Microcystis_virus(25.0%)	40	NA	NA
WP_002910404.1|3726887_3728144_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3728414_3729026_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|3729022_3729874_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3730057_3731005_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3731129_3732809_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3732809_3733856_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3734078_3734354_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3734626_3735211_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3735328_3736420_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3736502_3736712_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3736913_3737828_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3737959_3739375_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3739394_3739838_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|3739840_3740377_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|3740357_3741404_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3741403_3743167_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3743300_3746711_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3746694_3747852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3747855_3748122_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|3748419_3748677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|3748865_3749102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3749225_3750206_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3750542_3751433_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3751608_3752502_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|3752677_3753571_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|3753754_3754648_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|3754669_3754975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|3754998_3756108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|3756213_3756444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3756489_3756996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3756992_3757322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3757318_3757501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|3757642_3758566_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|3760216_3760726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3760962_3761469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3761465_3761975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3761975_3763331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|3766294_3767992_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3767995_3768649_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3768645_3769986_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	4038873	4046498	5402261		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|4038873_4039875_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|4040068_4041235_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|4041415_4041970_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|4041984_4042875_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|4042906_4043776_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|4043802_4044867_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|4045091_4046498_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 11
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	4083065	4089972	5402261	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|4083065_4084544_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|4084540_4085263_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|4085581_4086943_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|4087188_4088082_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|4088324_4089098_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|4089108_4089972_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 12
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	4496317	4577837	5402261	tRNA,terminase,tail,plate,portal,coat,capsid,head,lysis,integrase	Salmonella_phage(70.0%)	87	4541021:4541067	4579498:4579544
WP_002914079.1|4496317_4497055_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4497186_4498518_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4498563_4498947_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4499260_4499950_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4500007_4501093_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4501296_4501722_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4501791_4502490_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_032431361.1|4502524_4505185_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4505305_4506661_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4506702_4507026_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4507029_4508328_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4514293_4516867_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4516996_4517728_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4517724_4518705_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4518836_4519574_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4519844_4520180_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4520286_4520334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4520434_4521595_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4521591_4522464_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4522526_4523648_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4523657_4524728_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4525070_4525580_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4525572_4526796_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_032431362.1|4526809_4527292_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4527300_4528671_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4528727_4529186_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4529305_4529653_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4529692_4530460_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4530491_4531040_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4531058_4531307_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4531566_4532931_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4533094_4533886_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4533905_4535192_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4535311_4535902_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4536026_4536905_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4536991_4538653_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4538800_4539142_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4539208_4539499_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4539488_4539965_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4540075_4540558_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4541021:4541067	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4541161_4541539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4541566_4541785_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4541851_4542946_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4542942_4543428_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|4543424_4546055_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|4546047_4546167_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4546181_4546481_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4546533_4547049_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4547058_4548231_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4548379_4549453_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4549504_4550623_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4550632_4552582_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4552583_4553255_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4553247_4554156_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4554142_4554505_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4554501_4555074_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4555168_4556035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4556057_4556504_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4556496_4556919_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|4557014_4557443_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4557439_4557823_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4557827_4558337_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4558317_4558533_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4558536_4558740_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4558739_4559204_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4559299_4559953_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4559956_4561009_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4561025_4561859_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4561999_4563763_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4563762_4564806_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4564862_4565132_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|4565653_4566655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4566654_4567734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4567720_4568404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4568499_4568733_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4568744_4568933_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004152765.1|4569040_4570525_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151012.1|4571005_4573390_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4573386_4574238_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4574234_4574462_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4574461_4574695_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4574762_4575101_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4575064_4575265_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4575272_4575782_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4575814_4576057_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4576179_4576809_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4576811_4577837_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4579498:4579544	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP021539	Klebsiella pneumoniae strain AR_0047, complete genome	5402261	5296997	5345840	5402261	tRNA,terminase,tail,protease,portal,capsid,head	uncultured_Caudovirales_phage(66.67%)	54	NA	NA
WP_002918465.1|5296997_5297492_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|5297495_5298134_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|5298445_5298838_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|5298853_5299282_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|5299547_5300675_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|5300865_5301264_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|5301437_5302805_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|5302892_5303951_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|5304087_5305026_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|5305440_5305911_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|5306286_5306550_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|5306648_5306915_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|5306965_5307241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|5307320_5309288_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|5309293_5310226_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|5310233_5310437_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|5310568_5311498_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|5311533_5312979_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|5313067_5316865_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|5316902_5318372_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|5318374_5318956_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|5318963_5319452_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|5319451_5320444_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|5320514_5321558_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|5321863_5323804_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|5323883_5324075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|5324303_5325305_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|5325304_5325913_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|5326136_5326589_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|5326611_5327079_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|5327089_5328439_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|5328549_5328792_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|5328781_5330233_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|5330244_5331126_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|5331483_5332449_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|5332473_5332770_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|5332923_5333115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|5333117_5334779_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|5334762_5335119_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|5335394_5335838_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|5335837_5336137_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|5336133_5336469_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|5336465_5337707_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|5337708_5338269_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|5338320_5339487_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|5339750_5340263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|5340311_5340647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|5340989_5343125_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|5343124_5343490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|5343486_5343855_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|5343851_5344166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|5344158_5344347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|5344339_5344609_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|5345060_5345840_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP021540	Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence	201874	33012	60979	201874	transposase,protease	Escherichia_phage(37.5%)	22	NA	NA
WP_020314316.1|33012_34359_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|36201_37164_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|37150_37900_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|38137_38335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|38334_41130_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|41244_41814_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|41848_42130_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|42373_42637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|42651_42915_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|44116_45097_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|46305_47175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|47168_48179_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|48187_49015_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|49023_49887_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|49883_50711_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_001067855.1|51566_52271_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|53605_54610_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_085955245.1|55444_56636_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_000219391.1|56997_57903_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|57899_59138_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|59137_59722_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|60214_60979_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP021540	Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence	201874	66398	115361	201874	integrase,transposase	Stx2-converting_phage(20.0%)	36	87505:87522	118164:118181
WP_000845039.1|66398_67412_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|67614_67965_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|68090_68651_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|68653_71620_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|71686_72064_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|72264_72924_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000333416.1|74540_74813_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004118216.1|74812_76201_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000005560.1|76193_77306_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|77302_77938_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_020956879.1|78485_78872_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004152557.1|78868_79216_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|83038_84772_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|84779_85727_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|85771_87376_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|87388_88309_-	ABC transporter permease	NA	NA	NA	NA	NA
87505:87522	attL	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
WP_004152279.1|88308_89157_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|89153_89747_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|89743_90871_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|91155_91323_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|92425_92947_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004118237.1|92943_93897_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|93982_96307_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|96351_97254_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|97250_98249_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|98245_99202_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|99202_99970_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|100068_100362_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|100692_100935_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|101232_102237_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|102640_103651_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|104111_105194_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|105315_108390_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|108441_109695_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|111400_113710_+	ATPase	NA	NA	NA	NA	NA
WP_000019473.1|114380_115361_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
118164:118181	attR	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP021541	Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence	111531	0	19749	111531	transposase	Enterobacteria_phage(27.27%)	22	NA	NA
WP_004197772.1|358_1321_+	Abi family protein	NA	NA	NA	NA	NA
WP_047353183.1|1477_1951_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_016338361.1|2663_3587_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_004197750.1|4105_5080_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.6	8.1e-106
WP_004152349.1|5076_6282_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004197749.1|6603_7500_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	2.5e-69
WP_004197744.1|7900_9172_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	1.2e-154
WP_004197746.1|9171_9603_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
WP_004194318.1|10011_11496_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_001568038.1|11744_12716_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_032431399.1|12718_13390_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_009309993.1|13453_13684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194746.1|14291_14525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194745.1|14521_14857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|15242_15944_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568042.1|15943_16165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144453.1|16174_16594_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032431402.1|16647_17415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152356.1|18095_18524_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001568046.1|18566_19073_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_001568047.1|19115_19307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568048.1|19488_19749_+	DNA polymerase III, theta subunit	NA	H9C187	Pectobacterium_phage	50.0	6.3e-13
>prophage 2
NZ_CP021541	Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence	111531	22792	34314	111531	transposase	Escherichia_phage(25.0%)	16	NA	NA
WP_009310029.1|22792_23356_+	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	4.4e-19
WP_032431381.1|24186_24729_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	1.0e-49
WP_032431380.1|24777_25026_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_044531953.1|25095_27153_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
WP_001568057.1|27197_27629_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_020323772.1|27625_28354_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_023329033.1|28350_28677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280872.1|28732_29107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310022.1|29307_29817_+|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
WP_000019445.1|30059_31040_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_019706020.1|31132_31345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|31355_31580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|31660_31981_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|31970_32249_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|32249_32663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152492.1|33492_34314_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 3
NZ_CP021541	Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence	111531	69091	103200	111531	transposase	Escherichia_phage(43.75%)	34	NA	NA
WP_015065543.1|69091_69817_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_015065544.1|69972_70566_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_096030814.1|70732_71329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|71378_72023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032431407.1|72078_72729_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_015065549.1|72725_73034_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_022644723.1|73442_76448_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.6	0.0e+00
WP_001217881.1|76611_77169_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|77351_78212_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000019473.1|78885_79866_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_050597717.1|79979_80249_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014386216.1|80460_80538_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631532.1|80530_81082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065551.1|81074_82088_+	replication protein	NA	NA	NA	NA	NA
WP_011977766.1|83075_83411_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|83583_83865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|83918_84530_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001067855.1|84920_85625_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|85636_86293_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|86388_87573_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|87667_88777_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|89266_89971_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011117369.1|90527_91388_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|91684_91945_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620097.1|92031_93120_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001067855.1|94092_94797_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386219.1|94881_95187_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	42.9	1.3e-06
WP_004194048.1|95846_97028_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|97454_97769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|98023_98380_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|98369_98771_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|98767_99058_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_071567536.1|99113_100160_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|100233_103200_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
>prophage 1
NZ_CP021542	Klebsiella pneumoniae strain AR_0047 plasmid tig00000003, complete sequence	43379	29259	39557	43379	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|29259_32277_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|33485_34388_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|34649_35411_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|35431_36292_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|36428_37133_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|37525_37765_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|37851_38514_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|38894_39557_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
