The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	839676	847316	5420545		Bacillus_virus(50.0%)	8	NA	NA
WP_000959447.1|839676_840036_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.5	1.9e-36
WP_001215839.1|840022_842107_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	73.5	4.2e-301
WP_000274263.1|843029_843803_+	nuclease	NA	A0A2P0PAD9	Pectobacterium_phage	37.9	2.7e-11
WP_000864958.1|843926_844328_+	ribonucleoside-diphosphate reductase	NA	G3MBF3	Bacillus_virus	68.7	5.4e-48
WP_000687512.1|844544_844925_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137747.1|844921_845620_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.2e-20
WP_000843921.1|845616_846399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048568825.1|846413_847316_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.1	2.2e-36
>prophage 2
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	1358920	1367038	5420545		Bacillus_phage(66.67%)	7	NA	NA
WP_087875217.1|1358920_1360168_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.7	2.2e-10
WP_001194306.1|1360267_1361032_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087875218.1|1361272_1363033_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	97.7	1.6e-272
WP_048568907.1|1363118_1363796_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	3.3e-122
WP_001231621.1|1363792_1364866_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_153043824.1|1365155_1365875_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_087875220.1|1366165_1367038_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	6.2e-65
>prophage 3
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	1524616	1554176	5420545	terminase,tail,portal,integrase,head	Bacillus_phage(25.0%)	39	1518883:1518898	1560085:1560100
1518883:1518898	attL	ATTAAATACAACTTCA	NA	NA	NA	NA
WP_087875259.1|1524616_1525753_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	41.5	2.3e-67
WP_087875260.1|1525772_1526291_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.1	9.9e-26
WP_087875261.1|1526805_1527885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875262.1|1527865_1528411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875263.1|1528441_1529662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875264.1|1529841_1530177_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	45.5	7.3e-14
WP_087875265.1|1530339_1530531_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087875266.1|1530571_1530871_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	34.9	1.4e-08
WP_087875267.1|1530938_1531454_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	23.4	2.6e-10
WP_087875268.1|1531484_1531706_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_048563603.1|1531887_1532172_+	hypothetical protein	NA	D2XR42	Bacillus_phage	55.3	1.6e-25
WP_087875269.1|1532289_1533267_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	45.0	1.8e-52
WP_087875270.1|1533484_1533847_+	cell division protein SepF	NA	D2XR47	Bacillus_phage	68.3	9.9e-41
WP_087875271.1|1533938_1534139_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	65.2	3.8e-18
WP_087875272.1|1534135_1534744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875273.1|1534838_1535342_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	64.8	1.2e-55
WP_087875274.1|1535509_1537441_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_087876130.1|1537589_1538636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875275.1|1538671_1539313_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_087875276.1|1539432_1539792_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_087876131.1|1540361_1540817_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_153043752.1|1541151_1541559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875278.1|1541745_1542654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875279.1|1542745_1542925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875280.1|1542946_1543774_+|terminase	terminase	terminase	A0A1L2JY44	Aeribacillus_phage	38.1	9.9e-36
WP_087875281.1|1543766_1545044_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	64.7	7.3e-155
WP_087875282.1|1545113_1546592_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_087875283.1|1546705_1547224_+|head	phage head morphogenesis protein	head	Q1WDG7	Streptomyces_phage	34.4	1.4e-08
WP_087875284.1|1547337_1548540_+	hypothetical protein	NA	A0A1B1IMM2	Lactococcus_phage	33.5	3.4e-37
WP_044795829.1|1548557_1549544_+	XkdG	NA	H7BVA6	unidentified_phage	43.9	6.6e-71
WP_000869888.1|1549714_1549879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875285.1|1549878_1550415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875286.1|1550411_1550783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024034.1|1550789_1551200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875287.1|1551203_1551626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875288.1|1551638_1552241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875289.1|1552300_1552819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875290.1|1552782_1553205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875291.1|1553237_1554176_+|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	65.8	9.1e-70
1560085:1560100	attR	ATTAAATACAACTTCA	NA	NA	NA	NA
>prophage 4
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	2042451	2049108	5420545		Bacillus_phage(33.33%)	9	NA	NA
WP_001139345.1|2042451_2042667_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_087875411.1|2043398_2044199_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	6.0e-38
WP_002061468.1|2044218_2044431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061469.1|2044495_2044696_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_087875412.1|2044833_2045715_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000372690.1|2045842_2046352_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	36.0	1.4e-16
WP_087875413.1|2046469_2047009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163828.1|2047021_2047696_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
WP_087875414.1|2047692_2049108_+	HAMP domain-containing histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	23.5	6.3e-06
>prophage 5
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	3061035	3071622	5420545	bacteriocin	uncultured_Caudovirales_phage(45.45%)	14	NA	NA
WP_000413738.1|3061035_3061656_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976240.1|3061748_3062552_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031383.1|3062552_3063095_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102627.1|3063087_3063411_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_030027264.1|3063783_3064014_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	80.3	1.1e-26
WP_030027266.1|3064187_3065183_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KCJ1	Bacillus_phage	47.5	1.5e-78
WP_030027267.1|3065251_3066073_-	M23 family metallopeptidase	NA	A0A2H4J669	uncultured_Caudovirales_phage	33.9	7.8e-09
WP_030027273.1|3066320_3067289_-	lysozyme family protein	NA	A0A1W6JSC2	Bacillus_phage	45.5	1.5e-30
WP_087875653.1|3067527_3067914_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	69.8	6.4e-46
WP_087875654.1|3068323_3069226_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	67.8	9.2e-96
WP_001189064.1|3069378_3069573_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_048567458.1|3069584_3070343_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.8	5.4e-97
WP_000283431.1|3070545_3070758_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_033683142.1|3070962_3071622_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 6
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	3621978	3679219	5420545	terminase,tail,portal,protease,holin,integrase,tRNA,head,capsid	Bacillus_phage(85.45%)	68	3615763:3615783	3671032:3671052
3615763:3615783	attL	ACGCTGTTGCTGTCCACCAGA	NA	NA	NA	NA
WP_087875729.1|3621978_3622806_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	70.6	1.6e-102
WP_087875730.1|3622815_3623436_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_087875731.1|3623377_3624559_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.9	2.6e-215
WP_087875732.1|3624674_3624857_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	86.7	2.0e-21
WP_087875733.1|3624853_3625171_-	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	3.2e-51
WP_030024438.1|3625361_3625559_+	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	56.9	4.4e-11
WP_087875734.1|3625598_3626183_+	hypothetical protein	NA	A0A288WFT6	Bacillus_phage	75.9	9.9e-83
WP_087875735.1|3627039_3627741_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	88.1	6.7e-118
WP_000373914.1|3627740_3628166_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	9.1e-70
WP_087875736.1|3628241_3628466_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	94.6	9.1e-29
WP_087875737.1|3628591_3632623_-	hypothetical protein	NA	H0USX5	Bacillus_phage	88.4	0.0e+00
WP_087875738.1|3632619_3634104_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	98.8	6.0e-294
WP_087875739.1|3634115_3637964_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	87.1	0.0e+00
WP_000779040.1|3638184_3638502_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	99.0	5.8e-53
WP_000896770.1|3638549_3639158_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	100.0	5.8e-102
WP_087875740.1|3639158_3639518_-	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	95.8	1.6e-59
WP_000763219.1|3639514_3639949_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_016098402.1|3639941_3640265_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	97.2	2.2e-55
WP_016077615.1|3640251_3640539_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	98.9	6.8e-45
WP_087875741.1|3640559_3641732_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	95.1	7.8e-204
WP_087875742.1|3641795_3642479_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.0	2.0e-119
WP_087875743.1|3642465_3643719_-|portal	phage portal protein	portal	H0USW4	Bacillus_phage	97.4	1.5e-237
WP_087875744.1|3643907_3645602_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_087875745.1|3645603_3646107_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	98.2	2.6e-87
WP_001139463.1|3646236_3646614_-	HNH endonuclease	NA	H0USW1	Bacillus_phage	96.0	3.8e-67
WP_087875746.1|3646603_3646858_-	hypothetical protein	NA	W8CYT4	Bacillus_phage	92.9	1.7e-39
WP_000773601.1|3646992_3647205_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_087875747.1|3647221_3647461_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	92.4	3.1e-19
WP_087875748.1|3647450_3647675_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.5	5.5e-26
WP_087875749.1|3647720_3647948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|3647984_3648272_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_087875750.1|3648674_3648920_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	96.3	1.7e-36
WP_001012128.1|3649126_3649669_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	99.4	3.3e-96
WP_087875751.1|3649665_3650151_-	ArpU family transcriptional regulator	NA	W8CYU4	Bacillus_phage	99.4	8.8e-85
WP_000965619.1|3650508_3650790_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_087875752.1|3652198_3652597_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	98.5	1.1e-69
WP_001099196.1|3652949_3653249_-	hypothetical protein	NA	W8CZ51	Bacillus_phage	85.9	7.9e-44
WP_087875754.1|3653398_3653698_+	lactate permease	NA	W8CYG6	Bacillus_phage	98.0	4.8e-49
WP_001025406.1|3653694_3653910_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|3653927_3654092_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_087875755.1|3654163_3654430_-	hypothetical protein	NA	W8CYZ5	Bacillus_phage	96.6	9.5e-41
WP_087875756.1|3654471_3655284_-	DNA replication protein	NA	W8CZ50	Bacillus_phage	98.1	4.8e-152
WP_087875757.1|3655246_3656251_-	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	96.2	6.5e-183
WP_087875758.1|3656494_3657142_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	95.3	5.0e-112
WP_087875759.1|3657417_3657732_-	hypothetical protein	NA	H0USU0	Bacillus_phage	96.1	1.1e-48
WP_087875760.1|3657893_3658718_-	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	77.0	7.3e-116
WP_000277643.1|3658927_3659116_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000368216.1|3659260_3659506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875761.1|3659753_3660083_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	99.1	6.6e-52
WP_087875762.1|3660503_3661757_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.4	2.9e-212
WP_087876158.1|3661898_3662129_-	hypothetical protein	NA	H0UST5	Bacillus_phage	94.7	9.7e-34
WP_087875763.1|3663234_3664296_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	82.2	4.9e-165
WP_000871386.1|3664357_3665635_-	MFS transporter	NA	NA	NA	NA	NA
WP_001052031.1|3665751_3666363_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	62.2	4.5e-70
WP_000021899.1|3666899_3667658_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_000825416.1|3667731_3668097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875764.1|3668252_3669365_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001054516.1|3669444_3669858_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000613815.1|3669871_3670705_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001059662.1|3670704_3671475_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.9	1.5e-14
3671032:3671052	attR	ACGCTGTTGCTGTCCACCAGA	NA	NA	NA	NA
WP_000435963.1|3671655_3672534_-	YitT family protein	NA	NA	NA	NA	NA
WP_001048954.1|3672683_3672938_+	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_087875765.1|3672957_3673854_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.7	4.7e-23
WP_000194015.1|3674086_3675397_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.3	4.0e-47
WP_000484170.1|3675578_3676313_+	VrrA protein	NA	NA	NA	NA	NA
WP_000706659.1|3676402_3677353_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_000036233.1|3677393_3678515_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	50.0	7.1e-21
WP_001006545.1|3678511_3679219_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	3898817	3906502	5420545		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221066.1|3898817_3899741_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_049107067.1|3899866_3900802_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-21
WP_000018029.1|3900803_3901496_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014310.1|3901838_3902033_+	YwbE family protein	NA	NA	NA	NA	NA
WP_087875794.1|3902071_3903271_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	3.6e-71
WP_000587818.1|3903565_3903889_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086123.1|3903961_3904726_-	class B sortase	NA	NA	NA	NA	NA
WP_044306745.1|3904758_3905529_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	7.6e-14
WP_001036848.1|3905518_3906502_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
>prophage 8
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	4237657	4320063	5420545	terminase,tail,portal,protease,holin,integrase,tRNA,capsid,head,plate,coat	Bacillus_phage(69.09%)	93	4271390:4271407	4313366:4313383
WP_087875861.1|4237657_4239034_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	7.6e-49
WP_001140612.1|4239073_4239457_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_048568248.1|4239552_4240296_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252163.1|4240346_4240940_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4240985_4241873_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_030029055.1|4241980_4243705_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_000545253.1|4243848_4244454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487944.1|4244628_4246113_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|4246272_4246899_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|4246985_4247303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415320.1|4247299_4247806_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4247930_4249139_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|4249600_4250590_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_087875862.1|4250702_4261268_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000902159.1|4261738_4262218_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391938.1|4262383_4263631_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535260.1|4263648_4264530_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|4264609_4265071_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_087875863.1|4265393_4266224_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.6	1.5e-100
WP_087875864.1|4266233_4266854_-	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	3.7e-112
WP_087875865.1|4266795_4267977_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	97.7	1.2e-220
WP_087875866.1|4268092_4268275_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.3e-22
WP_087875867.1|4268271_4268589_-	hypothetical protein	NA	H0USY0	Bacillus_phage	99.0	1.3e-52
WP_087875868.1|4268771_4268969_+	helix-turn-helix domain-containing protein	NA	A0A288WG74	Bacillus_phage	79.7	4.0e-20
WP_087875869.1|4268977_4269157_+	hypothetical protein	NA	A0A288WFV9	Bacillus_phage	63.3	1.9e-08
WP_087875870.1|4269162_4269741_+	hypothetical protein	NA	H0USX9	Bacillus_phage	90.6	1.7e-98
WP_021728237.1|4269794_4270127_+	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	72.7	4.1e-33
WP_087875871.1|4270672_4271374_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	91.1	1.8e-123
WP_087875872.1|4271373_4271799_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	95.7	3.5e-69
4271390:4271407	attL	TTTTTCTCTTCTTGTTTT	NA	NA	NA	NA
WP_000390482.1|4271874_4272099_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_087875873.1|4272249_4273431_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	71.1	5.3e-152
WP_087875874.1|4273445_4275788_-	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	94.1	0.0e+00
WP_087875875.1|4275784_4276468_-|tail	phage tail protein	tail	A0A1B1P7Q0	Bacillus_phage	97.8	4.5e-127
WP_087875876.1|4276469_4279991_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	92.3	0.0e+00
WP_006927278.1|4280007_4280196_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_087875877.1|4280234_4280621_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	98.4	2.8e-65
WP_087875878.1|4280632_4281268_-|tail	phage tail protein	tail	A0A1C8E980	Bacillus_phage	98.1	1.1e-114
WP_087875879.1|4281279_4281657_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	98.4	3.3e-63
WP_001166633.1|4281656_4281986_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126095.1|4281975_4282308_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	95.5	4.6e-53
WP_087875880.1|4282285_4282546_-	hypothetical protein	NA	A0A1B2APX3	Phage_Wrath	97.7	6.4e-42
WP_087875881.1|4282547_4283852_-|capsid	phage major capsid protein	capsid	A0A1B0T682	Bacillus_phage	93.5	2.1e-189
WP_000687902.1|4283853_4284435_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	95.9	5.4e-97
WP_000603760.1|4284505_4284763_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_087875882.1|4284931_4286104_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	98.7	5.0e-219
WP_087875883.1|4286119_4287844_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.4	0.0e+00
WP_153043784.1|4287840_4288266_-|terminase	terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	95.7	3.1e-70
WP_087875884.1|4288349_4288742_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	97.7	3.3e-74
WP_087875885.1|4288738_4289053_-	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	91.3	2.8e-47
WP_087875886.1|4289049_4289268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875887.1|4289314_4289512_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	87.7	1.6e-24
WP_157686418.1|4289516_4289663_-	hypothetical protein	NA	A0A288WG60	Bacillus_phage	77.8	4.0e-17
WP_087875888.1|4289795_4289987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875889.1|4290161_4290569_-	hypothetical protein	NA	Q2I8C1	Bacillus_phage	64.4	1.1e-45
WP_087875890.1|4290597_4290792_-	glyoxalase	NA	NA	NA	NA	NA
WP_087875891.1|4290788_4290911_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847112.1|4291054_4291240_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	51.6	5.1e-09
WP_087875892.1|4291275_4291674_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	96.2	6.8e-67
WP_087875893.1|4291758_4292505_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	2.8e-98
WP_087875894.1|4292497_4292725_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	70.7	2.4e-24
WP_087875895.1|4292724_4293606_-	DNA replication protein	NA	A0A0S2SXI8	Bacillus_phage	33.6	5.2e-27
WP_087875896.1|4293617_4294391_-	replication protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.8	2.2e-53
WP_087875897.1|4294524_4295406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021727909.1|4295429_4296104_-	antirepressor	NA	A0A288WFT2	Bacillus_phage	67.0	4.6e-84
WP_021727908.1|4296313_4296502_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.0e-21
WP_060851577.1|4296681_4296888_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021727905.1|4297045_4297387_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	33.3	1.0e-10
WP_080346158.1|4297799_4298966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087875898.1|4300296_4301358_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.0	1.8e-170
WP_000833142.1|4301446_4301800_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.5	9.1e-15
WP_087875899.1|4302423_4303194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573825.1|4303607_4303961_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|4304002_4304869_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4305137_4305377_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|4305723_4306794_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|4307027_4307201_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470265.1|4307256_4307916_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_000679260.1|4307899_4308697_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|4308896_4309238_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_048568467.1|4309397_4309679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113710572.1|4309748_4310546_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_087875901.1|4310913_4311246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087875902.1|4311296_4311965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141536902.1|4312088_4312883_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4312935_4313244_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4313439_4313676_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
4313366:4313383	attR	AAAACAAGAAGAGAAAAA	NA	NA	NA	NA
WP_001125494.1|4313994_4314210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|4314271_4315273_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665094.1|4315393_4315885_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_016110886.1|4315908_4316388_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087875904.1|4316550_4317654_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_087875905.1|4317598_4318945_+	adenine/guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000241504.1|4318950_4320063_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	5109790	5117738	5420545		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|5109790_5110075_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|5110113_5111748_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|5112154_5113693_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|5114078_5115404_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929887.1|5115547_5116249_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	7.3e-40
WP_087876039.1|5116232_5117738_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	2.3e-30
>prophage 10
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	5156224	5164600	5420545		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|5156224_5157532_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_087876047.1|5157620_5158340_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	44.8	5.2e-49
WP_000278823.1|5158332_5158587_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|5158583_5159267_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|5159250_5161470_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|5161454_5162870_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|5162975_5164016_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|5164012_5164600_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 11
NZ_CP019230	Bacillus thuringiensis strain YGd22-03, complete genome	5420545	5326082	5372808	5420545	terminase,tail,portal,protease,integrase,transposase,tRNA,capsid,head	Bacillus_phage(82.22%)	58	5354843:5354859	5374641:5374657
WP_016111332.1|5326082_5327462_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.5	7.8e-86
WP_087876075.1|5327522_5328647_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	86.4	5.2e-189
WP_087876076.1|5330313_5330667_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	45.5	7.7e-22
WP_086412643.1|5331183_5332311_+	hypothetical protein	NA	H0UST6	Bacillus_phage	52.4	2.4e-109
WP_003276353.1|5332602_5332785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876077.1|5332795_5333143_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	39.4	1.3e-10
WP_087876078.1|5333539_5334265_+	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	81.1	8.2e-111
WP_087876079.1|5334307_5334658_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	91.4	4.7e-56
WP_157686419.1|5334654_5334822_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	68.5	4.7e-14
WP_087876081.1|5335032_5335773_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	93.9	1.1e-99
WP_001148230.1|5335720_5336584_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	94.9	3.1e-133
WP_087876082.1|5336586_5336781_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	6.5e-23
WP_000805174.1|5336806_5336980_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
WP_087876083.1|5336994_5337249_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	1.4e-38
WP_087876084.1|5337260_5337680_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	44.2	4.8e-15
WP_087876177.1|5337695_5338151_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	1.4e-20
WP_087876085.1|5338189_5338516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876178.1|5338660_5339029_+	spore protein H	NA	NA	NA	NA	NA
WP_087876086.1|5339048_5339435_+	hypothetical protein	NA	A0A0A7AR60	Bacillus_phage	89.8	1.6e-60
WP_087876087.1|5339662_5340067_+	hypothetical protein	NA	W8EIC5	Pseudomonas_phage	44.9	3.3e-21
WP_087876088.1|5340099_5340360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876089.1|5340404_5340599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876090.1|5340635_5340863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876091.1|5340982_5341339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876092.1|5341376_5341613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645587.1|5341630_5341753_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_061684776.1|5342062_5342536_+	ArpU family transcriptional regulator	NA	A0A1B1P7X5	Bacillus_phage	98.1	1.7e-80
WP_001055140.1|5342532_5343075_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	99.4	7.2e-96
WP_087876093.1|5344129_5345341_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	36.7	3.4e-69
WP_087876094.1|5345602_5345785_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	75.0	2.5e-16
WP_087876095.1|5345816_5346083_+	hypothetical protein	NA	H0USV8	Bacillus_phage	53.8	4.7e-16
WP_046945213.1|5346154_5346466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087876096.1|5346495_5346768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046945231.1|5346913_5347129_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	97.2	9.0e-34
WP_000357490.1|5347290_5347671_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	97.6	2.7e-65
WP_087876097.1|5347651_5349424_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	98.1	0.0e+00
WP_087876098.1|5349439_5350654_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	97.0	3.8e-230
WP_087876099.1|5350631_5351387_+|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	97.2	1.3e-135
WP_087876100.1|5351383_5352571_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	95.4	1.1e-208
WP_142284543.1|5352545_5352848_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_000891191.1|5352856_5353132_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	98.9	8.0e-43
WP_153043810.1|5353118_5353466_+|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	97.4	1.4e-60
WP_087876102.1|5353453_5353891_+	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	95.9	9.7e-75
WP_086400934.1|5353887_5354247_+	structural protein	NA	A0A1B1P7S7	Bacillus_phage	97.5	7.7e-62
WP_087876103.1|5354259_5354847_+|tail	phage tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	81.7	4.9e-82
5354843:5354859	attL	AATAAAATTATAAAAAG	NA	NA	NA	NA
WP_153043811.1|5354906_5355302_+	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	89.3	4.5e-55
WP_087876104.1|5355319_5355460_+	LysR family transcriptional regulator	NA	A0A1B1P7R9	Bacillus_phage	91.3	3.2e-16
WP_087876105.1|5355475_5360491_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	86.9	0.0e+00
WP_087876106.1|5360529_5361987_+|tail	phage tail protein	tail	A0A2H4JH21	uncultured_Caudovirales_phage	55.7	3.4e-156
WP_087876107.1|5361983_5366462_+	hypothetical protein	NA	A0A2H4JF18	uncultured_Caudovirales_phage	53.3	0.0e+00
WP_087876108.1|5366479_5366815_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	49.1	1.6e-21
WP_087876109.1|5366933_5367623_+	hypothetical protein	NA	D2XR29	Bacillus_phage	83.8	1.3e-102
WP_087874946.1|5367996_5369156_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_153043812.1|5369280_5370240_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.2	2.5e-176
WP_000151210.1|5370254_5370536_+	hypothetical protein	NA	D2XR31	Bacillus_phage	98.9	3.4e-41
WP_000159645.1|5370538_5370745_+	hypothetical protein	NA	D2XR32	Bacillus_phage	100.0	2.5e-33
WP_087876110.1|5370744_5371563_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.8	1.0e-149
WP_087876111.1|5372070_5372808_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
5374641:5374657	attR	CTTTTTATAATTTTATT	NA	NA	NA	NA
