The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	220810	318715	4862952	terminase,tail,plate,transposase,portal,integrase,holin,tRNA,lysis,capsid,head,protease	Escherichia_phage(47.06%)	99	230510:230545	327600:327635
WP_000187022.1|220810_221911_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|221950_222310_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|222309_222960_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|223290_224691_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|224673_225591_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|225857_227231_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|227291_228068_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|228075_229080_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|229233_230385_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
230510:230545	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|230982_233634_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|233815_235549_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|235763_236615_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|236601_236943_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|236944_237823_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|237788_240086_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|240136_240457_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|240471_241551_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|241859_244361_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|244372_245035_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|245045_246149_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|246423_247041_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|247067_247973_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|248065_250246_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|250574_251465_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|251813_254246_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|254248_255409_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|255685_256003_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|256186_256795_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|256855_257068_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|257270_259469_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|259624_260650_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|260741_261701_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|261793_262324_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|262333_263665_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|263731_264658_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|264750_265236_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|265320_265566_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|265990_266836_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|266858_268367_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|268501_269512_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|269608_270355_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|270359_270788_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|270814_271114_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|271325_271766_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|271866_272466_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|272573_273341_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|273395_274151_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|274257_275247_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|275566_276529_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|276709_277612_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|277819_278332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|278605_279975_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|280047_280266_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|280347_281511_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|281510_281990_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|282004_284452_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|284444_284564_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|284596_284872_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|284928_285447_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|285459_286650_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|286709_287312_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|287319_288855_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|288903_289251_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|289247_289652_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|289793_290309_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|290323_290926_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|290897_291314_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_001285346.1|292608_293220_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|293212_294121_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|294125_294473_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|294469_295105_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|295171_295624_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|295616_296084_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001440152.1|296046_296220_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040631.1|296191_296617_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000736582.1|296604_297030_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_001144097.1|297044_297542_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|297541_297823_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|297826_298030_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|298029_298539_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024176422.1|298638_299382_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_001248567.1|299385_300459_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085956.1|300517_301372_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156872.1|301545_303318_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|303317_304352_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000012516.1|304723_307207_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001016257.1|308524_309271_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|309285_310827_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|312301_312577_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|312573_312798_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|312797_313100_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|313099_313324_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|313387_313888_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|314057_314330_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|314466_314760_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|314829_315810_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|315996_316497_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|316646_317345_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|317341_318715_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
327600:327635	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 2
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	1654386	1664846	4862952		Escherichia_phage(71.43%)	9	NA	NA
WP_000081550.1|1654386_1655379_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1655472_1656837_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1656925_1657702_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1657706_1658345_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1658341_1659604_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1659600_1660509_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1660704_1661472_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1661522_1662179_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1662284_1664846_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	1744469	1753878	4862952	transposase	Enterobacteria_phage(87.5%)	10	NA	NA
WP_039023138.1|1744469_1746803_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|1746817_1747138_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_039023137.1|1747273_1747729_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_001244665.1|1747721_1748009_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_001149160.1|1748596_1748863_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_002431311.1|1749203_1750745_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|1750759_1751506_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001283035.1|1752000_1752735_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_000638635.1|1752731_1753232_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446128.1|1753305_1753878_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
>prophage 4
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	2281684	2291127	4862952		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|2281684_2282611_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|2282615_2283347_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2283327_2283435_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|2283494_2284226_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|2284447_2286133_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|2286129_2286849_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|2286895_2287366_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|2287407_2287869_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|2287993_2289994_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|2289990_2291127_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 5
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	3282547	3338589	4862952	terminase,tail,portal,integrase,holin,capsid,tRNA,head	Escherichia_phage(45.45%)	61	3290739:3290753	3338691:3338705
WP_001297484.1|3282547_3283654_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3283689_3284331_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3284334_3285705_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|3285873_3286545_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3286544_3288005_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3288080_3289202_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|3289250_3290477_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3290726_3291863_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3290739:3290753	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3291846_3292710_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|3293264_3293933_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|3294170_3294701_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|3295434_3295806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|3296114_3297623_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|3301576_3302176_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|3302243_3305723_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|3305783_3306392_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|3306328_3307072_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|3307077_3307776_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|3307775_3308132_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|3308109_3311337_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|3311383_3311644_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|3311685_3312072_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|3312071_3312776_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|3312836_3313181_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|3313177_3313627_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|3313623_3313962_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|3313970_3314288_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|3314364_3315582_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|3316187_3317414_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|3317561_3319319_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|3319318_3319801_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|3319948_3320299_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|3320824_3321118_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|3321208_3321391_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|3321607_3322141_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|3322204_3322555_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|3322559_3322775_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|3323082_3323271_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|3323531_3323867_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|3323937_3324150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|3324638_3324725_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|3325119_3325941_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|3325937_3326318_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|3326318_3327377_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|3327378_3327657_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|3327824_3328037_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|3329071_3329254_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|3329347_3329704_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|3329761_3330184_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3330224_3331295_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3331366_3331792_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3331775_3332018_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3332409_3332748_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|3333179_3333380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3333472_3333691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|3333655_3333859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3334259_3334448_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|3334444_3334636_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3334729_3337171_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|3337232_3337502_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|3337470_3338589_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
3338691:3338705	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	4269020	4329695	4862952	terminase,tail,transposase,portal,integrase,lysis,protease	Enterobacteria_phage(42.31%)	69	4270390:4270438	4315159:4315207
WP_000772656.1|4269020_4270229_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
4270390:4270438	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_039023233.1|4270867_4271710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023231.1|4272210_4272408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371964.1|4273103_4273685_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023230.1|4273662_4274544_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_072240810.1|4275221_4275350_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086708942.1|4275404_4279163_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_001230375.1|4279227_4279827_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_039023163.1|4279896_4283394_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_032158484.1|4283454_4284102_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032151194.1|4283999_4284743_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|4284748_4285447_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039023164.1|4285456_4285786_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_039023165.1|4285785_4288851_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|4288822_4289152_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4289160_4289547_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021560209.1|4289607_4290351_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|4290361_4290763_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|4290759_4291338_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|4291349_4291625_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140705.1|4291617_4291941_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_023277783.1|4292027_4294055_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_052249886.1|4294038_4295508_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|4295507_4295720_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|4295716_4297819_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|4297818_4298310_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|4298985_4299138_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|4299125_4299593_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|4299589_4300087_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4300086_4300302_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4300369_4301422_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4301572_4301776_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|4302044_4302986_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|4303007_4303457_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|4303492_4303861_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_039023166.1|4303875_4304865_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|4304872_4305682_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|4305701_4306091_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|4306087_4306414_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|4306410_4307064_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_001393497.1|4307063_4307558_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_039023167.1|4307554_4308541_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
WP_001250272.1|4308530_4308710_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|4308885_4309437_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|4309429_4309690_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|4309787_4310480_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|4311182_4311545_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4311610_4312435_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|4312562_4313099_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|4313089_4313452_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|4313451_4313757_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_077873866.1|4313672_4314107_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_039023168.1|4313983_4315147_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	1.7e-227
WP_000893278.1|4315351_4316605_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
4315159:4315207	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4316616_4317720_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|4318007_4319063_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|4319101_4319503_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|4319560_4320805_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4320896_4321355_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|4321615_4323073_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|4323129_4323666_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|4323598_4323865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|4324170_4324623_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|4324632_4325031_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554758.1|4325033_4325327_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4325378_4326434_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|4326504_4327275_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|4327234_4328974_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|4329197_4329695_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021691	Escherichia coli strain AR_0151, complete genome	4862952	4337953	4410796	4862952	protease,plate,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|4337953_4339090_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|4339520_4339913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|4339890_4344123_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|4344198_4346340_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|4346549_4347068_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4347762_4348263_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4348297_4348522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|4348572_4350048_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|4350054_4350468_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|4350471_4352322_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4352285_4353368_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|4353392_4354673_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4354669_4355194_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|4355196_4356528_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|4356532_4357294_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|4357302_4360068_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|4360064_4360808_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|4360812_4362225_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|4362333_4365768_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|4365778_4367131_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4367154_4367637_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|4367680_4368595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|4368604_4369084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|4369220_4370006_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|4370542_4371274_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|4371338_4371806_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|4371802_4372525_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4372558_4373314_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4373385_4374744_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|4374791_4375415_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|4375418_4376219_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|4376459_4377374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039023238.1|4377370_4378174_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_001140187.1|4383933_4384509_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|4384696_4385728_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|4385720_4386374_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|4386413_4387229_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4387346_4387751_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4387747_4388455_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|4388566_4390285_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|4390338_4391163_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|4391362_4392073_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|4392086_4392509_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4392505_4393051_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4393216_4393417_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4393403_4393664_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|4393712_4395011_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|4395075_4395465_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4395521_4397663_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4397761_4398721_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4398733_4402216_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4402252_4402849_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|4402845_4403994_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4403993_4404782_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4404785_4405241_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4405345_4406371_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4406374_4406860_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4406981_4409414_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4409443_4410796_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP021693	Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence	50228	5279	15789	50228	transposase	Enterobacteria_phage(37.5%)	10	NA	NA
WP_001143760.1|5279_8285_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|8448_9006_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|9188_10049_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_005015281.1|10309_10489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|10608_11235_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457515.1|11446_12718_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000109071.1|12717_13155_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|13151_13400_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_001134370.1|13794_14721_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086153.1|15105_15789_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
