The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	0	34922	4967401	head,plate,holin,integrase,transposase,capsid,portal,tail	Salmonella_phage(80.0%)	44	14619:14635	40317:40333
WP_001207578.1|455_971_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_080028419.1|985_1321_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	98.2	5.2e-52
WP_000763324.1|1329_1446_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_080028420.1|1446_4374_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	91.5	0.0e+00
WP_000979934.1|4383_4833_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.7	3.9e-79
WP_021567694.1|4939_5521_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	79.5	9.2e-81
WP_073511640.1|5694_5928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246760.1|7176_7791_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	98.4	5.9e-110
WP_080028422.1|7783_8695_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.0	1.8e-160
WP_000108899.1|8691_9054_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_045355545.1|9050_9680_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.2	1.3e-109
WP_016246757.1|9837_10482_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.2	5.7e-116
WP_000917105.1|10442_10937_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_016246755.1|10936_11467_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	65.3	5.3e-43
WP_016246754.1|11568_12048_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	70.1	4.6e-62
WP_021567690.1|12112_12442_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	97.2	2.3e-52
WP_001102549.1|12452_12653_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|12652_13141_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_023276968.1|13243_14092_-	hypothetical protein	NA	A0A0M4R523	Salmonella_phage	97.2	2.8e-134
WP_001246220.1|14134_15181_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
14619:14635	attL	ACGGTGATATCTTTCAT	NA	NA	NA	NA
WP_016246750.1|15221_16067_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.9	1.6e-153
WP_016246749.1|16220_17933_+	hypothetical protein	NA	A0A0M4S6K7	Salmonella_phage	98.1	0.0e+00
WP_000014576.1|17933_18983_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_045355548.1|19466_20579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028423.1|20629_22999_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.6	0.0e+00
WP_021567686.1|22995_23175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057063179.1|23174_24146_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	1.1e-137
WP_021567684.1|24147_24360_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	94.3	4.1e-31
WP_080028424.1|24402_24585_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000482341.1|24584_25019_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_021567682.1|25112_25343_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	74.7	2.1e-28
WP_000290619.1|25332_25539_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_021567681.1|25549_25753_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	94.0	1.4e-28
WP_000130011.1|25763_26045_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	98.9	5.3e-50
WP_000343126.1|26135_26375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567679.1|26611_26905_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	72.2	7.2e-34
WP_057502207.1|26974_27955_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	3.0e-185
WP_001223800.1|28132_28633_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|28782_29481_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|29477_30851_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_000399648.1|31135_32116_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001270260.1|32235_32910_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|33058_34042_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|34301_34922_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
40317:40333	attR	ATGAAAGATATCACCGT	NA	NA	NA	NA
>prophage 2
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	50461	53512	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|50461_53512_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 3
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	66236	70967	4967401		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000357970.1|66236_67247_-	Zn-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	22.5	4.5e-06
WP_000094544.1|67279_68167_-	aldolase	NA	NA	NA	NA	NA
WP_001299483.1|68191_69070_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000160872.1|69242_70139_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|70178_70967_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 4
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	78283	80754	4967401		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190580.1|78283_79333_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|79344_80754_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 5
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	84832	87619	4967401		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|84832_87619_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 6
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	101299	101914	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|101299_101914_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 7
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	110704	113991	4967401		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|110704_111481_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|111483_111999_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|112002_112272_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|112350_113991_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 8
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	126402	128232	4967401		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|126402_128232_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 9
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	136493	140352	4967401		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|136493_138656_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|138739_139456_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|139455_140352_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 10
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	158847	164991	4967401		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612036.1|158847_159978_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
WP_001145195.1|159982_160657_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|160634_161516_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|161534_162602_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|162601_163864_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|163860_164991_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 11
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	169033	174445	4967401		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|169033_169363_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|169493_170759_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|170892_172377_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|172423_174445_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 12
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	182831	184478	4967401		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012601.1|182831_184478_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 13
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	197869	203722	4967401		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|197869_198760_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|198784_199750_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|199754_201260_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|201267_201687_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|201853_203722_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 14
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	206890	207883	4967401		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845141.1|206890_207883_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 15
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	219835	223197	4967401		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|219835_221206_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|221367_223197_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 16
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	228728	232569	4967401		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|228728_229769_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|229855_230815_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|230814_231705_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|231795_232569_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 17
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	243558	244896	4967401		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|243558_244896_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 18
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	255094	262463	4967401		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|255094_255352_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|255315_255675_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|255691_255832_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|256061_256142_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|256438_257842_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673469.1|257846_258947_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|258946_260020_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|260048_262463_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 19
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	267169	268318	4967401		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|267169_268318_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 20
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	272745	273699	4967401		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|272745_273159_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|273270_273699_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 21
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	280046	289069	4967401		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|280046_281762_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|281758_283252_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|283298_283748_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|283857_284205_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|284194_284557_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|284553_285051_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|285058_286243_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|286522_286612_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001312198.1|287176_287275_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_087758689.1|287380_289069_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.2	3.0e-55
>prophage 22
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	296373	297708	4967401		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|296373_297708_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 23
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	304464	307839	4967401	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000080200.1|304464_306078_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_080028427.1|306108_306459_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	8.9e-39
WP_001322394.1|306822_307839_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
>prophage 24
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	317843	322590	4967401	integrase,transposase	Mycobacterium_phage(50.0%)	2	303846:303869	322890:322913
303846:303869	attL	TGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
WP_086937185.1|317843_318648_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	1.9e-31
WP_001218908.1|321405_322590_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
322890:322913	attR	TGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
>prophage 25
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	328868	330260	4967401		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|328868_330260_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 26
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	334696	339717	4967401		Bordetella_phage(33.33%)	4	NA	NA
WP_000280488.1|334696_336805_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|336823_337099_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|337153_337777_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870047.1|338034_339717_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
>prophage 27
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	344819	349382	4967401		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|344819_345275_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|345255_346476_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|346647_347316_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|347532_347769_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|347789_347957_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114543.1|348054_348864_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|348902_349382_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 28
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	356820	358914	4967401		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364795.1|356820_357846_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
WP_000064004.1|357930_358914_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 29
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	362313	371820	4967401		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587749.1|362313_363246_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
WP_001213837.1|363459_364656_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.1e-35
WP_000646014.1|364665_365691_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982115.1|365929_366964_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|366950_367910_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|367913_369197_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|369206_370751_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|370995_371427_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|371568_371820_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 30
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	393955	402352	4967401	tRNA	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_071549997.1|393955_398185_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.8	1.6e-25
WP_000779792.1|398413_399022_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|399119_400511_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582487.1|400507_402352_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
>prophage 31
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	426539	428081	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|426539_428081_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 32
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	433399	434395	4967401		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|433399_434395_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 33
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	438619	438832	4967401		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|438619_438832_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 34
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	442486	444820	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_000013930.1|442486_444820_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	3.7e-72
>prophage 35
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	460569	462554	4967401		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|460569_461553_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107035.1|461549_462554_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 36
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	510311	510959	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|510311_510959_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 37
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	515852	517987	4967401		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|515852_516278_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_001347664.1|516290_517580_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000008957.1|517633_517987_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 38
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	521332	523375	4967401		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|521332_523375_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 39
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	536787	542684	4967401		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149125.1|536787_539523_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	9.2e-22
WP_001314210.1|539522_540647_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259388.1|540719_540995_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_000593555.1|540991_541351_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|541470_541872_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|541877_542684_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 40
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	550572	554704	4967401		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|550572_551238_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|551458_551704_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106559.1|551805_554004_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|554077_554704_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 41
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	557710	560529	4967401		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|557710_558379_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|558371_559430_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|559674_560529_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 42
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	566262	567745	4967401		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|566262_567030_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|567031_567745_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 43
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	571285	573096	4967401		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907801.1|571285_572356_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073590.1|572352_573096_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 44
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	593105	595553	4967401		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|593105_595553_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 45
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	604782	606009	4967401		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105503.1|604782_606009_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 46
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	610388	612782	4967401		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|610388_612782_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 47
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	626193	629960	4967401		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|626193_626913_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|626909_628262_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001298201.1|628337_629960_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 48
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	646863	647700	4967401		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|646863_647700_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 49
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	666714	676255	4967401		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|666714_667278_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963797.1|667363_668584_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|668650_670741_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|670791_671424_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|671725_672130_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|672184_673054_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|673107_673326_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057379.1|673319_674342_-	hydrolase	NA	NA	NA	NA	NA
WP_000634789.1|674341_676255_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 50
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	681825	687399	4967401		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|681825_682212_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820724.1|682211_682571_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|682578_682866_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|682991_683366_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|683462_683933_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|684029_686144_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|686214_687399_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 51
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	707276	708748	4967401	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|707276_708224_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|708238_708748_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 52
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	719244	723398	4967401		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|719244_720003_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001299298.1|720010_721114_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|721123_722305_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738575.1|722372_723398_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 53
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	729902	730787	4967401		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258884.1|729902_730787_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.4e-24
>prophage 54
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	741352	742396	4967401		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|741352_742396_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 55
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	758892	761417	4967401	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|758892_759960_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|760049_761417_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 56
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	765383	765881	4967401	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|765383_765881_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 57
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	769585	774333	4967401		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|769585_771076_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|771123_771813_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209003.1|771809_772685_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|772681_773146_+	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000445144.1|773205_774333_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 58
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	781082	795877	4967401		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|781082_782012_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|782107_784444_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001307414.1|784673_785327_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|785323_786052_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|786048_786681_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|786894_787167_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|787163_788018_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|788063_788555_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|788672_788960_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|788982_790416_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|790463_791189_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|791195_791753_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|791721_792297_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|792293_792860_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|792880_793867_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|793880_794858_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438242.1|795067_795877_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 59
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	799945	801424	4967401		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|799945_800224_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|800452_801424_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 60
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	808052	810925	4967401	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|808052_809987_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|810076_810925_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 61
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	815007	821646	4967401		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|815007_816351_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|816981_817434_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|817461_818949_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|818973_821646_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 62
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	827127	829017	4967401		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|827127_829017_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 63
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	834844	842638	4967401		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|834844_835147_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|835197_835641_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|835620_836139_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|836266_836902_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|836974_838015_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|838128_838704_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|838713_839304_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|839323_839719_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249105.1|839676_841713_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809262.1|841777_842638_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 64
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	865647	866793	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|865647_866793_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 65
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	874780	877075	4967401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|874780_877075_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 66
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	903308	904274	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|903308_904274_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 67
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	916081	932264	4967401	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082882.1|916081_919174_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212470.1|919357_920341_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|920559_920892_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|920933_922424_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094682.1|922730_924251_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|924404_925028_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065895.1|925304_926069_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|926322_926829_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|926906_928748_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|928942_930688_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|930798_931014_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|931250_932264_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 68
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	938648	939887	4967401	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|938648_939887_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 69
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	945024	946458	4967401		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|945024_946458_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 70
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	955973	966935	4967401		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|955973_956627_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|956887_957058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|957115_957889_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|958004_958820_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|958857_960018_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|960023_960695_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|960842_962324_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|962528_963158_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|963158_963581_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|963605_964433_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|964432_965014_+	esterase YqiA	NA	NA	NA	NA	NA
WP_060614954.1|965042_966935_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	5.8e-92
>prophage 71
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	970762	981585	4967401		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|970762_971155_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|971207_971690_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281841.1|972235_974494_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000965712.1|974727_975465_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|975539_976952_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|977062_979282_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|979323_979581_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|979631_980558_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|980757_981585_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 72
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	988940	989825	4967401		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|988940_989825_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 73
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1012039	1013212	4967401		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|1012039_1013212_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 74
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1036492	1037755	4967401	integrase	Pseudomonas_phage(100.0%)	1	1027982:1027997	1040873:1040888
1027982:1027997	attL	ACAACTGGTGGCGATG	NA	NA	NA	NA
WP_001218875.1|1036492_1037755_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_001218875.1|1036492_1037755_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
1040873:1040888	attR	ACAACTGGTGGCGATG	NA	NA	NA	NA
>prophage 75
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1060537	1061692	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1060537_1061692_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 76
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1082693	1083371	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_000956872.1|1082693_1083371_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 77
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1101377	1102610	4967401		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1101377_1102610_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 78
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1111137	1116510	4967401		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195068.1|1111137_1114011_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_000951964.1|1114276_1115020_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024198262.1|1115076_1116510_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 79
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1120315	1135707	4967401	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|1120315_1121212_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|1121236_1121947_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|1121952_1123686_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|1123776_1124874_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|1124884_1126402_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192804.1|1126444_1126993_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1127047_1127119_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|1127115_1127241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|1127242_1128691_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001345944.1|1129126_1131046_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|1131045_1131534_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|1131569_1132937_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|1132972_1134289_-	guanine deaminase	NA	NA	NA	NA	NA
WP_060615030.1|1134306_1135707_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 80
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1159986	1160742	4967401		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1159986_1160742_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 81
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1169238	1171816	4967401		Enterobacteria_phage(100.0%)	2	NA	NA
WP_000890067.1|1169238_1171068_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.7	2.3e-32
WP_000179445.1|1171102_1171816_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	60.5	4.8e-63
>prophage 82
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1196691	1199179	4967401		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603504.1|1196691_1197453_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|1197760_1199179_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 83
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1208810	1215583	4967401		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|1208810_1209524_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|1209592_1210282_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|1210966_1211497_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|1211509_1213756_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|1213906_1214782_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1214788_1215583_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 84
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1221060	1236447	4967401	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138163.1|1221060_1223949_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
WP_001285985.1|1223941_1227484_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|1227483_1229310_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|1229371_1230703_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1230934_1232188_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|1232767_1233865_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|1233941_1234748_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184251.1|1234798_1235242_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001347723.1|1235241_1236447_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
>prophage 85
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1247973	1248729	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1247973_1248729_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 86
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1253587	1254436	4967401		Vibrio_phage(100.0%)	1	NA	NA
WP_000100409.1|1253587_1254436_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 87
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1261970	1266085	4967401		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|1261970_1264727_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046785.1|1264783_1266085_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 88
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1270117	1275037	4967401		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|1270117_1271755_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_080028433.1|1271842_1273141_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|1273200_1274073_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|1274086_1274227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|1274365_1275037_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 89
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1280242	1281028	4967401		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1280242_1281028_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 90
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1304998	1307031	4967401		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|1304998_1306426_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|1306425_1307031_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 91
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1310143	1313859	4967401		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|1310143_1310905_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1310898_1311525_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1311664_1312804_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1312866_1313859_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 92
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1319073	1326213	4967401		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1319073_1319712_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1319708_1320971_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1320967_1321876_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1322071_1322839_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1322889_1323546_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1323651_1326213_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 93
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1344038	1345052	4967401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|1344038_1345052_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 94
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1352625	1353591	4967401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1352625_1353591_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 95
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1359058	1364618	4967401	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|1359058_1359556_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|1359635_1360697_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|1360939_1361440_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047177.1|1361567_1364198_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1364432_1364618_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 96
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1377801	1383097	4967401		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|1377801_1379004_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|1379358_1380318_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_000246536.1|1380327_1382472_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_000080944.1|1382444_1382855_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|1382851_1383097_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 97
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1387032	1391157	4967401		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|1387032_1387482_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156813.1|1387482_1388145_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1388165_1389566_-	GABA permease	NA	NA	NA	NA	NA
WP_000097641.1|1389876_1391157_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 98
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1400638	1400896	4967401		Salmonella_phage(100.0%)	1	NA	NA
WP_000340075.1|1400638_1400896_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
>prophage 99
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1405163	1405646	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1405163_1405646_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 100
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1419392	1420463	4967401		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|1419392_1420463_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 101
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1426369	1428943	4967401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1426369_1428943_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 102
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1434800	1436099	4967401		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|1434800_1436099_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 103
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1441392	1447474	4967401	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|1441392_1441812_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1442018_1443056_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1443103_1443793_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1444097_1444481_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189206.1|1444535_1445123_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001297408.1|1445225_1446107_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219196.1|1446139_1447474_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 104
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1453245	1456988	4967401		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|1453245_1455045_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1455060_1456035_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1456307_1456988_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 105
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1460446	1460707	4967401		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1460446_1460707_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 106
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1464826	1476134	4967401		Bacillus_phage(50.0%)	7	NA	NA
WP_000970111.1|1464826_1468714_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
WP_001297612.1|1469289_1470717_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|1470881_1471595_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|1471584_1472919_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1472979_1473318_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|1473362_1474553_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|1474880_1476134_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 107
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1481892	1483404	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|1481892_1483404_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 108
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1498568	1505025	4967401		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|1498568_1499783_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1499810_1500197_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1500213_1500537_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|1500632_1501148_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|1501164_1503015_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|1503016_1503352_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1503363_1503564_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|1503741_1505025_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 109
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1514910	1515342	4967401		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1514910_1515342_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 110
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1524171	1530468	4967401		Escherichia_phage(60.0%)	6	NA	NA
WP_000937933.1|1524171_1525542_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|1525703_1527170_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1527238_1528816_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|1528910_1529450_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000669402.1|1529465_1529981_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1530294_1530468_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 111
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1536902	1540904	4967401		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|1536902_1537541_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|1537540_1538578_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1538902_1539529_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1539614_1540904_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 112
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1561991	1562705	4967401		Synechococcus_phage(100.0%)	1	NA	NA
WP_001347624.1|1561991_1562705_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FHU1	Synechococcus_phage	36.6	4.1e-38
>prophage 113
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1580723	1581674	4967401		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1580723_1581674_-	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 114
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1600228	1605166	4967401		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|1600228_1601098_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|1601311_1601737_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000842944.1|1601723_1602173_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|1602233_1602809_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|1602904_1603804_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|1603861_1605166_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 115
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1608644	1624014	4967401		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|1608644_1609436_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290224.1|1609606_1610623_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458406.1|1610622_1611456_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1611455_1612331_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021039.1|1612320_1613418_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|1613551_1614463_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|1614465_1614834_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|1614938_1615790_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1615831_1616341_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1616381_1618109_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1618153_1618411_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1618794_1619766_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|1619950_1620712_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|1620941_1621928_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|1621998_1624014_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 116
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1649551	1650286	4967401		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1649551_1650286_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 117
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1654104	1655025	4967401		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1654104_1655025_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 118
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1658754	1666331	4967401		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|1658754_1660449_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|1660518_1661463_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001347877.1|1661536_1662682_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001347876.1|1662737_1666331_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 119
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1672984	1674418	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1672984_1674418_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 120
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1686373	1687493	4967401	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087758690.1|1686373_1687493_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 121
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1690975	1691713	4967401		Salmonella_phage(100.0%)	1	NA	NA
WP_001347871.1|1690975_1691713_-	HNH endonuclease	NA	K4I1Q3	Salmonella_phage	50.0	8.8e-36
>prophage 122
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1698791	1699013	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_087758691.1|1698791_1699013_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	7.4e-07
>prophage 123
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1706143	1707532	4967401		Leptospira_phage(100.0%)	1	NA	NA
WP_000772533.1|1706143_1707532_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.1	9.4e-47
>prophage 124
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1713173	1717392	4967401	transposase	Clostridium_phage(50.0%)	2	NA	NA
WP_087758693.1|1713173_1714586_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	28.6	3.1e-13
WP_087758690.1|1716272_1717392_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 125
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1722622	1725144	4967401	integrase	Enterobacteria_phage(100.0%)	2	1715344:1715358	1728979:1728993
1715344:1715358	attL	TTACCTGCATCATCG	NA	NA	NA	NA
WP_001229151.1|1722622_1723885_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.3	4.0e-81
WP_000368131.1|1724211_1725144_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1728979:1728993	attR	TTACCTGCATCATCG	NA	NA	NA	NA
>prophage 126
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1743026	1744112	4967401		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1743026_1744112_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 127
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1753955	1755092	4967401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1753955_1755092_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 128
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1761568	1763086	4967401		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1761568_1763086_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 129
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1767297	1769170	4967401	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|1767297_1768071_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|1768267_1769170_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 130
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1779729	1782957	4967401		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|1779729_1780380_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|1780466_1782299_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_060615010.1|1782357_1782957_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 131
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1804407	1805424	4967401	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|1804407_1805424_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 132
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1818964	1823968	4967401		Tupanvirus(50.0%)	4	NA	NA
WP_001551384.1|1818964_1820947_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
WP_000461642.1|1820946_1821915_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_024166496.1|1821918_1823058_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	2.2e-30
WP_001306469.1|1823365_1823968_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 133
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1827570	1831874	4967401	transposase	Oenococcus_phage(50.0%)	3	NA	NA
WP_021523190.1|1827570_1828776_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_000992991.1|1830127_1830931_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_023278440.1|1830971_1831874_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.2	5.6e-69
>prophage 134
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1837766	1838843	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|1837766_1838843_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 135
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1841889	1853716	4967401		Pseudomonas_phage(40.0%)	6	NA	NA
WP_021523189.1|1841889_1842144_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
WP_000332037.1|1842143_1843274_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|1843419_1845705_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_060615086.1|1846400_1850159_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.7	7.7e-19
WP_000990765.1|1850219_1850942_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281227.1|1851088_1853716_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 136
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1863416	1866266	4967401		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|1863416_1866266_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 137
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1870543	1876312	4967401		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865539.1|1870543_1871638_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
WP_060615083.1|1871749_1872805_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710366.1|1872878_1873943_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884953.1|1873942_1874593_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|1874668_1876312_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 138
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1885079	1885697	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1885079_1885697_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 139
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1897396	1904923	4967401		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|1897396_1898404_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|1898541_1898826_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|1898950_1900711_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|1900859_1901555_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|1901582_1902773_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|1903105_1903450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060615082.1|1903453_1904923_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	28.2	2.1e-12
>prophage 140
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1910677	1914978	4967401		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|1910677_1911244_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|1911655_1912369_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198789.1|1912407_1913394_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848214.1|1913511_1914978_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 141
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1929494	1930352	4967401		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1929494_1930352_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 142
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1934421	1938207	4967401		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|1934421_1936413_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|1936444_1937281_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_001139613.1|1937538_1938207_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 143
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1941901	1943422	4967401		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|1941901_1943422_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 144
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1963737	1973179	4967401		Enterobacteria_phage(85.71%)	10	NA	NA
WP_080028461.1|1963737_1964664_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.1e-22
WP_000783120.1|1964668_1965400_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1965380_1965488_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1965547_1966279_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1966500_1968186_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1968182_1968902_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1968948_1969419_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1969459_1969921_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1970045_1972046_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1972042_1973179_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 145
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1985744	1987778	4967401	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001349809.1|1985744_1987778_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 146
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	1998425	2001982	4967401		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001315719.1|1998425_1999244_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434036.1|1999295_2000042_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|2000015_2000981_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|2000977_2001982_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
>prophage 147
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2011205	2018079	4967401	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807353.1|2011205_2012105_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_000716757.1|2012519_2012837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|2013166_2014528_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|2014630_2014927_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|2014928_2015225_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|2015433_2015766_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|2015956_2016679_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675150.1|2016675_2018079_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 148
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2031520	2032873	4967401		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_060615117.1|2031520_2032873_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 149
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2037537	2047928	4967401		Catovirus(40.0%)	8	NA	NA
WP_001295424.1|2037537_2038179_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|2038270_2038852_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|2038873_2040727_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001347702.1|2041000_2042584_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.1	9.4e-35
WP_000978094.1|2043242_2044382_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|2044387_2044831_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_080028464.1|2044833_2046996_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654487.1|2047088_2047928_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
>prophage 150
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2052172	2059054	4967401		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048188.1|2052172_2053294_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
WP_000043595.1|2053296_2054262_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.9e-87
WP_042032722.1|2054264_2054744_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032170927.1|2054740_2055964_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_032170925.1|2055966_2057403_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_032170923.1|2057683_2059054_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.3e-32
>prophage 151
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2065055	2070759	4967401		Klebsiella_phage(25.0%)	5	NA	NA
WP_080028467.1|2065055_2066450_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000999466.1|2066607_2067603_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_080028468.1|2067845_2068739_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	2.3e-46
WP_032264589.1|2069096_2069717_+	acetyltransferase	NA	NA	NA	NA	NA
WP_032264590.1|2069718_2070759_+	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	37.2	4.0e-34
>prophage 152
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2079497	2082318	4967401		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_032264598.1|2079497_2080904_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_077491737.1|2081151_2082318_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	8.5e-110
>prophage 153
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2089673	2090573	4967401		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2089673_2090573_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 154
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2098216	2099383	4967401		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830143.1|2098216_2099383_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	5.5e-226
>prophage 155
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2104978	2107113	4967401		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692329.1|2104978_2105200_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001347688.1|2105262_2105739_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|2105754_2106240_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|2106294_2107113_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 156
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2113321	2116135	4967401	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_001373172.1|2113321_2114473_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
WP_106120865.1|2114906_2116135_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.7e-175
>prophage 157
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2143063	2144149	4967401		Wolbachia_phage(100.0%)	1	NA	NA
WP_001593456.1|2143063_2144149_+	cGAMP-activated phospholipase CapV	NA	A0A1B2LRS3	Wolbachia_phage	31.5	3.4e-20
>prophage 158
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2149821	2155360	4967401		Caulobacter_phage(50.0%)	3	NA	NA
WP_032737973.1|2149821_2150769_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.7	5.6e-51
WP_080028471.1|2151072_2151852_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_016240611.1|2151835_2155360_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	25.5	8.8e-17
>prophage 159
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2171951	2172137	4967401		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|2171951_2172137_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 160
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2179705	2236460	4967401	tail,integrase,holin,terminase	Escherichia_phage(26.67%)	45	2174269:2174284	2217022:2217037
2174269:2174284	attL	CGCAACTGGTTGTCGC	NA	NA	NA	NA
WP_040210965.1|2179705_2189197_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_046664393.1|2189284_2195392_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
WP_000140406.1|2195582_2196542_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098391.1|2196708_2198511_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_040210958.1|2198497_2200300_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_001593428.1|2200292_2201573_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703034.1|2201600_2202905_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001593427.1|2203098_2204361_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.5	7.4e-75
WP_001302302.1|2204698_2205496_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021546102.1|2205731_2206757_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|2206756_2206960_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069067231.1|2207018_2209460_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	7.8e-113
WP_021579309.1|2209553_2209745_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|2209741_2209930_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2210329_2210494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2210497_2210716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2210875_2211031_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_069067232.1|2211303_2212020_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.7e-52
WP_060615121.1|2212069_2212285_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693850.1|2212281_2212707_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475341.1|2212778_2213849_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_021546098.1|2213889_2214315_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|2214489_2215155_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_029488705.1|2215335_2215548_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_000737636.1|2215691_2216084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|2216380_2216659_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|2216660_2217710_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
2217022:2217037	attR	GCGACAACCAGTTGCG	NA	NA	NA	NA
WP_001217424.1|2217722_2218082_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_080028474.1|2218078_2218768_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.0e-58
WP_000839572.1|2219564_2219780_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|2219784_2220099_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|2220154_2220688_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|2220904_2221090_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|2221330_2221816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016240599.1|2222060_2222261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|2222268_2222619_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001333563.1|2222766_2223249_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|2223248_2225006_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_087758697.1|2225023_2225626_+	C40 family peptidase	NA	C6ZCZ3	Enterobacteria_phage	92.1	4.1e-92
WP_012311734.1|2225523_2226171_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_071549948.1|2226231_2229711_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_041498143.1|2229780_2230380_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.2e-105
WP_072042815.1|2230444_2233858_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
WP_041498150.1|2233857_2234439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.7e-101
WP_001079062.1|2235929_2236460_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 161
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2240004	2252384	4967401		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|2240004_2240676_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826787.1|2240675_2242034_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218214.1|2242141_2242993_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824361.1|2243584_2244658_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	8.1e-99
WP_012601575.1|2245222_2245588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|2245627_2246323_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157239.1|2246389_2247808_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786009.1|2247788_2248259_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212226.1|2248247_2249168_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|2249340_2250258_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2250336_2250519_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_012601574.1|2250689_2252384_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 162
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2266399	2267068	4967401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334608.1|2266399_2267068_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 163
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2279244	2279997	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_001273009.1|2279244_2279997_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 164
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2291988	2293503	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187772.1|2291988_2293503_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 165
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2303590	2309234	4967401		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001313042.1|2303590_2305252_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483205.1|2305297_2306899_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	3.7e-15
WP_000204335.1|2306917_2307778_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|2307780_2308830_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2308844_2309234_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 166
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2314486	2316220	4967401	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025347.1|2314486_2316220_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 167
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2324115	2326166	4967401		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|2324115_2324859_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2324899_2325295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|2325347_2326166_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 168
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2330184	2337249	4967401		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|2330184_2330706_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024929.1|2330707_2331310_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|2331381_2331447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|2331585_2332197_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2332205_2333216_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|2333362_2334148_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2334144_2334900_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2334978_2335911_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2335926_2337249_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 169
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2341248	2342724	4967401		Cyanophage(100.0%)	1	NA	NA
WP_000301730.1|2341248_2342724_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
>prophage 170
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2350780	2355250	4967401		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|2350780_2351443_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|2351466_2352123_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2352224_2352455_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2352593_2352968_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879285.1|2352971_2353844_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|2353856_2354198_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812734.1|2354593_2355250_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	4.7e-57
>prophage 171
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2362746	2364795	4967401		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|2362746_2364795_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 172
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2370125	2370335	4967401		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2370125_2370335_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 173
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2375974	2377531	4967401		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2375974_2377531_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 174
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2381393	2389499	4967401	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000854972.1|2381393_2382755_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2382828_2383008_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001295493.1|2383848_2384193_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2384324_2386235_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220979.1|2386292_2386988_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000268230.1|2387027_2387609_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|2387813_2389499_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 175
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2397872	2400051	4967401	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_001349736.1|2397872_2398835_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_000826413.1|2398842_2400051_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	8.6e-206
>prophage 176
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2406001	2410578	4967401		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|2406001_2407492_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616442.1|2407672_2409148_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|2409294_2410578_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 177
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2413896	2414751	4967401		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|2413896_2414751_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 178
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2417994	2418636	4967401		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|2417994_2418636_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 179
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2423562	2425524	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2423562_2425524_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 180
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2431122	2431776	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_001299561.1|2431122_2431776_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 181
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2438540	2439761	4967401		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2438540_2439761_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 182
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2447237	2448065	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|2447237_2448065_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 183
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2454192	2456454	4967401		Tupanvirus(100.0%)	1	NA	NA
WP_000077870.1|2454192_2456454_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.2e-144
>prophage 184
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2467753	2489489	4967401	tRNA,tail,capsid	Enterobacteria_phage(73.33%)	22	NA	NA
WP_001144192.1|2467753_2469682_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|2469685_2470228_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2470324_2470522_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2470574_2470931_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2471053_2471098_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018596.1|2471381_2472365_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|2472379_2474767_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2474771_2475071_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2475374_2475515_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|2475705_2475966_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024188892.1|2476115_2476619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132830.1|2477751_2478861_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|2479018_2480203_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|2480202_2480715_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2480769_2481135_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2481170_2481299_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_033544764.1|2481285_2484093_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000979945.1|2484105_2484594_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001100987.1|2484690_2485869_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_060615039.1|2485963_2486563_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
WP_071549942.1|2487654_2488629_-|tail	phage tail protein I	tail	A0A0A7NQ82	Enterobacteria_phage	100.0	1.3e-92
WP_033544761.1|2488652_2489489_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
>prophage 185
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2492623	2512039	4967401	integrase	Enterobacteria_phage(40.0%)	19	2492229:2492242	2507322:2507335
2492229:2492242	attL	CGCCATCATCTTGC	NA	NA	NA	NA
WP_000211261.1|2492623_2492935_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	1.0e-49
WP_033544759.1|2492939_2493899_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_033544758.1|2493975_2496801_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.8	0.0e+00
WP_021549223.1|2496797_2497187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094527.1|2497517_2497829_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_021529551.1|2497917_2498856_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	6.7e-81
WP_032157285.1|2498888_2499221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|2499325_2499655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|2499863_2500844_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|2500906_2501458_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2501457_2502207_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|2502284_2502749_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001315654.1|2502995_2503709_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175619.1|2503771_2505208_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|2505211_2505403_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|2505534_2506581_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|2506737_2507571_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
2507322:2507335	attR	GCAAGATGATGGCG	NA	NA	NA	NA
WP_000069375.1|2507903_2510282_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553715.1|2510338_2512039_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
>prophage 186
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2530630	2535714	4967401		Lake_Baikal_phage(33.33%)	4	NA	NA
WP_000367160.1|2530630_2530999_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|2531007_2532495_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|2532504_2533251_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000144602.1|2534493_2535714_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
>prophage 187
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2544004	2546271	4967401		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|2544004_2544673_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001088967.1|2544669_2545455_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587552.1|2545458_2546271_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 188
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2551775	2560567	4967401		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|2551775_2552417_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|2552456_2553605_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|2553895_2555107_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2555219_2556152_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080028477.1|2556148_2557174_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.7e-32
WP_000102278.1|2557472_2557562_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|2557727_2558897_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2559042_2559624_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|2559751_2560567_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 189
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2569370	2570869	4967401		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|2569370_2570267_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|2570347_2570869_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 190
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2577780	2579055	4967401	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_024199038.1|2577780_2579055_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	6.7e-84
>prophage 191
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2598937	2600749	4967401		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945924.1|2598937_2600749_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 192
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2610644	2611946	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|2610644_2611946_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 193
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2622046	2671271	4967401	integrase,terminase,lysis,tail,protease	Enterobacteria_phage(37.04%)	57	2639177:2639191	2654099:2654113
WP_001260855.1|2622046_2622868_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2622967_2623051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2623143_2623479_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|2623875_2625129_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2625235_2626129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225275.1|2626263_2627484_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2627608_2628304_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2628256_2629549_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2629708_2630323_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2630365_2631220_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2631221_2631839_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2631849_2634273_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_077627936.1|2634333_2635443_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.9	1.1e-85
WP_001249849.1|2635668_2637024_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000113586.1|2637546_2637915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020819.1|2638311_2639403_+	hypothetical protein	NA	NA	NA	NA	NA
2639177:2639191	attL	ACGAAGAATACTTCG	NA	NA	NA	NA
WP_000095383.1|2639730_2640240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025924.1|2640326_2641316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041533.1|2641780_2643259_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.2e-120
WP_001295396.1|2643457_2643763_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2643870_2644581_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2644583_2645144_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2645178_2645520_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2645654_2645981_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2646186_2647401_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2647412_2648432_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2648489_2648600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876993.1|2648619_2649900_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2649934_2650171_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048320.1|2650258_2652730_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2652823_2653015_-	YebW family protein	NA	NA	NA	NA	NA
WP_000854559.1|2653011_2653200_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|2653599_2653764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171933.1|2653767_2653986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2654145_2654301_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
2654099:2654113	attR	CGAAGTATTCTTCGT	NA	NA	NA	NA
WP_000448563.1|2654467_2654875_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2654958_2655189_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|2655172_2655694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2655674_2656640_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001151251.1|2656680_2657103_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000566848.1|2657355_2658255_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|2658569_2659223_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|2659235_2659931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|2660616_2660829_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000980987.1|2661045_2661297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2661363_2661642_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265276.1|2661643_2662693_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_001204811.1|2662710_2663088_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_000780579.1|2663244_2663769_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_000592549.1|2663961_2664921_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839586.1|2665852_2666068_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_001348167.1|2666067_2666565_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|2666781_2666964_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2667054_2667348_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_000421825.1|2668028_2668568_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_100069996.1|2668576_2669887_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000885571.1|2670689_2671271_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
>prophage 194
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2674376	2676076	4967401		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000527797.1|2674376_2675837_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|2675872_2676076_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 195
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2681442	2682333	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|2681442_2682333_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 196
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2689837	2691967	4967401		Pandoravirus(50.0%)	3	NA	NA
WP_000012618.1|2689837_2691277_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_000803659.1|2691333_2691552_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2691583_2691967_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 197
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2699712	2701131	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|2699712_2701131_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 198
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2709012	2710548	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|2709012_2710548_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 199
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2736735	2743671	4967401		Bacillus_phage(50.0%)	3	NA	NA
WP_001296749.1|2736735_2738421_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_000832440.1|2738458_2740831_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001307214.1|2740875_2743671_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 200
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2748945	2752752	4967401		Bacillus_virus(50.0%)	2	NA	NA
WP_000426261.1|2748945_2750328_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|2750352_2752752_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 201
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2757068	2758974	4967401		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193563.1|2757068_2758055_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-17
WP_000072429.1|2758047_2758974_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 202
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2762248	2763690	4967401		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|2762248_2763259_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|2763405_2763690_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 203
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2769702	2769993	4967401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001347834.1|2769702_2769993_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 204
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2776878	2778423	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|2776878_2778423_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 205
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2791574	2793677	4967401		Salmonella_phage(100.0%)	1	NA	NA
WP_000689359.1|2791574_2793677_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	2.4e-134
>prophage 206
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2797945	2798755	4967401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|2797945_2798755_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 207
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2802136	2812310	4967401	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|2802136_2803150_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|2803167_2804313_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760592.1|2804557_2805964_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|2806042_2806459_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|2806504_2806681_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|2806902_2807133_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001593323.1|2807224_2809186_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.2e-23
WP_000429155.1|2809258_2809795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001348055.1|2809847_2811062_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_001372110.1|2811101_2812310_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
>prophage 208
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2824117	2825066	4967401		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|2824117_2824291_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2824535_2825066_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 209
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2829005	2832908	4967401		Klosneuvirus(100.0%)	1	NA	NA
WP_000139553.1|2829005_2832908_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 210
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2851849	2852839	4967401		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2851849_2852839_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 211
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2857799	2867387	4967401	tail,transposase	Enterobacteria_phage(44.44%)	10	NA	NA
WP_000837924.1|2857799_2858933_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2859073_2859508_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|2860284_2860398_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|2860466_2860700_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|2861016_2861607_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_080028384.1|2861704_2862280_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	2.0e-104
WP_080028385.1|2862279_2864346_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	57.0	5.1e-198
WP_087758690.1|2864374_2865495_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000149055.1|2865630_2865969_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|2866225_2867387_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 212
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2872206	2890505	4967401	tRNA,integrase	Escherichia_phage(66.67%)	22	2873543:2873556	2887928:2887941
WP_155119857.1|2872206_2874204_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
2873543:2873556	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|2874544_2874967_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_080028387.1|2875007_2876078_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693853.1|2876149_2876575_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2876571_2876826_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2876905_2877325_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|2877611_2877746_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2877756_2877912_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2877908_2878397_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2878838_2879060_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2879059_2879230_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2879304_2879580_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105127.1|2879681_2882282_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_060615110.1|2882274_2883057_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	73.0	5.5e-105
WP_001317028.1|2883140_2883335_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2883327_2883537_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2883615_2883831_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2883832_2885068_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|2885119_2886055_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|2886183_2887557_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2888034_2889018_-	zinc transporter ZntB	NA	NA	NA	NA	NA
2887928:2887941	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_069067245.1|2889272_2890505_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 213
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2896831	2897347	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|2896831_2897347_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 214
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2915509	2916592	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_060615107.1|2915509_2916592_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.6e-23
>prophage 215
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2930595	2931861	4967401		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|2930595_2931861_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 216
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2944776	2950436	4967401		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|2944776_2945583_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968857.1|2945650_2946004_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2946373_2947162_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|2947306_2948434_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|2948501_2950436_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 217
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2958251	2958842	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2958251_2958842_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 218
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2963766	2969058	4967401	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|2963766_2966364_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|2966743_2966995_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|2967030_2968080_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2968299_2969058_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
>prophage 219
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2973991	2976949	4967401		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|2973991_2975587_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2975590_2976949_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 220
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	2988606	2990621	4967401		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|2988606_2989611_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|2989607_2990621_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 221
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3000035	3006399	4967401		Citrobacter_phage(33.33%)	7	NA	NA
WP_000068079.1|3000035_3000653_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|3001258_3001672_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3001815_3002724_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|3002925_3003939_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|3004030_3004936_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|3005048_3005507_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|3005556_3006399_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
>prophage 222
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3009786	3011325	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_000702660.1|3009786_3011325_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 223
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3022579	3022810	4967401		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|3022579_3022810_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 224
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3025911	3029919	4967401		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|3025911_3026766_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3026801_3027611_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|3027614_3028007_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|3028003_3028837_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3028836_3029919_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 225
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3033055	3046727	4967401	tRNA,integrase,transposase	Tupanvirus(16.67%)	9	3030719:3030731	3049920:3049932
3030719:3030731	attL	AAGCGACAGACAC	NA	NA	NA	NA
WP_001298109.1|3033055_3034003_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3034127_3035807_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3035861_3036140_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3036417_3037002_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3037118_3038210_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_019841501.1|3038424_3039624_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	4.5e-74
WP_001443045.1|3040581_3041733_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
WP_072275333.1|3042632_3043415_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000699006.1|3045329_3046727_+	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
3049920:3049932	attR	AAGCGACAGACAC	NA	NA	NA	NA
>prophage 226
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3055663	3056611	4967401	integrase	Bacillus_phage(100.0%)	1	3043836:3043848	3057708:3057720
3043836:3043848	attL	GCGTCACGTTGCA	NA	NA	NA	NA
WP_000213673.1|3055663_3056611_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000213673.1|3055663_3056611_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
3057708:3057720	attR	GCGTCACGTTGCA	NA	NA	NA	NA
>prophage 227
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3060069	3060339	4967401		Vibrio_phage(100.0%)	1	NA	NA
WP_001442951.1|3060069_3060339_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
>prophage 228
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3095237	3098488	4967401		Salmonella_phage(33.33%)	3	NA	NA
WP_000457616.1|3095237_3096506_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|3096505_3096925_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_059295014.1|3097003_3098488_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.2	2.6e-31
>prophage 229
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3107370	3109692	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|3107370_3109692_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 230
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3115559	3119288	4967401		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|3115559_3116291_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3116511_3116916_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|3116968_3117079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|3117611_3117935_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|3118037_3119288_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 231
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3122424	3123795	4967401		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3122424_3123795_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 232
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3128815	3130793	4967401		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|3128815_3129952_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|3129935_3130793_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 233
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3134069	3137792	4967401		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|3134069_3134891_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|3134906_3135818_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251350.1|3135846_3137091_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|3137090_3137792_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 234
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3145081	3145339	4967401		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3145081_3145339_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 235
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3157671	3159314	4967401		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267920.1|3157671_3158676_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|3158672_3159314_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 236
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3162586	3163768	4967401		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3162586_3162823_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|3163033_3163768_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 237
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3176126	3177068	4967401		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001323587.1|3176126_3177068_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 238
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3192914	3193160	4967401		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3192914_3193160_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 239
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3197822	3198743	4967401		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3197822_3198743_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 240
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3208051	3208585	4967401		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000845150.1|3208051_3208585_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.7e-25
>prophage 241
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3212719	3213553	4967401		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189312.1|3212719_3213553_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 242
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3218789	3221351	4967401	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|3218789_3219951_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|3219992_3221351_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
>prophage 243
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3228170	3229094	4967401		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|3228170_3229094_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 244
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3243870	3245970	4967401		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|3243870_3244365_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240630.1|3244385_3245714_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	4.5e-232
WP_001273658.1|3245796_3245970_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 245
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3250273	3262528	4967401		Klosneuvirus(20.0%)	13	NA	NA
WP_000420629.1|3250273_3251194_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3251193_3251499_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|3251591_3252191_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|3252187_3254734_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|3254733_3255906_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3256035_3256728_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|3256700_3257729_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001367057.1|3257811_3260556_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829672.1|3260627_3261701_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3261748_3261922_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|3261911_3262142_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524630.1|3262116_3262305_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3262315_3262528_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 246
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3281793	3282453	4967401	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3281793_3282453_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 247
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3286686	3288741	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|3286686_3288741_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 248
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3301340	3303248	4967401		Tupanvirus(100.0%)	1	NA	NA
WP_000053124.1|3301340_3303248_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	8.3e-54
>prophage 249
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3319170	3325794	4967401	tRNA	Bacillus_virus(33.33%)	4	NA	NA
WP_001090508.1|3319170_3319938_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193844.1|3320144_3322757_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|3323022_3324225_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117889.1|3324393_3325794_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	3.1e-82
>prophage 250
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3331025	3331574	4967401		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001347776.1|3331025_3331574_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	34.7	3.2e-06
>prophage 251
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3346279	3350820	4967401		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|3346279_3348028_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3348064_3350329_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3350535_3350820_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 252
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3355906	3356995	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|3355906_3356995_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 253
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3361093	3364308	4967401		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292820.1|3361093_3363376_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|3363567_3364308_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 254
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3370618	3394377	4967401	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|3370618_3371236_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850313.1|3371246_3373691_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000886683.1|3373929_3375222_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|3375312_3376656_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3376666_3377278_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|3377432_3381500_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3381634_3382129_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3382673_3383639_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043601.1|3383761_3385528_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202180.1|3385528_3387250_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	7.6e-22
WP_001241678.1|3387291_3387996_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3388280_3388499_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3389183_3391460_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3391490_3391811_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3392133_3392358_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3392430_3394377_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
>prophage 255
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3403636	3405355	4967401		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|3403636_3405355_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 256
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3408942	3411680	4967401		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|3408942_3409773_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160739.1|3409769_3410093_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|3410218_3410734_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027195.1|3410951_3411680_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
>prophage 257
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3415017	3424167	4967401		Streptococcus_phage(25.0%)	10	NA	NA
WP_001149732.1|3415017_3416145_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3416185_3416674_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061670.1|3416733_3417579_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|3417575_3418529_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996022.1|3418538_3419672_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_000126097.1|3419766_3420879_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3421229_3421706_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3421793_3422696_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001201576.1|3423462_3423750_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|3423909_3424167_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 258
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3432733	3433936	4967401		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3432733_3433936_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 259
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3445271	3447143	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|3445271_3447143_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 260
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3450370	3454501	4967401		Synechococcus_phage(50.0%)	3	NA	NA
WP_000424893.1|3450370_3451033_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001442269.1|3451163_3452063_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209304.1|3452068_3454501_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 261
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3458379	3459972	4967401		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|3458379_3459972_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 262
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3464969	3470194	4967401		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|3464969_3465485_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3465537_3465603_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3465837_3466725_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3467023_3467527_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3467930_3468677_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3468815_3469475_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3469471_3470194_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 263
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3473734	3488546	4967401		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|3473734_3473995_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430036.1|3474259_3476542_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|3476583_3477261_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3477334_3477601_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3477865_3478126_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443536.1|3478354_3479440_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3479580_3480543_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001398823.1|3480570_3482721_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_001145127.1|3482840_3483323_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_000007101.1|3483554_3484919_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3485147_3485819_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001347780.1|3485821_3486817_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3486809_3488546_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
>prophage 264
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3499857	3500766	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3499857_3500766_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 265
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3507247	3508537	4967401		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|3507247_3508537_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 266
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3518892	3525466	4967401		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891684.1|3518892_3519951_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|3519953_3520643_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|3520642_3521416_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3521582_3521732_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147439.1|3521860_3522649_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|3522716_3524189_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|3524449_3525466_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 267
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3529822	3533342	4967401		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|3529822_3530875_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|3531190_3531571_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951296.1|3531684_3532626_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	3.7e-23
WP_000345410.1|3532622_3533342_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 268
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3569224	3570016	4967401		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|3569224_3570016_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 269
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3573394	3576336	4967401		Acinetobacter_phage(50.0%)	2	NA	NA
WP_080028413.1|3573394_3574876_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	7.2e-45
WP_000628041.1|3574917_3576336_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	1.8e-61
>prophage 270
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3580799	3593520	4967401		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_071549920.1|3580799_3584993_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|3585235_3585442_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|3585754_3585844_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|3585843_3587517_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087967.1|3587539_3589588_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001297248.1|3589596_3590169_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001297245.1|3590161_3592846_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|3592842_3593520_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 271
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3600175	3600940	4967401		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|3600175_3600940_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 272
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3605090	3608904	4967401	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|3605090_3606755_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|3606957_3608904_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 273
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3613530	3615195	4967401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|3613530_3615195_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 274
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3619291	3620371	4967401		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3619291_3620371_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 275
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3628267	3631800	4967401		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|3628267_3628993_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|3629110_3630046_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367909.1|3630129_3631800_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	3.0e-76
>prophage 276
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3638738	3641321	4967401	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3638738_3641321_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 277
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3648331	3650771	4967401		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|3648331_3649420_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|3649559_3650771_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 278
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3655586	3656233	4967401		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|3655586_3655970_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3656023_3656233_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 279
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3671658	3673773	4967401		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|3671658_3672087_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|3672207_3673773_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 280
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3676882	3678705	4967401		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029824.1|3676882_3678103_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
WP_000502941.1|3678075_3678705_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 281
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3693065	3699108	4967401		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|3693065_3693881_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096713.1|3693877_3695011_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077708.1|3695226_3699108_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	2.0e-62
>prophage 282
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3710536	3713680	4967401		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|3710536_3713680_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 283
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3716825	3725504	4967401		Salmonella_phage(33.33%)	7	NA	NA
WP_000770953.1|3716825_3717509_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253830.1|3717498_3718947_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103246.1|3719683_3721585_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	8.6e-27
WP_000147895.1|3723403_3723874_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	60.7	1.2e-35
WP_001182903.1|3723870_3724410_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3724479_3724710_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3724814_3725504_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
>prophage 284
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3733725	3736856	4967401	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|3733725_3734592_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3734593_3734806_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3734913_3735435_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3735470_3736856_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 285
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3748344	3749490	4967401		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|3748344_3749490_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 286
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3755680	3757462	4967401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001347858.1|3755680_3757462_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	4.1e-39
>prophage 287
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3761770	3771866	4967401	transposase	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_085947771.1|3761770_3762932_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001347856.1|3762929_3763643_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
WP_000014696.1|3764050_3768340_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000561866.1|3768768_3771183_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|3771179_3771866_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 288
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3775002	3775680	4967401		Bacillus_virus(100.0%)	1	NA	NA
WP_001157550.1|3775002_3775680_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 289
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3780219	3783179	4967401		uncultured_virus(50.0%)	2	NA	NA
WP_080028414.1|3780219_3782724_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.1e-114
WP_001344274.1|3782837_3783179_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 290
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3791423	3799985	4967401		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801846.1|3791423_3792383_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
WP_001250088.1|3792379_3793342_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001347617.1|3793577_3794222_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|3794402_3796277_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|3796386_3796992_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3796991_3797321_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|3797373_3799305_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3799433_3799985_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 291
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3806993	3810143	4967401		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3806993_3810143_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 292
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3818977	3822524	4967401		Bacillus_phage(100.0%)	2	NA	NA
WP_001256180.1|3818977_3820759_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
WP_001235598.1|3820751_3822524_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
>prophage 293
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3825847	3826543	4967401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|3825847_3826543_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 294
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3829671	3834717	4967401		Bacillus_phage(33.33%)	3	NA	NA
WP_001043542.1|3829671_3829944_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|3830152_3832507_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000122253.1|3834093_3834717_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 295
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3858423	3867404	4967401	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|3858423_3858894_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150455.1|3858982_3860086_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.2e-54
WP_000543535.1|3860089_3860539_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|3860689_3861229_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|3861527_3862412_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|3862588_3862936_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|3863064_3864036_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|3864046_3865894_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|3865921_3866254_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|3866276_3867404_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 296
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3874356	3884328	4967401		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|3874356_3875652_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|3875709_3876399_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|3876588_3877791_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698883.1|3877787_3880931_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345723.1|3881056_3882241_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|3882383_3883292_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|3883416_3884328_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 297
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3888617	3889733	4967401		Bacillus_phage(100.0%)	1	NA	NA
WP_000484027.1|3888617_3889733_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 298
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3897148	3898306	4967401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3897148_3898306_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 299
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3905295	3906063	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|3905295_3906063_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 300
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3911359	3912469	4967401		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3911359_3912469_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 301
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3918305	3920266	4967401		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|3918305_3919319_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3919315_3920266_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 302
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3925676	3929956	4967401		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|3925676_3926759_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177923.1|3926881_3929956_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.2	0.0e+00
>prophage 303
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3934497	3940092	4967401		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|3934497_3935397_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_001299008.1|3935436_3936720_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|3936709_3937969_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010248.1|3938205_3940092_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.8e-53
>prophage 304
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3948468	3953006	4967401		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_069067266.1|3948468_3949518_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.0	3.2e-71
WP_000750340.1|3949604_3950561_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|3950557_3951529_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|3951521_3953006_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 305
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	3964999	4031133	4967401	tail,integrase,holin	Shigella_phage(42.11%)	53	3998435:3998450	4029180:4029195
WP_023277486.1|3964999_3968983_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	4.2e-124
WP_000131044.1|3969555_3971589_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3971717_3972305_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|3972318_3973791_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3973804_3975475_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|3976549_3977113_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|3977442_3978237_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|3978390_3979152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|3980297_3981491_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|3981674_3982340_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|3982585_3983281_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|3983273_3984701_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|3984711_3985431_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|3985960_3986815_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046304.1|3987040_3988366_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474074.1|3988474_3988711_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3988722_3989316_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_024198277.1|3989475_3990345_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_000092619.1|3991571_3995825_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3996919_3997021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3997383_3997647_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3997646_3997787_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3997821_3998049_-	hypothetical protein	NA	NA	NA	NA	NA
3998435:3998450	attL	TCCCTTACCCTTAAAA	NA	NA	NA	NA
WP_001296902.1|3998871_3999414_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3999488_4000076_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4000133_4000802_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|4000827_4003353_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|4003342_4004986_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|4004954_4005665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|4005977_4006307_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4006554_4007169_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|4007586_4008276_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000667026.1|4009257_4011456_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|4011465_4012422_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|4012400_4012811_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_042058399.1|4013432_4014365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614957.1|4015925_4016909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048228913.1|4017564_4018239_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.0e-78
WP_023568709.1|4018341_4018644_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_023568708.1|4018649_4019270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023568707.1|4019704_4020256_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.9e-86
WP_071549914.1|4020327_4020675_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.2	4.6e-11
WP_000090998.1|4020859_4021216_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_069067270.1|4021215_4022355_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	75.3	1.3e-190
WP_087758695.1|4022338_4022509_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	1.0e-24
WP_001191674.1|4024102_4024363_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4024460_4025153_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000206732.1|4025549_4025855_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|4025770_4026205_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|4026081_4027245_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_058685605.1|4027417_4028641_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060614976.1|4028671_4028950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614977.1|4029288_4031133_-	cell envelope integrity protein TolA	NA	A0A1Q1N989	Escherichia_phage	32.4	1.5e-63
4029180:4029195	attR	TTTTAAGGGTAAGGGA	NA	NA	NA	NA
>prophage 306
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4041152	4044864	4967401		Streptococcus_phage(66.67%)	3	NA	NA
WP_000893255.1|4041152_4042406_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|4042417_4043521_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4043808_4044864_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 307
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4049541	4050708	4967401		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|4049541_4050708_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 308
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4073960	4076918	4967401		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_001143095.1|4073960_4076405_+	glycosyltransferase	NA	A0A0N9R0I0	Chrysochromulina_ericina_virus	40.2	9.0e-45
WP_000859525.1|4076522_4076918_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 309
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4090589	4094508	4967401		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543899.1|4090589_4091363_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|4091548_4091809_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615982.1|4091811_4092090_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4092245_4092986_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4092956_4093724_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4093929_4094508_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 310
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4105424	4107566	4967401		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103360.1|4105424_4107566_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	6.3e-26
>prophage 311
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4115306	4123159	4967401		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|4115306_4116038_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4116102_4116570_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4116566_4117289_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4117322_4118078_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4118149_4119508_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|4119555_4120326_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4120403_4121204_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|4121444_4122359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|4122355_4123159_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
>prophage 312
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4129808	4130840	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4129808_4130840_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 313
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4145078	4149194	4967401		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|4145078_4148561_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4148597_4149194_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 314
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4158022	4158781	4967401		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4158022_4158781_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 315
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4170665	4172090	4967401	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4170665_4172090_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 316
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4176019	4176364	4967401		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4176019_4176364_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 317
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4182275	4183073	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158933.1|4182275_4183073_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	4.6e-14
>prophage 318
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4188316	4195122	4967401	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_024198265.1|4188316_4190746_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.1e-39
WP_001294697.1|4190819_4191350_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|4191364_4192069_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4192246_4192702_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000937432.1|4192738_4193665_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|4193703_4195122_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 319
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4205028	4205931	4967401	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|4205028_4205931_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 320
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4209193	4215661	4967401		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|4209193_4210120_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4210228_4210891_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|4210931_4211468_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000996827.1|4211673_4214064_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189602.1|4214110_4215661_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 321
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4223311	4224736	4967401		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_062881927.1|4223311_4224736_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	7.1e-42
>prophage 322
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4233363	4233915	4967401		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4233363_4233915_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 323
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4238160	4239204	4967401		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4238160_4239204_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 324
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4265189	4266914	4967401		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425664.1|4265189_4266914_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 325
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4279616	4280315	4967401		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|4279616_4280315_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 326
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4286635	4292058	4967401		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035654.1|4286635_4288987_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117011.1|4289151_4292058_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 327
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4299802	4301202	4967401		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|4299802_4300645_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|4300722_4301202_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 328
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4309096	4314757	4967401		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|4309096_4310611_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|4310641_4311784_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349938.1|4311912_4313130_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|4313203_4314757_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 329
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4320227	4321376	4967401		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4320227_4321376_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 330
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4325782	4328599	4967401	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|4325782_4328599_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 331
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4335632	4344701	4967401		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|4335632_4336799_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|4337327_4337537_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|4337640_4338771_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|4338859_4340776_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|4341152_4341557_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|4341582_4342296_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|4342444_4343011_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|4343045_4343633_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|4343747_4344701_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 332
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4356469	4358583	4967401		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_069067225.1|4356469_4357894_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188656.1|4357893_4358583_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	5.2e-30
>prophage 333
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4361866	4367221	4967401		Bacillus_phage(33.33%)	3	NA	NA
WP_000409465.1|4361866_4363804_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4364014_4365682_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4365988_4367221_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 334
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4373964	4375287	4967401		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4373964_4375287_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 335
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4380922	4383798	4967401		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|4380922_4381084_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4381210_4381816_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|4382208_4383798_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 336
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4391694	4392974	4967401		Salmonella_phage(50.0%)	2	NA	NA
WP_000098816.1|4391694_4392234_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	1.4e-27
WP_000799911.1|4392236_4392974_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 337
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4396200	4401565	4967401		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|4396200_4397223_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091569.1|4397361_4398276_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410129.1|4398490_4399852_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|4399900_4401565_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 338
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4418174	4442034	4967401	integrase,transposase	Acinetobacter_phage(20.0%)	21	4423253:4423312	4446786:4447553
WP_001593930.1|4418174_4420607_+	DEAD/DEAH box helicase	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001387312.1|4420673_4422143_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
4423253:4423312	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000412211.1|4424243_4424903_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4425103_4425481_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032426534.1|4425791_4426796_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|4426874_4429841_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|4429843_4430404_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4430529_4430880_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|4431082_4432096_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_045899678.1|4432785_4433259_+	trimethoprim-resistant dihydrofolate reductase Dfr7	NA	A0A1B2IBQ4	Erwinia_phage	35.4	9.0e-18
WP_045899677.1|4433405_4433837_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001007673.1|4433918_4434746_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|4434881_4435229_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4435222_4436062_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4436189_4436690_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|4436672_4436813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|4437196_4437961_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000480968.1|4438162_4438999_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|4438998_4439802_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|4439908_4441038_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_085947932.1|4441274_4442034_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
4446786:4447553	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 339
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4445920	4449895	4967401	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_000027057.1|4445920_4446781_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000181165.1|4448938_4449895_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.0e-60
>prophage 340
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4457396	4457951	4967401		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|4457396_4457951_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 341
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4464518	4465979	4967401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4464518_4465979_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 342
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4476252	4477929	4967401		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|4476252_4476849_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|4477326_4477929_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 343
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4481292	4485602	4967401		Stx2-converting_phage(50.0%)	3	NA	NA
WP_000991447.1|4481292_4482273_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
WP_000168559.1|4482484_4483357_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000177023.1|4483526_4485602_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
>prophage 344
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4492480	4506060	4967401	tRNA	Tupanvirus(20.0%)	8	NA	NA
WP_001022619.1|4492480_4493950_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001593906.1|4495897_4496917_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001347963.1|4497046_4498549_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|4498667_4499750_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4499749_4500850_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4501116_4502628_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|4502722_4503205_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|4503204_4506060_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 345
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4514337	4520434	4967401		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|4514337_4515273_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4515285_4515747_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4515819_4516206_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|4516411_4519108_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4519248_4519302_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|4519486_4520434_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 346
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4524072	4526833	4967401		Vibrio_phage(50.0%)	2	NA	NA
WP_000187795.1|4524072_4526211_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106236.1|4526368_4526833_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
>prophage 347
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4531143	4537801	4967401		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|4531143_4532142_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4532174_4533170_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|4533156_4534179_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|4534192_4535695_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|4536004_4536961_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4537270_4537801_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 348
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4581130	4582294	4967401		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943965.1|4581130_4582294_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 349
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4586226	4599258	4967401	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|4586226_4588668_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|4588706_4589132_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4589336_4590635_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4590738_4590936_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4591017_4592022_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4592024_4593284_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4593369_4594650_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4594726_4595035_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4595120_4596071_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|4596063_4597911_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|4597920_4599258_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 350
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4603173	4603719	4967401		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4603173_4603719_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 351
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4611702	4612680	4967401		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4611702_4612680_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 352
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4617600	4618134	4967401		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4617600_4618134_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 353
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4622642	4624626	4967401		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|4622642_4624289_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4624332_4624626_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 354
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4632960	4636824	4967401	integrase	Enterobacteria_phage(50.0%)	2	4627956:4627968	4638152:4638164
4627956:4627968	attL	ATGCCAGCTAAAG	NA	NA	NA	NA
WP_001218773.1|4632960_4634226_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
WP_155119858.1|4636281_4636824_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	90.0	6.3e-07
4638152:4638164	attR	CTTTAGCTGGCAT	NA	NA	NA	NA
>prophage 355
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4645626	4647482	4967401		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502858.1|4645626_4646265_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	52.5	3.0e-56
WP_022645126.1|4646249_4647482_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	1.7e-60
>prophage 356
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4663198	4663774	4967401		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|4663198_4663774_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 357
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4670599	4674181	4967401		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000792585.1|4670599_4671829_+	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
WP_000494233.1|4671845_4672901_+	response regulator	NA	NA	NA	NA	NA
WP_001001003.1|4673029_4674181_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 358
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4682482	4683644	4967401	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|4682482_4683644_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 359
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4686937	4687741	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_001609855.1|4686937_4687741_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
>prophage 360
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4691438	4693240	4967401	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001295213.1|4691438_4692461_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_072133117.1|4692457_4693240_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
>prophage 361
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4700776	4703116	4967401		Yersinia_phage(33.33%)	4	NA	NA
WP_001175165.1|4700776_4701595_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
WP_000706978.1|4701860_4702340_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.2e-12
WP_001186774.1|4702355_4702832_+	RadC family protein	NA	NA	NA	NA	NA
WP_023356553.1|4702894_4703116_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
>prophage 362
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4711731	4714943	4967401	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|4711731_4713189_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|4713425_4714943_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 363
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4736139	4737642	4967401		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4736139_4737642_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 364
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4742481	4743270	4967401		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4742481_4743270_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 365
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4748874	4750424	4967401		Bacillus_virus(50.0%)	2	NA	NA
WP_001039799.1|4748874_4749633_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611404.1|4749743_4750424_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 366
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4754409	4756395	4967401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|4754409_4756395_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 367
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4761640	4763788	4967401		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4761640_4763788_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 368
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4773070	4775029	4967401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4773070_4775029_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 369
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4780612	4781962	4967401		Moraxella_phage(100.0%)	1	NA	NA
WP_000106888.1|4780612_4781962_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 370
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4785779	4789392	4967401		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|4785779_4786316_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|4786569_4789392_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 371
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4793599	4796147	4967401		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|4793599_4794679_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4794731_4796147_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 372
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4802775	4803384	4967401		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4802775_4803384_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 373
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4812599	4813715	4967401		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4812599_4813715_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 374
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4829576	4830368	4967401		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130538.1|4829576_4830368_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.5e-46
>prophage 375
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4836017	4839701	4967401		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|4836017_4839701_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 376
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4855079	4856669	4967401		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4855079_4856669_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 377
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4862037	4863801	4967401		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|4862037_4862310_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|4862496_4863087_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|4863129_4863801_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 378
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4873016	4881345	4967401		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|4873016_4877240_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|4877316_4881345_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 379
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4885461	4888514	4967401		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4885461_4886646_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4887563_4888514_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 380
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4897023	4898868	4967401		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|4897023_4898868_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 381
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4905618	4906833	4967401		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|4905618_4906833_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 382
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4919016	4926263	4967401		Serratia_phage(33.33%)	5	NA	NA
WP_000184829.1|4919016_4921314_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4921364_4921685_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4921699_4922779_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174081.1|4923087_4925589_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424837.1|4925600_4926263_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.1e-28
>prophage 383
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4939255	4943440	4967401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001611588.1|4939255_4943440_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
>prophage 384
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4949077	4953580	4967401		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|4949077_4950409_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4950475_4951402_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4951494_4951980_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4952064_4952310_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4952734_4953580_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 385
NZ_CP021722	Escherichia coli strain AR_0128, complete genome	4967401	4964610	4966493	4967401		Salmonella_phage(100.0%)	3	NA	NA
WP_021567699.1|4964610_4964994_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	98.4	2.7e-65
WP_001251454.1|4965083_4965326_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_021567698.1|4965374_4966493_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	1.9e-191
>prophage 1
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	0	10586	128094		Sodalis_phage(25.0%)	18	NA	NA
WP_001348526.1|451_793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|807_1278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516918.1|1270_1642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|1652_1847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061573.1|2187_2736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270043.1|2898_3249_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000124640.1|3253_3556_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001239998.1|3582_3876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043046.1|3964_4237_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.6e-19
WP_004201083.1|4294_4822_-	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	32.4	2.0e-05
WP_001270409.1|4824_5016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167036.1|5041_5899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972665.1|5885_6116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210757.1|6115_6634_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919343.1|6630_7077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422769.1|7076_7436_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591076.1|7493_7922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348528.1|9608_10586_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	30.5	1.6e-16
>prophage 2
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	14226	15342	128094		unidentified_phage(100.0%)	1	NA	NA
WP_000946104.1|14226_15342_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	8.3e-46
>prophage 3
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	19245	22992	128094		Bacillus_phage(50.0%)	7	NA	NA
WP_000077457.1|19245_20229_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|20245_20539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|20540_20960_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|21019_21571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|21567_22176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|22186_22720_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|22719_22992_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 4
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	30320	31832	128094		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|30320_31832_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 5
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	34991	71382	128094	transposase,integrase	Salmonella_phage(30.0%)	33	23562:23582	75578:75598
23562:23582	attL	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
WP_004201184.1|34991_35861_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|35865_36876_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|36878_37415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|37713_38034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|38264_38867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|38882_39335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|39505_39946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069067410.1|39917_44171_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_000988731.1|44303_45029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326390.1|45142_45544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|46159_47164_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|47242_47677_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|49142_49847_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072199448.1|50337_50757_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000080860.1|52842_53979_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|54029_54275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|54280_54472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855769.1|55112_55958_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_004201046.1|56055_56709_-	endonuclease III	NA	NA	NA	NA	NA
WP_001183923.1|58219_58519_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|58602_58845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|58971_59811_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|59804_60152_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_032488579.1|60320_60875_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845048.1|61105_62119_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|62424_62982_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|62984_65957_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|66035_67040_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000714163.1|67221_67443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268337.1|67515_67794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|67780_69508_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077336.1|69685_70072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|70530_71382_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
75578:75598	attR	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
>prophage 6
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	80864	83552	128094		Mycobacterium_phage(33.33%)	3	NA	NA
WP_000706865.1|80864_81875_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001282585.1|81937_82927_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|83021_83552_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
>prophage 7
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	93148	96507	128094	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_001221666.1|93148_93682_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_015058212.1|93775_94921_-	class C beta-lactamase CMY-6	NA	NA	NA	NA	NA
WP_000608644.1|95244_96507_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 8
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	103604	119975	128094		Streptococcus_phage(12.5%)	24	NA	NA
WP_000366823.1|103604_105797_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_004201072.1|105811_106300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|106390_106690_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|106901_107519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|107574_108231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|108230_109658_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|109661_110162_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000348669.1|110170_110503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|110487_110919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|110986_111661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044823.1|111635_111917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|111909_112287_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|112613_112757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|112848_113484_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|113536_113809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|113857_115039_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151305.1|115042_115828_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-10
WP_000380893.1|116001_116313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053910.1|116294_116744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348523.1|116757_118005_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001258026.1|117994_118357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096360.1|118359_118602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532167.1|118839_119037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268394.1|119036_119975_-	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.2e-69
>prophage 9
NZ_CP021719	Escherichia coli strain AR_0128 plasmid tig00000792, complete sequence	128094	124435	125899	128094		Phormidium_phage(100.0%)	1	NA	NA
WP_004201081.1|124435_125899_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
>prophage 1
NZ_CP021720	Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence	216378	773	125160	216378	capsid,head,holin,tRNA,tail,plate,transposase,lysis,integrase	Escherichia_phage(81.9%)	126	26392:26451	129343:132579
WP_012817690.1|773_3782_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_094334140.1|3855_4050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|4282_4591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|5084_5633_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004099053.1|6042_7011_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_020316917.1|7487_8159_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
WP_050484131.1|8398_9382_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032441801.1|9543_10524_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.8e-186
WP_000427623.1|11457_12462_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015065644.1|12540_15507_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|15581_15872_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|15868_16270_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|16259_16616_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|16870_17185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|17611_18793_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|19452_20058_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|20152_23050_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_017899891.1|23482_23806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714822.1|24924_25641_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000677445.1|25675_26311_-	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
26392:26451	attL	TGGGGTTCTAGGGATTTTCCGTCCAAAAACGACAAAGTGCTCTGGAGGCCGCGCCGTCCG	NA	NA	NA	NA
WP_021740570.1|26468_29486_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004201172.1|30943_31234_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|31427_31757_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|31761_32793_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|32803_33442_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|33446_33812_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|33815_34628_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_021740570.1|35056_38074_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_000077919.1|38337_39546_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
WP_001238268.1|39955_40156_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_086252943.1|40170_40467_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_069067271.1|40801_41062_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	6.8e-44
WP_000209223.1|41064_41499_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_080028524.1|41535_48372_-	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	99.2	0.0e+00
WP_001273800.1|48522_49008_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_047648389.1|49040_49238_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	93.8	5.0e-31
WP_080028525.1|49237_49945_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	98.7	1.4e-128
WP_000245715.1|49944_50169_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_080028492.1|50582_51545_-	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.4	8.2e-175
WP_080028493.1|51745_52744_-|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.8	7.9e-181
WP_052154682.1|52757_53990_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	99.8	2.8e-236
WP_080028494.1|54504_55890_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	9.1e-236
WP_080028495.1|55996_57205_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_060877123.1|57321_57696_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_080028496.1|57695_59633_-|head	head protein	head	A0A222YWA3	Escherichia_phage	97.7	0.0e+00
WP_080028497.1|59625_60246_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	96.1	1.6e-75
WP_080028498.1|60235_60682_-|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	99.3	2.7e-80
WP_000457140.1|60681_61008_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_001340317.1|61873_62107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001436272.1|65096_65246_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	95.9	5.1e-20
WP_080028500.1|65634_66480_-|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	95.0	5.3e-154
WP_080028501.1|66490_67921_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	93.1	1.2e-254
WP_032220997.1|67917_68292_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	96.8	2.5e-63
WP_047647212.1|72557_73379_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	2.9e-157
WP_001077897.1|73767_74523_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|74904_75612_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187854.1|75627_76179_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_080028502.1|76233_76725_-|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	98.8	3.0e-88
WP_080028503.1|76733_77252_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	77.3	3.8e-70
WP_080028504.1|77378_78113_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.6	1.7e-124
WP_080028505.1|78156_79815_-|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	97.1	8.8e-302
WP_047647205.1|79882_80161_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	95.7	1.1e-39
WP_080028506.1|80308_82006_-|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	99.1	0.0e+00
WP_080028507.1|82164_82569_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	98.5	2.6e-66
WP_080028508.1|82604_83603_-	ORF6N domain-containing protein	NA	A0A222YWG0	Escherichia_phage	91.9	1.4e-116
WP_023908691.1|83602_83818_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	78.3	3.2e-23
WP_080028509.1|84345_84804_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.7	2.7e-67
WP_080028510.1|84874_85681_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	99.3	8.5e-117
WP_001272821.1|85680_85965_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_080028511.1|86231_87188_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.2e-180
WP_000076909.1|87200_87539_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_000585022.1|87826_88468_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
WP_000595051.1|88460_88748_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_001287146.1|89016_90678_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.6	0.0e+00
WP_080028512.1|90726_91632_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	99.7	2.2e-174
WP_000812238.1|91624_92305_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_080028513.1|92288_93194_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	2.3e-163
WP_000828872.1|93253_93907_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	98.2	1.1e-101
WP_000046500.1|93903_94884_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000203293.1|94887_95655_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000532307.1|95651_96443_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.9	7.5e-150
WP_000162415.1|96605_96908_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|96978_97317_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_080028514.1|97373_97574_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	6.2e-29
WP_080028515.1|97595_98324_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	57.1	3.7e-71
WP_001112629.1|98357_99551_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	99.5	5.7e-202
WP_000542383.1|99543_99873_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_023908597.1|100201_100855_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	98.6	1.9e-114
WP_080028516.1|101123_102035_+	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	96.6	1.6e-164
WP_000201621.1|102074_102425_-	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_022630902.1|102571_102856_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	100.0	1.4e-45
WP_080028517.1|102915_103857_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	89.8	1.2e-157
WP_052936000.1|104883_105462_-	recombinase	NA	A0A222YXV2	Escherichia_phage	97.9	4.4e-75
WP_080028526.1|105749_106346_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	97.0	5.5e-105
WP_052936027.1|106375_106660_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	1.8e-42
WP_080028518.1|106649_107351_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	94.1	1.2e-111
WP_080028519.1|107350_107671_+	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	86.8	2.2e-44
WP_080028520.1|107762_108050_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	94.4	5.1e-40
WP_000139733.1|108046_108271_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	100.0	9.1e-37
WP_073714439.1|108267_108579_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	96.1	1.7e-57
WP_073714440.1|108575_109268_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	95.2	2.0e-130
WP_080028521.1|109365_110361_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	98.8	1.3e-196
WP_069067277.1|110377_111067_+	hypothetical protein	NA	Q71T76	Escherichia_phage	70.0	4.1e-88
WP_080028522.1|111053_111740_+	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	61.5	2.8e-44
WP_069067276.1|111736_112450_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	57.9	1.3e-57
WP_000797282.1|112622_112811_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000951710.1|112812_113022_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_074446721.1|113018_113720_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	90.3	1.5e-56
WP_001142396.1|113703_113988_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_001344848.1|113972_114182_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_032220968.1|114355_114607_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	96.4	2.3e-36
WP_069067275.1|114705_115095_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	96.1	2.7e-68
WP_001190712.1|115167_115389_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_069067274.1|115388_115769_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	90.3	1.3e-56
WP_000432092.1|115852_116653_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	96.5	8.1e-136
WP_069067273.1|116659_117322_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	80.1	5.5e-98
WP_000640903.1|117336_117831_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
WP_000861173.1|117827_118304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000349257.1|118300_118609_-	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_080028523.1|118718_119747_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	1.1e-57
WP_000888609.1|120939_121179_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_000897063.1|121206_122715_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_031325887.1|122714_123695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|124075_124468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|124576_124762_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|124968_125160_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
129343:132579	attR	TGGGGTTCTAGGGATTTTCCGTCCAAAAACGACAAAGTGCTCTGGAGGCCGCGCCGTCCGTGGCCTCCAGAGGGGTATTACTTTTCGCTGACGGGTAAATATCCCTCGATTGAGCGCATAAGCTCCTCCAGATCTGGCAATTTTTCGCTCAATTCGAAGTGGTAAGTCCCCTTGAGGTTAATGTTGTGCCAGGCCACAGGGGATGCCTGTTTGACGATATCTATTCTCTTGGTATCTCCTTGGTATTCGAAGCTGGTCAACAGCTGGCTGAGTATCCTGGAGTTGAAGTAAACGATGGCATTGGTGACCAGGCGAGCGCACTCATTCCATAGCTGGATTTCTTCGTCTGAACTGCCCCGGAACTGATCCCCATTGACGCTGCTCACGGCCCGACGCAGTTGGTGATAGGCCTCTCCCCGGTTCAGCGCGCGCTGAACATAGTTTCTTAAACTGGCATCATCGATGTAGCACAGTAGATAATTCGCTTTCACCAGGCGATTGTATTCCGTCAGGGCTTCCAGCAGCGGGTGATTGCGCTTGTACTCCGAGAGCTTTCTCACCAAGGTGGCTTGCGTTGTTTTCCGCTGCTTAAGTGATACTGCAATCCGTTGGATGGTATCCCAGTGCTGCGCAATACGATGGGTATTGATTGGCTTTTTTAAGCACAGCTGAATTCGGTGTTCTTTGTCTTCCTTGACATCAAACATGTCATTGATCACTTTGCCAACCTGGGCATAGCGTGGGGCAAACTGGTATCCGAACAGATCCAGTAACGCGAAGTTCACATGGTTCACCCCATGGGTATCGGTTGAGAGCACATCCGGAATGATGTCTGACGTATTGCTCATCAACAAATCAAAGATGTAGTGCGATTCATGTTCGTTGGCGCCGATCACTCTGGCGTTGATCGCAGCGTGATTGGCGATCAAGGTCATGGCAGAAACACCTTTTTGAGTGCCAAAGTACTTCGACGAATAACGGGTTTTGAAGGTCTCGCGCCGGGCTTCGAACTTTTGACCATCGGCACTGGCGTGGATCACATCTTCCTGGATGTTGTAGTACCGGAAGATGGGTAGCTTGGCTGTCGCGTTATTGATGTTGTCGTTAGCAGCATTCAATGTTTCCAGGCGAAGATAGTTCGCCTGGATAGTGCTGAGCTGATCATAGGTACGATCAGAGATCTGTGCCATGCCGTAAATGCCTTGATTGGTTGCATTGCCGACCAGAATTGCCAACAGGTCATATTCATGGGAACGGCTTCTGGATTGGGAACCCAGCACATGAGCGAAGCAGTCAATGAAACCGGTGTCACGATCAACCATGCGCAGTACATCCGCAATCCCCGTTGTGGGAATTTGCTGGAAGAAGGGATTGTTGACCAGATGATGTTTGCTGGCCGAAGGCAGGCGCCAGAAGCGTTTACCCTGCGGATTACGCAAGATGATATTCCGGTTGTCTTCCTGTTCAAGATATTCGCCGACTTCGTACAAACGGGTATCCAATTCCATGGCCATCTGTTTGATCAGCTTTTCAGGCTCCTCCGCTAATTTTGTAAAATGGCTCTGTTGAAGCAGCGTATATTTGTTTTTTCGCCAATGTTCCCCGTCGATCAGGTCGGCGTCGAGTGCCCGGTATTTAGTGATATCAGGCAGCGTCAGCTGGCCATTCAGGCGATCAGGAATCTGTTGATAGAGGAACCACTCATAACGATCGATCAGGATATTCCCTTCACCATCCAGCAGGAATTCACGTGATTTTTTGGAAAGGAGTCTGGTGTCGGCAGTTTGCAACTGAGCGTCCTGGCCGTTGAGTTCGTTTTGTGTTTTCGCCAAGGCGGCCGCTAAGTGCTGGGTGCCGTCGCAGCCTTCGAAGCGCAGACATAGGAACAACTCTCGCAGCAAACCTTTCCGCAGACTTTCTTTCTCGTCGCAGTACTGCCACATGGCTTCATCGACCGATCGTCGCTGCTCGTTCAGGAAGAGACATACAGATTCCAGATCCCTTTTGGTCAGCAGGCTCAGTGCTTGCTGTCTTACTGTTGCAAACGGTAGTTGCAGATCAATGCTGTCATCAATGAACAGGTGCAGTACTTCAGCTGCCTTGCTGACATTTTTAGCTGCTTTTTGCCAATCCTTAAACACCGCTTCCTGCGCATAATCCTTTGCCTTCTGTTTGGTCTGTCTGACATGATGCACAAAGCCATCGGCAATACGTTCCAGCGCTTGCTGCCATCGCGTTTGAAGATAGCACAATAAATACAGCCATTGGCTGCCTACGGTTTGACGTTTCAGTTTGGCACCGTAGTAGTCGACTTTCTCTGCCAGGTGTTGCAGATTTTTCTGCGACAGTGATAGCGTGCTCAACAGCAGATCCACTTCCGGCATCCAATGCTGGATATGGCGATAGACAATCAGTTCTTTCTCCAACTCGGTTCCGGTGAAGTTACGAGCCGATTGTCGCAACTGTCGGAACGGCAGTGGACCTGTGCCGTTCACGAGCTCCGCCAGTGCTTGCTTAAGACCGCGTGACATTGCACGCTCAAGGTGCGCGGCCATGTGTTCCTGTTCGTCTCCCACCACCTGACTGATGATCTTTTGCAGCGTGCTGTAGGCAGGGATTGCGATCTTCTGCCCCGAACAATATTCAATGGCCGCATCGAAGAGGTGCCTAGGCGCTGTCCAGGCTCTGGCTTGCTGGGATAAGTAATCTCTCAACGCCGCTCCATGGTCTTTGACATTCCAGCGCTGGTAGTTGCAGAGCTGGAAAACACGTTGGTAAATCCGTTCGTTCTCTTTTGGCGTGAGATTAAAGGGTCTACAGCCTGGGCCTGGTAGAACGGTTTGATAAACGTATTTGAGGTCCTGCTTGATCTGATGAAAGCCGGGATTCAGCACCACCGGCTTGGCTTTGAAATAGCCCAGCAGTACCACCAGCATGTAACGCTGGCCCCGATGACGGAGGCTTTTAGCGATCGCCAGTTCCTTATCGTTCAGCGAGAAAAAGAAGCGTTGGTCGGCGGAGGTGAAAGCGGGGGGTCCATATAACTCATCTTGTTCTGCCTCGGACAAGATTTGGACACGTTCTTCGAATGCCATGGATTTAGCCCAAAAAGACTAAATCTTACTCAAACAGAGCCCAAATAGGGATCTCGAAAAAAGTAATACCCCTCTGGAGGCCACAGACGGCGGGGCCTCCAGAGCACTTTGTCGTTTTTGGACGGAAAATCCCTAGAACCCC	NA	NA	NA	NA
>prophage 2
NZ_CP021720	Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence	216378	168927	207073	216378	transposase,integrase	Stx2-converting_phage(26.32%)	46	173738:173754	195246:195262
WP_015632444.1|168927_170517_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_032495749.1|170557_170896_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.8	7.6e-27
WP_015632445.1|170892_171300_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_016162081.1|171375_171633_+	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
WP_016162080.1|171644_171896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|171936_173865_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
173738:173754	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
WP_016162079.1|173867_174179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|174574_174907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|175176_175497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162076.1|175549_175783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632450.1|176472_176910_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015632451.1|177079_177940_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_032441934.1|178013_178193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|178336_178696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632453.1|179289_179727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|179854_180343_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016162074.1|180339_180588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632456.1|180950_181379_-	partitioning protein	NA	NA	NA	NA	NA
WP_015632457.1|181371_182352_-	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632458.1|182712_182895_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632459.1|182920_183364_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_016162072.1|183705_183933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|184362_184620_+	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_015632462.1|184823_185390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632463.1|185431_185776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632464.1|185920_186226_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632465.1|186225_186444_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632466.1|186629_187655_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015632467.1|188598_189030_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_016162068.1|189029_190301_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_004098982.1|190712_191588_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|192220_192847_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|192966_193146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|193617_194412_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_016162067.1|194609_195614_-	hypothetical protein	NA	NA	NA	NA	NA
195246:195262	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
WP_024191724.1|195678_195990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|196038_196353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162066.1|196908_197478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|197618_198647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568022.1|198791_201596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632381.1|201755_202154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839879.1|202180_203773_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_004189161.1|203803_204154_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_015632382.1|204150_204591_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_001531258.1|205271_206054_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|206050_207073_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
