The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	205653	306819	4372742	integrase,protease,capsid,terminase,portal,tail,tRNA,lysis,head,transposase,holin,plate	Salmonella_phage(30.23%)	103	259639:259692	290190:290243
WP_004249698.1|205653_206751_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_004249699.1|206872_207274_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004246383.1|207273_207954_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_004246384.1|208154_209552_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004249700.1|209543_210461_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004246386.1|210695_212078_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_004246387.1|212170_213382_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_004246388.1|213446_214220_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_036970484.1|214240_215245_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_004249702.1|215345_216509_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004246391.1|216600_218325_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
WP_004246392.1|218889_219711_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_004246394.1|219707_220157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246396.1|220156_221338_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004246397.1|221413_222427_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004246398.1|223196_224699_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
WP_049199257.1|224709_226140_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.4	2.1e-62
WP_087726265.1|226179_227163_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004246402.1|227219_229856_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004246404.1|230328_230490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246405.1|230568_231087_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_004249705.1|231209_233648_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_004249895.1|233657_234818_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004246409.1|235103_235421_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_004246411.1|236407_236620_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004249709.1|236823_239025_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_004249710.1|239277_240309_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_004246415.1|240379_241174_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004246416.1|241284_241815_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004246417.1|241827_243168_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004249712.1|243266_244184_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246419.1|244292_244811_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_012368679.1|244904_245147_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246421.1|245443_246259_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_004246422.1|246301_247834_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246423.1|247944_249129_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_004246424.1|249467_250214_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004249714.1|250274_250703_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_004249715.1|250814_251450_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_004249716.1|251556_252327_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_004249717.1|252422_253427_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004246429.1|253720_254698_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036895948.1|255231_255987_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_087726266.1|256105_257254_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_085940413.1|258070_259160_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
259639:259692	attL	AAGGGCAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_081353461.1|259814_260048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064505875.1|260233_260437_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	6.6e-10
WP_006536728.1|260483_260702_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	70.3	2.2e-19
WP_064505876.1|260754_261852_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.1	2.3e-112
WP_087726267.1|261851_262316_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	60.6	4.4e-41
WP_087726268.1|262315_265150_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	38.1	3.3e-99
WP_072070684.1|265142_265316_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
WP_087726269.1|265276_265624_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.0e-18
WP_087726270.1|265643_266159_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	58.5	1.6e-55
WP_087726271.1|266162_267335_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.9	6.5e-166
WP_087726272.1|267436_269065_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	44.9	6.9e-57
WP_036907674.1|269054_269666_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	1.1e-76
WP_087726273.1|269658_270567_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	5.6e-109
WP_036907670.1|270568_270907_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_087726274.1|270903_271530_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.1	4.5e-57
WP_087726275.1|271595_272231_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.0e-28
WP_087726276.1|272220_272655_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	50.0	9.1e-33
WP_087726277.1|272629_273133_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
WP_087726278.1|273129_273534_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	4.6e-39
WP_087726279.1|273526_273841_-|holin	holin	holin	NA	NA	NA	NA
WP_012368195.1|273860_274067_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_087726280.1|274066_274522_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_087726281.1|274599_275268_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	9.4e-45
WP_087726282.1|275267_276413_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.1	1.5e-127
WP_049256947.1|276428_277238_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.4	6.8e-66
WP_087726283.1|277410_279165_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	1.8e-260
WP_087726284.1|279164_280193_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.1e-136
WP_087726285.1|280236_280578_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_049220095.1|280579_281554_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.9	1.5e-54
WP_087726286.1|281869_282265_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087726287.1|282335_283016_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	27.2	2.4e-16
WP_087726289.1|283222_285601_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.0	1.0e-162
WP_087726290.1|285600_285924_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_087726291.1|285923_286751_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	8.8e-61
WP_087726292.1|286752_286974_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	3.4e-12
WP_006536692.1|286966_287224_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_087726293.1|287241_287637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726294.1|287686_287962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|287971_288124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908539.1|288120_288309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220107.1|288310_288583_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	56.7	1.6e-22
WP_049220109.1|288706_289000_+	transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	51.5	3.4e-23
WP_087726295.1|289066_290047_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	63.2	4.3e-115
WP_004249721.1|290340_290907_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
290190:290243	attR	AAGGGCAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_004246432.1|291090_291789_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_036919531.1|291801_293193_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_049256316.1|294590_295628_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_036919527.1|295636_296335_+	WbqC family protein	NA	NA	NA	NA	NA
WP_036919524.1|296347_297319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919521.1|297323_298319_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036919514.1|298803_299928_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_109937988.1|300422_301148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919507.1|301137_302370_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_052124577.1|302394_303498_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_036919505.1|303499_304279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919501.1|304295_305462_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	3.8e-118
WP_036919498.1|305491_306283_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	41.3	2.3e-18
WP_004246449.1|306315_306819_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	1475333	1491877	4372742	integrase	Morganella_phage(61.54%)	20	1476588:1476604	1497513:1497529
WP_017827221.1|1475333_1476206_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	1.1e-34
1476588:1476604	attL	GGGGGCATAATTGGGGG	NA	NA	NA	NA
WP_049257510.1|1476638_1477850_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.0	7.7e-130
WP_152691671.1|1478057_1478975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049257508.1|1479091_1479310_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	8.6e-08
WP_049257507.1|1479309_1479705_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	9.5e-29
WP_049257506.1|1479719_1480313_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	76.1	8.5e-82
WP_080972384.1|1480333_1481365_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	52.8	1.6e-80
WP_071843629.1|1481357_1481531_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_049257505.1|1481533_1481728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907509.1|1481724_1481934_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_053087955.1|1481930_1482515_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	57.1	2.0e-27
WP_049257504.1|1482684_1482870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049257503.1|1482869_1483466_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	4.9e-29
WP_036900269.1|1483480_1483825_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	2.8e-45
WP_049257501.1|1483821_1486569_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.9	2.1e-228
WP_036907521.1|1486888_1487326_+	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	57.4	5.6e-14
WP_036900262.1|1487400_1487931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|1488115_1488289_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036900256.1|1488288_1488630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049257498.1|1488646_1491877_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	41.6	1.2e-100
1497513:1497529	attR	GGGGGCATAATTGGGGG	NA	NA	NA	NA
>prophage 3
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	1677334	1738543	4372742	integrase,protease,capsid,portal,terminase,tail,tRNA,lysis,head,holin,plate	Salmonella_phage(31.43%)	74	1686552:1686576	1716008:1716032
WP_036905155.1|1677334_1678321_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_026090407.1|1678581_1678857_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004244035.1|1679164_1679572_+	membrane protein	NA	NA	NA	NA	NA
WP_004244033.1|1679672_1680191_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244032.1|1680298_1681240_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244030.1|1681273_1681981_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244029.1|1681990_1683724_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_096043105.1|1683895_1684993_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_049213452.1|1685002_1686517_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.2	4.1e-88
1686552:1686576	attL	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_087726416.1|1686685_1687669_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.2	8.2e-98
WP_012368214.1|1687735_1688035_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
WP_012368213.1|1688137_1688413_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	47.0	3.7e-16
WP_104836870.1|1688430_1688616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|1688612_1688765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908537.1|1688774_1689050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220105.1|1689099_1689495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049256968.1|1689512_1689770_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_036907622.1|1689762_1689984_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.0e-12
WP_087726417.1|1689985_1690294_+	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	41.1	6.5e-09
WP_087726418.1|1690293_1691121_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	1.0e-61
WP_087726419.1|1691120_1691444_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_087726420.1|1691443_1693822_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.2	1.0e-162
WP_087726421.1|1693928_1694138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726422.1|1694752_1695781_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.1e-136
WP_087726283.1|1695780_1697535_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	1.8e-260
WP_036907650.1|1697707_1698517_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.6e-65
WP_087726423.1|1698532_1699678_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.2	1.5e-127
WP_012368197.1|1699677_1700346_+|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_087726424.1|1700423_1700879_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_012368195.1|1700878_1701085_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_080972378.1|1701104_1701419_+|holin	holin	holin	NA	NA	NA	NA
WP_049256933.1|1701411_1701843_+	M15 family metallopeptidase	NA	A0A193GZ39	Escherichia_phage	58.0	3.4e-40
WP_087726425.1|1701839_1702343_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_087726426.1|1702317_1702755_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	48.6	3.5e-32
WP_087726427.1|1702744_1703383_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	36.3	4.0e-29
WP_052124641.1|1703450_1703837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726428.1|1703950_1704583_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.6	1.2e-57
WP_036907670.1|1704579_1704918_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_087726429.1|1704919_1705828_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.2	3.6e-108
WP_087726430.1|1705820_1706432_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.9	6.5e-77
WP_087726431.1|1708151_1709324_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	3.8e-166
WP_087726432.1|1709327_1709843_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.1	6.5e-54
WP_087726433.1|1709862_1710210_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.4	9.2e-20
WP_075204427.1|1710170_1710344_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_087726434.1|1710336_1713171_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.1	2.6e-112
WP_036907694.1|1713170_1713635_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_087726435.1|1713634_1714732_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.4	3.5e-113
WP_012368178.1|1714784_1715003_+	positive regulator of phage late gene transcription	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_087726436.1|1715034_1715739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827173.1|1716282_1716642_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
1716008:1716032	attR	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_017827172.1|1716804_1717353_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_049213453.1|1717568_1718051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213455.1|1718023_1718764_-	response regulator	NA	NA	NA	NA	NA
WP_004244018.1|1718989_1719490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213457.1|1719462_1720209_-	membrane protein	NA	NA	NA	NA	NA
WP_004244016.1|1720726_1721263_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_017827170.1|1721321_1722080_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_036918776.1|1722063_1724628_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_026164610.1|1724631_1725975_+	fimbrial usher protein StbD	NA	NA	NA	NA	NA
WP_004244011.1|1725940_1726669_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_004244007.1|1726937_1727147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244005.1|1727454_1727664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|1728165_1728714_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_087726437.1|1729176_1729629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049210250.1|1729634_1732103_+	sugar transporter	NA	NA	NA	NA	NA
WP_049210248.1|1732160_1733021_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_004244000.1|1733087_1733924_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036971209.1|1735011_1735698_+	membrane protein	NA	NA	NA	NA	NA
WP_012368174.1|1735772_1736333_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004248514.1|1736310_1736658_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012368173.1|1736842_1737088_+	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248513.1|1737200_1737440_-	YecH family protein	NA	NA	NA	NA	NA
WP_004243991.1|1737584_1737800_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004243990.1|1738051_1738543_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 4
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2009265	2028540	4372742	lysis,tail,holin	Escherichia_phage(26.67%)	22	NA	NA
WP_087726458.1|2009265_2010081_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	4.6e-54
WP_087726459.1|2010462_2010762_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243635.1|2010764_2011169_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
WP_036895256.1|2011165_2011615_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012368090.1|2011651_2012164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036971123.1|2012172_2013660_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368088.1|2013670_2014123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|2014182_2014641_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_036971125.1|2014723_2017027_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	5.4e-15
WP_036971128.1|2017029_2017524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|2017529_2017850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|2017818_2018631_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|2018633_2019326_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|2019322_2019667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628010.1|2019659_2020847_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243615.1|2020843_2021500_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_087726460.1|2022828_2023182_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	29.2	5.7e-09
WP_017628013.1|2023286_2023466_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004250729.1|2024034_2024577_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_004243611.1|2024692_2025469_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|2025472_2026090_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_087726461.1|2026101_2028540_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.3	7.2e-260
>prophage 5
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2197150	2256309	4372742	integrase,terminase,tail,tRNA,transposase,holin	Escherichia_phage(25.0%)	59	2187758:2187772	2221029:2221043
2187758:2187772	attL	AAAAAATGAAATTAA	NA	NA	NA	NA
WP_087726471.1|2197150_2199202_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_004243408.1|2199143_2199341_-	YpfN family protein	NA	NA	NA	NA	NA
WP_004248280.1|2199438_2199813_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004250835.1|2199829_2200498_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004248276.1|2200494_2201625_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_004248275.1|2201630_2202002_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_004248274.1|2202202_2202763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248273.1|2202832_2203456_-	response regulator	NA	NA	NA	NA	NA
WP_087726472.1|2204005_2206288_+	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_004248271.1|2206474_2207344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248270.1|2207361_2208171_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_004248269.1|2208195_2210364_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_087726473.1|2210549_2212799_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004243392.1|2212915_2214304_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
WP_004243391.1|2214473_2215940_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004250844.1|2216024_2217602_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_087726475.1|2217821_2219018_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	1.6e-140
WP_020945830.1|2219025_2219214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726476.1|2219213_2219411_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	7.5e-19
WP_087726477.1|2220117_2221089_+	hypothetical protein	NA	NA	NA	NA	NA
2221029:2221043	attR	AAAAAATGAAATTAA	NA	NA	NA	NA
WP_087726478.1|2221085_2221613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726479.1|2221739_2221997_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	39.6	1.6e-05
WP_087726480.1|2222041_2223082_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.7	1.1e-100
WP_087726481.1|2223127_2224852_-	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.0	3.5e-112
WP_004243373.1|2225248_2225857_-	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_064505757.1|2225934_2226213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250866.1|2226354_2226576_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	8.5e-11
WP_087726482.1|2226577_2227513_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.1	1.2e-69
WP_087726483.1|2227481_2227964_+	replication protein	NA	NA	NA	NA	NA
WP_046334325.1|2228185_2228599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|2228595_2228991_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_087726484.1|2229113_2229536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060555924.1|2229526_2230021_+	hypothetical protein	NA	A0A067ZG68	Vibrio_phage	68.8	3.4e-60
WP_087726485.1|2230017_2230362_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	56.4	5.7e-30
WP_087726486.1|2230390_2231065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900160.1|2231108_2231678_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.0e-43
WP_087726487.1|2231677_2233162_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	9.5e-231
WP_004243356.1|2233346_2233559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726488.1|2233568_2235233_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.9	6.3e-199
WP_004243354.1|2235229_2235544_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_087726489.1|2235561_2236239_+	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
WP_087726490.1|2236254_2237235_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.1	5.5e-110
WP_087726491.1|2237293_2237725_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.1	3.2e-30
WP_036936189.1|2237733_2238075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243342.1|2238126_2238732_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	5.1e-66
WP_087726492.1|2238731_2241194_+	hypothetical protein	NA	Q858G3	Salmonella_phage	69.9	0.0e+00
WP_049210389.1|2241177_2241666_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	60.5	9.2e-50
WP_087726493.1|2241665_2242214_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	1.2e-45
WP_087726494.1|2242216_2245300_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.8	4.6e-163
WP_087726495.1|2245299_2248683_+	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.2	1.1e-184
WP_087726496.1|2248686_2249106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726497.1|2249209_2249965_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	53.1	2.7e-32
WP_087726498.1|2250323_2250575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726499.1|2250748_2253658_+	hypothetical protein	NA	A0A2I7RA25	Vibrio_phage	52.7	5.5e-166
WP_020945795.1|2253827_2254199_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_004243326.1|2254195_2254468_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_049203746.1|2254470_2254929_+	structural protein	NA	A0A0D4DAE2	Escherichia_phage	51.1	1.4e-31
WP_087726500.1|2254944_2255439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726501.1|2255787_2256309_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	36.7	6.4e-17
>prophage 6
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2436499	2442310	4372742	integrase	Proteus_phage(71.43%)	14	2435773:2435788	2437497:2437512
2435773:2435788	attL	TTTAATGGAGAAAATT	NA	NA	NA	NA
WP_049211075.1|2436499_2437495_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	5.4e-73
WP_049211074.1|2437451_2437697_-	excisionase	NA	NA	NA	NA	NA
2437497:2437512	attR	AATTTTCTCCATTAAA	NA	NA	NA	NA
WP_087726521.1|2437693_2438017_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	73.3	4.0e-33
WP_049211072.1|2438340_2438586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211071.1|2438578_2438848_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	53.9	4.1e-15
WP_049211070.1|2438847_2439027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036932464.1|2439056_2439383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726522.1|2439416_2439755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726523.1|2439787_2440591_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	99.3	1.0e-146
WP_087726524.1|2440583_2441402_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	97.4	1.6e-158
WP_087726525.1|2441398_2441653_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_087726526.1|2441649_2441925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157673311.1|2441915_2442092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726527.1|2442145_2442310_-	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	57.4	1.8e-13
>prophage 7
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2445495	2489207	4372742	tail,transposase,lysis	Morganella_phage(52.63%)	57	NA	NA
WP_070486789.1|2445495_2446173_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	54.9	7.0e-56
WP_070486794.1|2446252_2446480_+	DNA-binding protein	NA	G9L677	Escherichia_phage	62.2	6.0e-20
WP_087726530.1|2446623_2447004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726531.1|2447264_2448749_+	replication protein	NA	E5AGE9	Erwinia_phage	46.3	1.2e-47
WP_049206622.1|2448748_2450125_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.3	5.4e-156
WP_087726532.1|2450144_2450348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|2450358_2450526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726534.1|2450786_2451014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080386764.1|2451010_2451193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726740.1|2451206_2451407_+	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	59.1	3.7e-13
WP_087726535.1|2451408_2451855_+	protein ninB	NA	A0A1W6JNZ4	Morganella_phage	57.3	6.3e-37
WP_087726536.1|2451875_2452235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157673312.1|2452346_2452505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726537.1|2452508_2453150_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	78.8	1.2e-84
WP_157673313.1|2453142_2453814_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.8	4.0e-35
WP_087726538.1|2453800_2454016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726539.1|2454012_2454516_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	87.4	1.5e-79
WP_004247488.1|2455005_2455428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|2455481_2455751_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_087726540.1|2455750_2456221_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	6.8e-50
WP_004250565.1|2456363_2456825_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_004247494.1|2457172_2457757_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_087726541.1|2457753_2457960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049203625.1|2458142_2458751_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	3.3e-65
WP_036919947.1|2458753_2460238_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.9	2.7e-270
WP_017628802.1|2460239_2461616_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_017827431.1|2461624_2462689_+	hypothetical protein	NA	A0A1W6JNT7	Morganella_phage	51.1	6.0e-102
WP_017628800.1|2462763_2463450_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827430.1|2463455_2464406_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628798.1|2464448_2464826_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017628797.1|2464827_2465169_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_087726542.1|2465171_2465540_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_060554538.1|2465536_2465908_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	71.5	6.6e-48
WP_087726543.1|2465972_2466728_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.5e-107
WP_087726544.1|2466777_2467467_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	1.8e-91
WP_049195202.1|2467974_2468463_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_036971541.1|2468727_2469078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971544.1|2469087_2469903_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	26.5	4.0e-13
WP_017827422.1|2470005_2470176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908824.1|2470947_2471742_+	hypothetical protein	NA	A0A2I7RX10	Vibrio_phage	42.7	8.0e-43
WP_036895017.1|2471864_2473007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726545.1|2473071_2476407_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	44.7	1.4e-197
WP_026090519.1|2476564_2477038_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	46.5	1.8e-29
WP_017628783.1|2477215_2477545_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_036908262.1|2477541_2478240_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
WP_017628781.1|2478243_2478963_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_017628780.1|2478899_2479466_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_036908261.1|2479465_2483611_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_004245936.1|2483604_2483973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|2483974_2484589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245934.1|2484638_2484899_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
WP_049211399.1|2485600_2485906_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087726741.1|2486296_2486488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335367.1|2486561_2486792_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	1.2e-31
WP_004243134.1|2487069_2487408_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004250996.1|2487559_2487976_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.5	1.3e-44
WP_087726546.1|2487998_2489207_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	1.2e-188
>prophage 8
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2663116	2673108	4372742		Escherichia_phage(66.67%)	8	NA	NA
WP_017628118.1|2663116_2665561_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
WP_004242892.1|2665572_2666190_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_004242891.1|2666191_2667052_+	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242890.1|2667191_2667803_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242888.1|2667855_2668317_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242887.1|2668316_2669003_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_049210314.1|2669338_2671039_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_087726565.1|2671050_2673108_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
>prophage 9
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	2902581	2981408	4372742	integrase,protease,capsid,portal,terminase,tail,lysis,head,transposase	Morganella_phage(20.9%)	100	2906596:2906612	2989711:2989727
WP_036969579.1|2902581_2902740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157673314.1|2904514_2905795_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
2906596:2906612	attL	TTATCATTTGATAAATA	NA	NA	NA	NA
WP_036905765.1|2906883_2907189_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247524.1|2907892_2908153_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_049202079.1|2908169_2908436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2908432_2909119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2909118_2909451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|2913165_2913564_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_004251562.1|2913595_2913901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251564.1|2913912_2914494_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_049200983.1|2914493_2915090_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	1.6e-51
WP_049200984.1|2915090_2918366_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	1.1e-53
WP_087726587.1|2918492_2918684_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036894769.1|2918708_2918987_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004251577.1|2918983_2919400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251580.1|2919464_2920130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251583.1|2920139_2920481_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251585.1|2920486_2920960_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251588.1|2920949_2921279_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251590.1|2921278_2921578_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251594.1|2921616_2922783_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251596.1|2922786_2923455_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_012367784.1|2923472_2924741_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_012367783.1|2924740_2926474_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_036905779.1|2926427_2926895_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_004242468.1|2927013_2927352_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	5.4e-41
WP_004251606.1|2928249_2928711_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.3	1.4e-23
WP_004251609.1|2928853_2929324_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	63.2	1.5e-49
WP_004251611.1|2929323_2929593_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	6.7e-18
WP_004251614.1|2929645_2930068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251618.1|2930484_2931411_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004251632.1|2931514_2931850_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004247148.1|2932173_2932695_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247137.1|2933096_2933309_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247136.1|2933651_2934050_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247135.1|2934077_2935103_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247134.1|2935102_2935810_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247133.1|2935981_2937073_-	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247132.1|2937085_2937265_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_004247131.1|2937254_2937464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247130.1|2937553_2938012_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247129.1|2938096_2938336_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247128.1|2938439_2938922_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247127.1|2939364_2939547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247126.1|2939570_2939945_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247125.1|2940010_2940838_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247124.1|2940894_2941425_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004251672.1|2941486_2941729_+	excisionase	NA	NA	NA	NA	NA
WP_004247122.1|2941709_2942837_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.3	1.4e-125
WP_087726588.1|2943981_2944242_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	1.6e-16
WP_087726589.1|2944258_2944525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2944521_2945208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2945207_2945540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726590.1|2945529_2948643_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.9	1.2e-187
WP_049210594.1|2948643_2949042_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	4.1e-32
WP_049255019.1|2949104_2949722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049217579.1|2949749_2950331_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	9.3e-49
WP_036901058.1|2950327_2950927_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	4.0e-55
WP_074924464.1|2950927_2954233_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	44.6	4.4e-196
WP_017827267.1|2954489_2954840_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_017827268.1|2954839_2955316_-|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
WP_026164627.1|2955338_2955731_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_017827270.1|2955739_2956129_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	1.0e-30
WP_074924467.1|2956115_2956451_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	45.9	1.4e-17
WP_049217570.1|2956447_2956768_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.5	5.0e-20
WP_074924469.1|2957089_2958304_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.0	3.6e-220
WP_049218002.1|2958315_2959167_-	peptidase S14	NA	A0A1P8DTI2	Proteus_phage	98.9	1.9e-151
WP_049218003.1|2959171_2960503_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	96.6	6.3e-250
WP_049218004.1|2960502_2962236_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.3	0.0e+00
WP_049218005.1|2962239_2962710_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.4	7.7e-70
WP_049218006.1|2962857_2963055_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_087726591.1|2963051_2963402_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.7	1.7e-61
WP_087726592.1|2963618_2964182_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_087726593.1|2964213_2964675_-|lysis	lysis protein	lysis	A0A0P0ZDL0	Stx2-converting_phage	35.9	3.6e-11
WP_087726540.1|2964817_2965288_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	6.8e-50
WP_036895056.1|2965287_2965557_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.1e-19
WP_087726594.1|2965695_2965953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726595.1|2965906_2966143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726596.1|2966223_2966559_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_087726597.1|2966715_2967138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211557.1|2967390_2968413_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.4	1.8e-132
WP_049210579.1|2968486_2968681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211559.1|2968839_2969520_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	50.0	3.6e-52
WP_087726598.1|2969547_2970573_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.4	3.7e-85
WP_087726599.1|2970569_2971373_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	2.0e-89
WP_087726600.1|2971391_2971775_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_064506369.1|2971847_2972243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036901006.1|2972239_2972878_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	65.0	1.1e-82
WP_071425696.1|2972877_2973996_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	56.6	5.2e-48
WP_036904897.1|2974005_2974185_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
WP_049210567.1|2974443_2974902_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	4.6e-27
WP_017827297.1|2974970_2975183_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	63.8	1.5e-20
WP_036956929.1|2975292_2975886_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	59.2	5.6e-17
WP_049255036.1|2976239_2976443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247126.1|2976767_2977142_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247125.1|2977207_2978035_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247124.1|2978091_2978622_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004251672.1|2978683_2978926_+	excisionase	NA	NA	NA	NA	NA
WP_004247122.1|2978906_2980034_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.3	1.4e-125
WP_004247120.1|2980154_2981408_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
2989711:2989727	attR	TTATCATTTGATAAATA	NA	NA	NA	NA
>prophage 10
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	3061706	3100753	4372742	integrase,terminase,tRNA,lysis,head	Burkholderia_phage(21.05%)	52	3053377:3053392	3101225:3101240
3053377:3053392	attL	CACCTGTTTTAAATTT	NA	NA	NA	NA
WP_087726607.1|3061706_3062363_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	2.0e-39
WP_087726608.1|3062359_3063547_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.0	5.7e-69
WP_087726609.1|3063539_3063884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726610.1|3063861_3064572_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.3e-35
WP_049209853.1|3064574_3065390_-	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_020945489.1|3065355_3065673_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_004250592.1|3065672_3066200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726611.1|3066196_3068500_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.0	3.2e-15
WP_087726612.1|3068556_3069243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726613.1|3069392_3069851_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	5.1e-26
WP_004250586.1|3069891_3070344_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250584.1|3070354_3071842_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.9	8.7e-83
WP_036937870.1|3071850_3072366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945484.1|3072352_3072724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726614.1|3072723_3073182_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250580.1|3073181_3073613_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	7.4e-11
WP_004250579.1|3073615_3073957_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
WP_049209851.1|3075095_3075593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726615.1|3075592_3076852_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209903.1|3076848_3077562_-|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.8	2.0e-32
WP_087726616.1|3077599_3079102_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.4	1.3e-99
WP_087726617.1|3079105_3080503_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	2.8e-83
WP_071425526.1|3080785_3081262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726618.1|3081383_3082406_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	39.8	1.6e-35
WP_004250565.1|3082895_3083357_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_004250560.1|3083499_3083970_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	1.1e-47
WP_004250558.1|3083969_3084239_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_049210236.1|3084507_3085542_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.3	3.4e-142
WP_087726619.1|3085696_3085894_-	TrmB family transcriptional regulator	NA	A0A0P0ZDH6	Stx2-converting_phage	63.5	3.2e-09
WP_087726620.1|3086056_3086590_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	51.3	2.3e-38
WP_087726621.1|3086577_3086889_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	4.5e-34
WP_087726622.1|3086900_3087494_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	9.5e-57
WP_087726623.1|3087565_3088669_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.2	6.8e-32
WP_087726624.1|3088655_3089291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726625.1|3089406_3089745_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	52.3	1.6e-24
WP_087726626.1|3089748_3089982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213710.1|3089984_3090161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495146.1|3090180_3091557_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_006533543.1|3091546_3092140_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	47.6	6.4e-45
WP_049210198.1|3092132_3092984_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	58.3	4.0e-32
WP_004250533.1|3092985_3093210_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_087726627.1|3093227_3093683_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	1.3e-29
WP_087726628.1|3093723_3093981_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004250527.1|3094085_3094844_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_087726629.1|3095174_3095393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726630.1|3095447_3095780_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.2e-05
WP_004250523.1|3095779_3096040_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_087726631.1|3096052_3098020_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	1.3e-118
WP_087726632.1|3098019_3098520_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.2	3.4e-39
WP_049219182.1|3098567_3098747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945460.1|3099360_3099573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074924452.1|3099574_3100753_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.9	5.5e-32
3101225:3101240	attR	AAATTTAAAACAGGTG	NA	NA	NA	NA
>prophage 11
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	3182487	3261488	4372742	tRNA,protease,plate	Bacillus_phage(23.53%)	58	NA	NA
WP_004244624.1|3182487_3182919_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_087726641.1|3182926_3184702_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244621.1|3184665_3185703_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|3185707_3186976_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|3186977_3187529_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_087726642.1|3187521_3188889_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244617.1|3188881_3189637_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247646.1|3189645_3192369_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244614.1|3192372_3193161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244612.1|3193162_3193813_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244611.1|3193818_3195282_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244610.1|3195284_3198833_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244609.1|3198870_3200226_+	membrane protein	NA	NA	NA	NA	NA
WP_004244608.1|3200218_3201955_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244607.1|3202045_3202519_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247640.1|3202611_3203262_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244605.1|3203311_3203860_-	YcbK family protein	NA	NA	NA	NA	NA
WP_049203595.1|3204191_3205907_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004247637.1|3206249_3206963_-	class B acid phosphatase	NA	NA	NA	NA	NA
WP_004244601.1|3207368_3208022_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.0	1.0e-99
WP_049203593.1|3208304_3212762_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247634.1|3212758_3213490_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004244597.1|3213470_3214793_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004244596.1|3214802_3215576_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_036971376.1|3215955_3216786_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244594.1|3216908_3217670_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004244593.1|3217674_3217854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247631.1|3218268_3218484_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244590.1|3218979_3219981_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004244589.1|3219977_3221723_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_087726643.1|3221759_3224129_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	30.1	4.0e-21
WP_004244587.1|3224556_3224844_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_004244586.1|3224908_3226582_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244585.1|3226756_3227434_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004247629.1|3227722_3229009_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244582.1|3229205_3230294_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_087726644.1|3230430_3231861_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.0	2.6e-07
WP_087726645.1|3231997_3233263_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244579.1|3233337_3234375_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_049203590.1|3234602_3236360_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244577.1|3237029_3237884_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_004244576.1|3237938_3240221_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244575.1|3240328_3241069_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244574.1|3241426_3242332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|3242404_3243454_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_049209992.1|3243852_3244200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244571.1|3244364_3245654_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_012367706.1|3245787_3247137_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244569.1|3247147_3247753_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_087726646.1|3247865_3251708_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244566.1|3251835_3252330_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004247618.1|3252872_3253832_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_087726647.1|3253973_3255743_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	2.3e-21
WP_004244562.1|3255745_3257497_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	4.0e-18
WP_004247616.1|3257498_3258191_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244560.1|3258510_3258729_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004244559.1|3258848_3261143_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244558.1|3261173_3261488_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
>prophage 12
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	3437198	3482539	4372742	tail,head,lysis,integrase	Morganella_phage(44.44%)	60	3430279:3430297	3482608:3482626
3430279:3430297	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_004245934.1|3437198_3437459_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
WP_004247523.1|3437508_3438123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|3438124_3438493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908261.1|3438486_3442632_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_017628780.1|3442631_3443198_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_017628781.1|3443134_3443854_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_036908262.1|3443857_3444556_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
WP_017628783.1|3444552_3444882_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_026090519.1|3445059_3445533_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	46.5	1.8e-29
WP_087726671.1|3445690_3449047_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	43.8	1.3e-198
WP_087726672.1|3449115_3449661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726673.1|3449687_3450098_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	37.0	1.7e-09
WP_147440009.1|3450161_3450722_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	57.9	6.1e-05
WP_087726676.1|3450718_3450958_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	43.2	2.9e-09
WP_087726677.1|3451043_3451205_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	52.9	2.6e-09
WP_087726678.1|3451274_3452108_+	hypothetical protein	NA	I6S627	Salmonella_phage	55.6	8.3e-67
WP_049195202.1|3452379_3452868_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_074924197.1|3453375_3454065_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	8.9e-91
WP_017628794.1|3454114_3454870_-	hypothetical protein	NA	A0A1W6JNT1	Morganella_phage	81.7	4.7e-109
WP_017628795.1|3454934_3455306_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
WP_036919952.1|3455302_3455671_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	85.2	3.0e-53
WP_017628797.1|3455673_3456015_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_017628798.1|3456016_3456394_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017827430.1|3456436_3457387_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_036919950.1|3457392_3458079_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_036919948.1|3458153_3459218_-|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	51.1	1.2e-102
WP_017628802.1|3459226_3460603_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_036919947.1|3460604_3462089_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.9	2.7e-270
WP_012367626.1|3462091_3462700_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
WP_004245979.1|3462882_3463089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247494.1|3463085_3463670_-	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_036919945.1|3464017_3464479_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	1.1e-23
WP_017628809.1|3464621_3465092_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_004247489.1|3465091_3465361_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_004247488.1|3465414_3465837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247148.1|3465995_3466517_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_036919943.1|3466828_3467461_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	33.8	1.6e-22
WP_004245983.1|3467460_3467817_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245984.1|3467813_3468104_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_036919942.1|3468182_3468632_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_026090523.1|3468699_3469029_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919941.1|3469056_3470442_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.9	6.1e-115
WP_036895070.1|3470441_3471209_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_036919940.1|3471473_3471821_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.8e-36
WP_004247477.1|3471966_3472176_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_036908281.1|3472281_3472926_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_036908283.1|3472960_3473740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908285.1|3473736_3474102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|3474556_3474874_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_017628819.1|3474895_3475393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919939.1|3475592_3475853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628822.1|3476069_3476324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628824.1|3476469_3476790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726680.1|3476791_3477676_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.2	1.2e-60
WP_087726681.1|3477665_3478205_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.1	1.1e-56
WP_087726682.1|3479141_3479825_+	hypothetical protein	NA	A0A2I7QT96	Vibrio_phage	48.1	1.2e-23
WP_012367598.1|3479899_3480625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049216772.1|3481000_3481339_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	7.4e-14
WP_012367595.1|3481335_3481581_+	excisionase	NA	NA	NA	NA	NA
WP_049213530.1|3481537_3482539_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.1	6.9e-68
3482608:3482626	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 13
NZ_CP021694	Proteus mirabilis strain AR_0155, complete genome	4372742	3518410	3530365	4372742		Stx2-converting_phage(12.5%)	12	NA	NA
WP_004246054.1|3518410_3519622_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|3519820_3520084_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|3520435_3521080_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|3521181_3522147_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|3522162_3522537_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246068.1|3523605_3523815_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|3524012_3524486_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_087726686.1|3524767_3524992_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	40.5	4.0e-08
WP_004246072.1|3525003_3525408_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004247428.1|3525436_3527563_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	3.4e-205
WP_004247427.1|3527588_3528557_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004247426.1|3529165_3530365_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 1
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	0	7901	214441		Escherichia_phage(50.0%)	7	NA	NA
WP_000988732.1|2263_2989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|3102_3504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|3723_3963_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|4035_4314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|4300_6028_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|6205_6592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|7049_7901_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
>prophage 2
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	14462	16088	214441		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000201432.1|14462_16088_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
>prophage 3
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	20742	22544	214441	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001317493.1|20742_21525_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|21521_22544_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 4
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	29980	34616	214441		Mycobacterium_phage(25.0%)	5	NA	NA
WP_000706865.1|29980_30991_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001282585.1|31053_32043_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|32137_32668_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_000739139.1|32728_33637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085162.1|33647_34616_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
>prophage 5
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	66767	69854	214441		Streptococcus_phage(50.0%)	3	NA	NA
WP_000366821.1|66767_68960_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.9e-42
WP_000468105.1|68974_69463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|69554_69854_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
>prophage 6
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	73287	134981	214441	transposase	Escherichia_phage(16.67%)	76	NA	NA
WP_000647189.1|73287_73788_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000348669.1|73796_74129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005507681.1|74113_74545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413515.1|74612_75287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044824.1|75261_75543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|75535_75913_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000939033.1|76231_76375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152394.1|76599_77379_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|77375_78401_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_000703827.1|79113_79386_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|79434_80616_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|80619_81405_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|81578_81890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|82196_83012_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|83098_83401_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|83294_83546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457263.1|83576_85682_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_014386425.1|85813_86797_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386424.1|86824_88039_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	8.5e-20
WP_071977887.1|88255_89377_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|89757_91251_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|91461_91686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|91682_92420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000447876.1|92567_92900_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239389.1|92896_93664_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
WP_000140066.1|93660_94167_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
WP_001272375.1|94163_95231_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000131871.1|95345_95549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021545039.1|95736_96762_+|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
WP_085940413.1|96840_97930_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_157673317.1|98371_99586_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_087726749.1|99578_100025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726750.1|100028_100943_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_071434332.1|100954_101599_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_087726751.1|101595_103203_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_087726752.1|103221_103464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726753.1|103466_104195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082242806.1|104191_106693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032300801.1|106689_107010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726754.1|107015_107375_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_087726755.1|107384_108329_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_135180852.1|108325_108865_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_157673318.1|108955_109489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029403601.1|109594_109915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029403600.1|109971_110217_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082242808.1|110246_111251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087726757.1|111237_113352_-	MFS transporter	NA	NA	NA	NA	NA
WP_029403597.1|114125_114356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082242814.1|114487_115021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082242810.1|115023_115476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726758.1|115475_116057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726759.1|116102_116456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082242812.1|116754_117705_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.7	3.4e-56
WP_036944392.1|118562_119225_+	plasmid stability/partitioning protein	NA	E5FFJ3	Burkholderia_phage	30.8	7.9e-12
WP_082242815.1|119286_119565_+	plasmid stability/partitioning protein	NA	NA	NA	NA	NA
WP_087726765.1|119816_120029_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_087726760.1|120145_120340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018330.1|120522_121338_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
WP_000957857.1|121694_121883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726761.1|121892_123092_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_087726762.1|123974_124901_-	replication associated protein RepA1	NA	NA	NA	NA	NA
WP_070133934.1|125176_125605_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_082242798.1|125604_125862_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_087726764.1|125918_126158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207275.1|126862_127213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082242800.1|127231_127453_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_085940413.1|127636_128727_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|128819_129635_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_021545033.1|129721_130024_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|129917_130169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000242922.1|130675_131113_-	DUF4102 domain-containing protein	NA	Q858E8	Salmonella_phage	69.9	2.4e-25
WP_000058871.1|131318_131750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337763.1|131763_133011_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001258027.1|133000_133363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|133365_133608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|134042_134981_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
>prophage 7
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	139869	143862	214441		Phormidium_phage(50.0%)	4	NA	NA
WP_001280522.1|139869_141333_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000434071.1|141406_142339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062185.1|142900_143398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|143400_143862_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
>prophage 8
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	147491	192998	214441	transposase,integrase	Escherichia_phage(28.57%)	49	156738:156753	183901:183916
WP_001043047.1|147491_147764_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_042041202.1|147821_148298_-	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.2e-09
WP_070531634.1|148490_149471_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_001167032.1|149779_150637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972663.1|150623_150854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210758.1|150853_151372_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919345.1|151368_151815_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000422768.1|151814_152174_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591074.1|152230_152659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139698.1|152692_153553_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001326179.1|153568_154546_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000539392.1|154527_155382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|155386_155701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|155690_156134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|156260_156782_-	hypothetical protein	NA	NA	NA	NA	NA
156738:156753	attL	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_077264454.1|156784_157246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849071.1|157310_157919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|158187_159303_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000883925.1|159320_159755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326182.1|160164_160446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|160791_161892_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_000127321.1|161876_162164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375812.1|162168_162735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|163206_164190_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|164206_164500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|164501_164921_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|164980_165532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|165528_166137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|166147_166681_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|166680_166953_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000683483.1|167668_168031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534551.1|168068_171683_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000256129.1|171695_173129_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001326396.1|173130_174171_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000811656.1|174281_175793_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|176079_177120_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|177336_179052_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|179161_182191_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|182297_183323_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|183319_184099_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
183901:183916	attR	GAAAGGGGCGATGATC	NA	NA	NA	NA
WP_047665864.1|184230_185112_+	carbapenem-hydrolyzing class A beta-lactamase KPC-6	NA	A0A1B0VBP7	Salmonella_phage	52.5	2.0e-74
WP_004152397.1|185361_186681_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_032413577.1|187025_187904_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_004883566.1|188565_189570_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|189648_190083_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|190154_190505_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|190518_190794_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|190829_191252_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|191303_192998_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 9
NZ_CP021695	Proteus mirabilis strain AR_0155 plasmid tig00000123, complete sequence	214441	197659	208829	214441	transposase,integrase	Pandoravirus(16.67%)	17	200681:200692	208961:208972
WP_000259031.1|197659_198499_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|198492_198840_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|199045_199834_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|199964_200438_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
200681:200692	attL	ACAGTTTACGAA	NA	NA	NA	NA
WP_001067855.1|201340_202045_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|202221_202434_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|202396_202516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|202499_202736_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|202732_203098_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|203115_204801_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|204839_205265_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|205292_205568_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|205583_205949_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|206020_206476_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000139718.1|206465_206948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|206944_207814_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|207818_208829_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
208961:208972	attR	TTCGTAAACTGT	NA	NA	NA	NA
