The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	0	18174	4864149	transposase,integrase	Bacillus_phage(25.0%)	11	7659:7673	20964:20978
WP_039023221.1|615_2043_-	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_039023220.1|2117_4271_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_135128180.1|4286_4733_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_039023218.1|4723_5860_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_039023217.1|6005_7439_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
7659:7673	attL	ACAGGCGATATCAGC	NA	NA	NA	NA
WP_032082730.1|9176_9806_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024188874.1|10199_11090_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.3e-45
WP_072647907.1|11842_14533_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
WP_001252361.1|14984_16838_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|16859_17441_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|17532_18174_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
20964:20978	attR	GCTGATATCGCCTGT	NA	NA	NA	NA
>prophage 2
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	22899	24252	4864149		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|22899_24252_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 3
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	38099	44203	4864149	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675144.1|38099_39503_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|39499_40222_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|40401_40734_+	YegP family protein	NA	NA	NA	NA	NA
WP_001551329.1|40881_42243_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.6	1.0e-215
WP_001303579.1|42572_42890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807371.1|43303_44203_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
>prophage 4
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	53346	56903	4864149		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|53346_54351_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_001551335.1|54347_55313_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|55286_56033_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001551336.1|56084_56903_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	2.3e-24
>prophage 5
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	67549	69583	4864149	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001551343.1|67549_69583_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.8e-54
>prophage 6
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	85286	94729	4864149		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|85286_86423_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|86419_88420_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|88544_89006_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|89047_89518_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|89564_90284_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|90280_91966_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|92187_92919_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|92978_93086_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|93066_93798_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|93802_94729_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 7
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	115050	116571	4864149		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|115050_116571_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 8
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	120265	120934	4864149		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|120265_120934_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 9
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	128106	128964	4864149		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|128106_128964_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 10
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	143458	147759	4864149		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091917.1|143458_144925_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198839.1|145042_146029_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001297918.1|146067_146781_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|147192_147759_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 11
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	153513	161162	4864149		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|153513_155103_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|155106_155451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|155783_156974_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|157001_157697_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|157846_159607_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|159731_160016_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|160154_161162_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 12
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	182243	188012	4864149		Bacillus_phage(25.0%)	5	NA	NA
WP_000422197.1|182243_183887_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884957.1|183962_184613_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786434.1|184612_185677_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.5	3.1e-18
WP_000406119.1|185750_186806_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865539.1|186917_188012_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
>prophage 13
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	192175	197018	4864149		Hokovirus(50.0%)	2	NA	NA
WP_000876029.1|192175_195025_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.5	8.4e-42
WP_000559127.1|195191_197018_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 14
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	211941	214569	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_001281225.1|211941_214569_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 15
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	220013	226160	4864149		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|220013_222299_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|222532_223663_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|223662_223917_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|223970_224621_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|225083_226160_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 16
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	232052	236563	4864149	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140472.1|232052_232952_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.9e-69
WP_000150333.1|232964_233150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|233190_233994_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|234011_235301_-	MFS transporter	NA	NA	NA	NA	NA
WP_024198364.1|235357_236563_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.6e-26
>prophage 17
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	240170	245174	4864149		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|240170_240773_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|241080_242220_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|242223_243192_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|243191_245174_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 18
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	284014	287242	4864149		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|284014_284614_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|284672_286505_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|286591_287242_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 19
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	297801	299662	4864149	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|297801_298692_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|298888_299662_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 20
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	303873	305391	4864149		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|303873_305391_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 21
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	311867	313004	4864149		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|311867_313004_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 22
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	321540	322626	4864149		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|321540_322626_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 23
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	341903	342836	4864149		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032330131.1|341903_342836_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.4e-166
>prophage 24
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	345876	347310	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|345876_347310_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 25
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	353951	361528	4864149		Hokovirus(50.0%)	4	NA	NA
WP_001307321.1|353951_357545_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|357600_358746_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|358819_359764_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|359833_361528_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 26
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	365219	366140	4864149		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|365219_366140_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 27
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	369957	370692	4864149		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|369957_370692_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 28
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	397578	410232	4864149		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|397578_399594_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|399664_400651_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|400880_401642_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|401826_402798_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|403181_403439_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|403483_405211_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|405251_405761_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|405803_406655_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|406759_407134_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|407166_407901_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|408089_409001_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|409134_410232_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 29
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	413249	414041	4864149		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|413249_414041_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 30
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	417519	422639	4864149		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|417519_418824_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|419063_419963_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|420058_420634_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|420694_421144_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|421130_421556_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102886.1|421769_422639_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 31
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	441293	442244	4864149		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|441293_442244_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 32
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	459532	460246	4864149		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|459532_460246_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 33
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	481498	485499	4864149		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|481498_482788_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|482873_483500_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|483823_484861_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|484860_485499_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 34
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	491934	498229	4864149		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|491934_492108_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|492421_492937_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|492952_493492_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|493584_495162_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|495230_496697_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937909.1|496858_498229_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	3.6e-43
>prophage 35
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	507059	507491	4864149		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|507059_507491_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 36
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	517701	524158	4864149		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|517701_518985_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|519162_519363_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|519374_519710_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196610.1|519711_521562_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.4	8.0e-102
WP_000384413.1|521578_522094_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|522189_522513_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|522529_522916_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|522943_524158_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 37
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	539385	540897	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493508.1|539385_540897_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	2.4e-11
>prophage 38
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	546789	558079	4864149		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|546789_548043_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|548370_549561_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|549605_549944_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|550004_551339_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|551328_552042_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001311037.1|552206_553634_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970102.1|554191_558079_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 39
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	562198	562459	4864149		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|562198_562459_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 40
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	565918	569660	4864149		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|565918_566599_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|566870_567845_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|567860_569660_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 41
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	575431	581690	4864149	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|575431_576766_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|576974_577856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|577958_578546_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|578601_578985_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|579289_579979_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|580026_581064_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|581270_581690_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 42
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	586983	588282	4864149		Burkholderia_virus(100.0%)	1	NA	NA
WP_001333897.1|586983_588282_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.2	3.7e-45
>prophage 43
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	594134	596708	4864149		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|594134_596708_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 44
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	602614	603685	4864149		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|602614_603685_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 45
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	617430	631943	4864149	transposase,integrase	Enterobacteria_phage(70.0%)	14	616526:616541	622255:622270
616526:616541	attL	CACCTTTTTTCTGTCT	NA	NA	NA	NA
WP_000162574.1|617430_617913_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_039023250.1|618678_619875_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	1.2e-103
WP_052249889.1|619946_621236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023248.1|621238_622279_+	hypothetical protein	NA	NA	NA	NA	NA
622255:622270	attR	AGACAGAAAAAAGGTG	NA	NA	NA	NA
WP_000446128.1|622534_623107_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	2.5e-94
WP_000638635.1|623180_623681_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283035.1|623677_624412_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_001016257.1|624906_625653_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|625667_627209_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001149160.1|627549_627816_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001244665.1|628403_628691_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_039023137.1|628683_629139_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_000856729.1|629274_629595_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_039023138.1|629609_631943_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
>prophage 46
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	637531	637750	4864149		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|637531_637750_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 47
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	647201	651253	4864149		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|647201_648482_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001333601.1|648719_650120_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|650140_650803_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|650803_651253_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 48
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	655189	660484	4864149		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|655189_655435_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|655431_655842_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|655814_657959_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|657968_658928_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|659281_660484_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 49
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	673434	678820	4864149	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|673434_673620_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|673854_676485_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|676612_677113_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|677181_678243_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|678322_678820_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 50
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	684286	685252	4864149		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|684286_685252_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 51
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	692727	693741	4864149		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|692727_693741_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 52
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	711566	724749	4864149		Escherichia_phage(50.0%)	12	NA	NA
WP_039023140.1|711566_714128_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|714233_714890_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|714940_715708_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847984.1|715903_716812_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590403.1|716808_718071_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|718067_718706_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|718710_719487_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|719575_720940_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|721033_722026_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|722088_723228_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|723367_723994_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|723987_724749_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 53
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	727861	729894	4864149		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|727861_728467_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|728466_729894_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 54
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	753901	754687	4864149		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021334.1|753901_754687_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.2e-20
>prophage 55
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	759099	764019	4864149		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|759099_759771_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|759909_760050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|760063_760936_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|760995_762294_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|762381_764019_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 56
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	768051	772166	4864149		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|768051_769353_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|769409_772166_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 57
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	779700	780549	4864149		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|779700_780549_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 58
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	785407	786163	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|785407_786163_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 59
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	797689	813237	4864149	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|797689_798895_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|798894_799338_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|799388_800195_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|800433_801531_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|802109_803363_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|803594_804926_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|804987_806814_-	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001285993.1|806813_810356_-	RecBCD enzyme subunit RecB	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|810348_813237_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 60
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	818713	825486	4864149		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|818713_819508_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|819514_820390_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|820540_822787_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|822799_823330_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|824014_824704_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|824772_825486_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 61
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	835116	837611	4864149		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|835116_836535_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|836849_837611_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 62
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	865578	868863	4864149	integrase	Streptococcus_phage(50.0%)	3	NA	NA
WP_000290523.1|865578_866211_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	37.8	2.2e-35
WP_000935232.1|866211_867801_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001375222.1|868107_868863_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.6	3.8e-10
>prophage 63
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	893322	908715	4864149	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|893322_894723_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|894740_896057_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|896092_897460_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|897495_897984_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|897983_899903_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|900338_901787_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|901788_901914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|901910_901982_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192820.1|902036_902585_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|902628_904146_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|904155_905254_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813200.1|905344_907078_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715214.1|907083_907794_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|907818_908715_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 64
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	912639	918013	4864149		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|912639_914073_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|914129_914873_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195062.1|915139_918013_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 65
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	926148	927381	4864149		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|926148_927381_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 66
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	955676	956831	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|955676_956831_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 67
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	979609	980875	4864149	integrase	Enterobacteria_phage(100.0%)	1	971229:971242	982003:982016
971229:971242	attL	TATAACCGTCAATA	NA	NA	NA	NA
WP_001218773.1|979609_980875_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
WP_001218773.1|979609_980875_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
982003:982016	attR	TATAACCGTCAATA	NA	NA	NA	NA
>prophage 68
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	991498	993354	4864149		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502858.1|991498_992137_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	52.5	3.0e-56
WP_022645126.1|992121_993354_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	1.7e-60
>prophage 69
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1009070	1009646	4864149		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|1009070_1009646_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 70
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1016471	1020053	4864149		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000792585.1|1016471_1017701_+	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
WP_000494233.1|1017717_1018773_+	response regulator	NA	NA	NA	NA	NA
WP_001001003.1|1018901_1020053_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 71
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1040059	1042399	4864149		Yersinia_phage(33.33%)	4	NA	NA
WP_001175165.1|1040059_1040878_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
WP_057109541.1|1041143_1041623_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.2e-13
WP_001186774.1|1041638_1042115_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692341.1|1042177_1042399_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
>prophage 72
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1075909	1077082	4864149		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|1075909_1077082_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 73
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1099292	1100177	4864149		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1099292_1100177_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 74
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1106253	1115604	4864149		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|1106253_1107081_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|1107280_1108207_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1108257_1108515_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1108557_1110777_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|1110887_1112300_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|1112374_1113112_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_032329482.1|1113345_1115604_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
>prophage 75
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1118914	1119307	4864149		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1118914_1119307_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 76
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1123134	1137410	4864149	transposase	Bacillus_virus(16.67%)	15	NA	NA
WP_000195292.1|1123134_1125027_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
WP_000105733.1|1125055_1125637_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1125636_1126464_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1126488_1126911_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1126911_1127541_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1127745_1129227_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1129374_1130046_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1130051_1131212_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|1131249_1132065_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1132180_1132954_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1133011_1133182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1133443_1134097_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_001295626.1|1134470_1134761_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001272145.1|1135044_1135596_+	fimbrial-like protein	NA	NA	NA	NA	NA
WP_001118619.1|1136486_1137410_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 77
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1144680	1146114	4864149		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1144680_1146114_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 78
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1151251	1152490	4864149	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|1151251_1152490_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 79
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1158890	1175086	4864149	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1158890_1159904_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1160141_1160357_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1160467_1162213_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|1162407_1164249_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1164327_1164834_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|1165087_1165852_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|1166139_1166763_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094721.1|1166916_1168437_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000627222.1|1168743_1170234_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.8e-33
WP_000450594.1|1170275_1170608_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|1170826_1171810_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|1171993_1175086_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 80
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1187940	1188906	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|1187940_1188906_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 81
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1210261	1212556	4864149		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1210261_1212556_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 82
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1220762	1221908	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|1220762_1221908_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 83
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1245694	1253488	4864149		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809255.1|1245694_1246555_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249104.1|1246619_1248656_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|1248613_1249009_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|1249028_1249619_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|1249628_1250204_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|1250317_1251358_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|1251430_1252066_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1252193_1252712_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|1252691_1253135_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|1253185_1253488_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 84
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1259190	1261080	4864149		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1259190_1261080_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 85
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1266561	1273200	4864149		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1266561_1269234_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|1269258_1270746_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1270773_1271226_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|1271856_1273200_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 86
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1277282	1280155	4864149	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1277282_1278131_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1278220_1280155_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 87
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1286929	1288407	4864149		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1286929_1287901_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445409.1|1288128_1288407_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 88
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1292475	1307270	4864149		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1292475_1293285_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|1293494_1294472_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1294485_1295472_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|1295492_1296059_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1296055_1296631_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1296599_1297157_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1297163_1297889_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|1297936_1299370_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1299392_1299680_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1299797_1300289_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1300334_1301189_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1301185_1301458_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|1301671_1302304_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|1302300_1303029_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|1303025_1303679_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1303908_1306245_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|1306340_1307270_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 89
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1320689	1328178	4864149		Pseudomonas_phage(33.33%)	7	NA	NA
WP_001189123.1|1320689_1322198_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032143699.1|1322506_1322878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072146727.1|1323697_1324558_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.6e-73
WP_000979882.1|1324617_1325082_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000209011.1|1325078_1325954_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1325950_1326640_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|1326687_1328178_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 90
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1331882	1332380	4864149	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1331882_1332380_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 91
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1336346	1338871	4864149	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1336346_1337714_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1337803_1338871_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 92
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1355647	1356691	4864149		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1355647_1356691_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 93
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1367256	1374729	4864149	transposase	Ostreococcus_lucimarinus_virus(25.0%)	7	NA	NA
WP_001258895.1|1367256_1368141_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
WP_001118619.1|1368367_1369291_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_000825639.1|1369923_1370145_+	membrane protein	NA	NA	NA	NA	NA
WP_000738568.1|1370575_1371601_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|1371668_1372850_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|1372859_1373963_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|1373970_1374729_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 94
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1385224	1386696	4864149	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114983.1|1385224_1385734_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.0e-19
WP_000004473.1|1385748_1386696_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 95
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1407911	1409864	4864149		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|1407911_1409864_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 96
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1418694	1427253	4864149		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|1418694_1421388_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|1421679_1422864_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1422934_1425049_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1425145_1425616_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1425712_1426087_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|1426212_1426500_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|1426507_1426867_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|1426866_1427253_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 97
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1432823	1442364	4864149		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|1432823_1434737_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|1434736_1435759_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1435752_1435971_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1436024_1436894_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1436948_1437353_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242761.1|1437654_1438287_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|1438337_1440428_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|1440494_1441715_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|1441800_1442364_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 98
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1466611	1467448	4864149		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1466611_1467448_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 99
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1484352	1488119	4864149		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|1484352_1485975_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|1486050_1487403_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1487399_1488119_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 100
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1494701	1495580	4864149		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|1494701_1495580_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 101
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1501614	1504008	4864149		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1501614_1504008_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 102
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1508387	1509614	4864149		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1508387_1509614_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 103
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1515669	1518117	4864149		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1515669_1518117_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 104
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1538127	1539938	4864149		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073613.1|1538127_1538871_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
WP_000907792.1|1538867_1539938_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 105
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1543481	1544964	4864149		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|1543481_1544195_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|1544196_1544964_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 106
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1550686	1553505	4864149		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1550686_1551541_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1551785_1552844_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1552836_1553505_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 107
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1556508	1560640	4864149		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1556508_1557135_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106551.1|1557208_1559407_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|1559508_1559754_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|1559974_1560640_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 108
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1568533	1574185	4864149		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|1568533_1569340_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|1569345_1569747_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_062914732.1|1569949_1574185_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
>prophage 109
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1577560	1580296	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|1577560_1580296_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 110
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1593898	1595941	4864149		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|1593898_1595941_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 111
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1599286	1601421	4864149		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|1599286_1599640_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|1599693_1600983_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|1600995_1601421_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 112
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1604814	1605462	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1604814_1605462_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 113
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1651422	1653407	4864149		Bacillus_virus(50.0%)	2	NA	NA
WP_039023208.1|1651422_1652427_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|1652423_1653407_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 114
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1663451	1665785	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|1663451_1665785_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 115
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1669439	1671439	4864149	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|1669439_1669652_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|1669838_1669991_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|1670070_1671439_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 116
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1675277	1676273	4864149		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|1675277_1676273_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 117
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1681591	1683133	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|1681591_1683133_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 118
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1707407	1715707	4864149	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582468.1|1707407_1709252_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_039023207.1|1709248_1710640_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|1710737_1711346_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_062914734.1|1711573_1715707_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
>prophage 119
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1734358	1743913	4864149		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|1734358_1734610_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|1734751_1735183_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_039023204.1|1735427_1736972_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|1736981_1738265_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|1738268_1739228_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982093.1|1739214_1740249_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000645982.1|1740487_1741513_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213802.1|1741522_1742719_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	1.1e-35
WP_000587766.1|1742932_1743913_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
>prophage 120
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1759078	1763641	4864149		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|1759078_1759558_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114529.1|1759596_1760406_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|1760503_1760671_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1760691_1760928_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001336353.1|1761144_1761813_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|1761984_1763205_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|1763185_1763641_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 121
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1768338	1775089	4864149		Morganella_phage(25.0%)	6	NA	NA
WP_001336364.1|1768338_1769163_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
WP_000924289.1|1769454_1770072_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870048.1|1770068_1771751_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.1e-22
WP_001295237.1|1772008_1772632_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|1772686_1772962_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|1772980_1775089_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 122
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1779522	1780914	4864149		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1779522_1780914_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 123
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1793032	1794367	4864149		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|1793032_1794367_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 124
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1801672	1812017	4864149	transposase	Micromonas_sp._RCC1109_virus(25.0%)	11	NA	NA
WP_000168475.1|1801672_1803361_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|1803466_1803565_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000343760.1|1803956_1805177_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001054909.1|1805453_1805543_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|1805822_1807007_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|1807014_1807512_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|1807508_1807871_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_039023179.1|1807860_1808208_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|1808315_1808765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|1808811_1810305_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|1810301_1812017_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 125
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1818368	1819322	4864149		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|1818368_1818797_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|1818908_1819322_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 126
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1823749	1824898	4864149		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1823749_1824898_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 127
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1829433	1836802	4864149		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|1829433_1831848_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|1831876_1832950_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|1832949_1834050_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|1834054_1835458_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|1835754_1835835_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|1836064_1836205_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|1836221_1836581_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|1836544_1836802_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 128
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1847000	1852386	4864149	transposase	Stx2-converting_phage(75.0%)	6	NA	NA
WP_000019348.1|1847000_1848338_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
WP_000086486.1|1848502_1849168_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116777.1|1849234_1849702_+	protein CbrB	NA	NA	NA	NA	NA
WP_001333339.1|1850053_1851589_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|1851637_1851985_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1851981_1852386_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
>prophage 129
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1861783	1869391	4864149		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|1861783_1862557_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|1862739_1863630_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|1863629_1864589_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|1864675_1865716_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|1866029_1867859_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|1868020_1869391_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 130
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1881344	1882337	4864149		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|1881344_1882337_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 131
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1885505	1891358	4864149		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102343.1|1885505_1887374_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	4.6e-65
WP_001301979.1|1887540_1887960_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|1887967_1889473_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211857.1|1889477_1890443_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001333816.1|1890467_1891358_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 132
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1904751	1906398	4864149		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|1904751_1906398_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 133
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1914870	1920284	4864149		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|1914870_1916892_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001295254.1|1916938_1918423_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|1918558_1919824_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|1919954_1920284_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 134
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1924326	1930470	4864149		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001340422.1|1924326_1925457_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|1925453_1926716_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|1926715_1927783_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|1927801_1928683_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|1928660_1929335_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|1929339_1930470_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 135
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1938544	1940200	4864149		Tetraselmis_virus(100.0%)	1	NA	NA
WP_039023212.1|1938544_1940200_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 136
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1950479	1954338	4864149		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|1950479_1951376_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|1951375_1952092_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|1952175_1954338_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 137
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1960056	1961886	4864149		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|1960056_1961886_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 138
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1974418	1977705	4864149		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|1974418_1976059_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|1976137_1976407_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|1976410_1976926_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|1976928_1977705_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 139
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	1986586	1987201	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|1986586_1987201_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 140
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2001060	2003847	4864149		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2001060_2003847_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 141
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2007963	2010434	4864149		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2007963_2009373_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2009384_2010434_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 142
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2026769	2114618	4864149	terminase,tail,tRNA,portal,holin,lysis,integrase,head,plate,capsid,transposase,protease	Escherichia_phage(50.98%)	95	2024317:2024334	2116194:2116211
2024317:2024334	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
WP_000718893.1|2026769_2027666_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|2027833_2028730_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|2028763_2029549_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001295269.1|2029647_2030247_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000920762.1|2030240_2031113_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_000560983.1|2031109_2031547_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|2031591_2032533_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|2033385_2033604_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|2033821_2034064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027703.1|2034393_2035323_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2035319_2035955_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2035951_2036854_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|2036866_2039917_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|2040110_2040944_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|2041096_2042152_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|2042201_2043950_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019486.1|2043949_2045020_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|2045009_2046461_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|2046471_2046918_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|2047218_2047533_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|2047542_2048367_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|2048817_2050077_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|2050073_2051543_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|2051830_2052667_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|2052650_2053589_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063517.1|2053585_2054620_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|2054904_2055525_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|2055784_2056768_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2056916_2057591_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2057696_2059070_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2059066_2059765_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2059914_2060415_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|2060601_2061582_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|2061651_2061945_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|2062081_2062354_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|2062523_2063024_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|2063087_2063312_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|2063311_2063614_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|2063613_2063838_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|2063834_2064110_+	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_002431311.1|2065584_2067126_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2067140_2067887_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000012516.1|2069204_2071688_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000038166.1|2072059_2073094_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000156872.1|2073093_2074866_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085956.1|2075039_2075894_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_001248567.1|2075952_2077026_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_024176422.1|2077029_2077773_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_000988633.1|2077872_2078382_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846414.1|2078381_2078585_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000123123.1|2078588_2078870_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144097.1|2078869_2079367_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000736582.1|2079381_2079807_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_000040631.1|2079794_2080220_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000917160.1|2080327_2080795_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001001770.1|2080787_2081240_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_001093698.1|2081306_2081942_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_000127167.1|2081938_2082286_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001121501.1|2082290_2083199_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_001285346.1|2083191_2083803_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001032315.1|2085097_2085514_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_024176421.1|2085485_2086088_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001333405.1|2086102_2086618_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_000839179.1|2086759_2087164_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2087160_2087508_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|2087556_2089092_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_062914736.1|2089099_2089702_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001286718.1|2089761_2090952_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|2090964_2091483_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|2091539_2091815_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2091847_2091967_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069960.1|2091959_2094407_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978889.1|2094421_2094901_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|2094900_2096064_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|2096145_2096364_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_085947770.1|2096436_2097805_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001145759.1|2098079_2098592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|2098799_2099702_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|2099882_2100845_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045683.1|2101164_2102154_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001326656.1|2102260_2103016_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216327.1|2103070_2103838_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|2103945_2104545_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|2104645_2105086_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|2105297_2105597_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323547.1|2105623_2106052_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|2106056_2106803_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2106899_2107910_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2108044_2109553_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2109575_2110421_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2110845_2111091_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2111175_2111661_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2111753_2112680_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|2112746_2114078_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|2114087_2114618_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
2116194:2116211	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 143
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2131376	2138623	4864149		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|2131376_2132039_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_039023143.1|2132050_2134552_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_001004446.1|2134860_2135940_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2135954_2136275_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|2136325_2138623_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 144
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2155969	2157814	4864149		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|2155969_2157814_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 145
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2166408	2169461	4864149		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2166408_2167359_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2168276_2169461_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 146
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2173577	2181906	4864149		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2173577_2177606_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2177682_2181906_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 147
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2191122	2192886	4864149		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2191122_2191794_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2191836_2192427_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2192613_2192886_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 148
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2198275	2199865	4864149		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|2198275_2199865_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 149
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2216260	2219944	4864149		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|2216260_2219944_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 150
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2239213	2240329	4864149		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2239213_2240329_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 151
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2249544	2250153	4864149		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2249544_2250153_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 152
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2256743	2259291	4864149		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2256743_2258159_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|2258211_2259291_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 153
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2263478	2267091	4864149		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2263478_2266301_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2266554_2267091_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 154
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2282809	2284159	4864149		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2282809_2284159_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 155
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2289742	2291701	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2289742_2291701_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 156
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2300985	2303133	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2300985_2303133_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 157
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2308378	2314747	4864149		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066019.1|2308378_2310364_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
WP_001171687.1|2310636_2311566_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|2311549_2312245_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|2312255_2313236_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|2313214_2314747_-	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 158
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2320981	2322531	4864149		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|2320981_2321662_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|2321772_2322531_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 159
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2328143	2328932	4864149		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|2328143_2328932_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 160
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2334168	2335671	4864149		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2334168_2335671_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 161
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2356867	2360079	4864149	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|2356867_2358385_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|2358621_2360079_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 162
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2374355	2376339	4864149		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2374355_2374649_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2374692_2376339_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 163
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2380862	2381396	4864149		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2380862_2381396_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 164
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2386316	2387294	4864149		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|2386316_2387294_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 165
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2395277	2395823	4864149		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001488516.1|2395277_2395823_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 166
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2399859	2412891	4864149	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990321.1|2399859_2401197_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122497.1|2401206_2403054_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2403046_2403997_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2404082_2404391_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2404467_2405748_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2405833_2407093_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2407095_2408100_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2408181_2408379_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2408482_2409781_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|2409985_2410411_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076310.1|2410449_2412891_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	1.1e-66
>prophage 167
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2421946	2423110	4864149		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|2421946_2423110_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 168
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2436189	2438020	4864149	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_048218113.1|2436189_2436804_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	3.6e-43
WP_061128813.1|2436811_2438020_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
>prophage 169
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2459175	2465663	4864149		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|2459175_2459706_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|2460015_2460972_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205784.1|2461111_2462614_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	9.0e-11
WP_001295197.1|2462627_2463650_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596008.1|2463636_2464632_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2464664_2465663_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 170
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2469850	2472613	4864149		Vibrio_phage(100.0%)	2	NA	NA
WP_001106227.1|2469850_2470315_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
WP_000187791.1|2470474_2472613_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 171
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2476251	2482348	4864149		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|2476251_2477199_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2477383_2477437_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|2477577_2480274_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_024176429.1|2480479_2480866_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2480938_2481400_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013049.1|2481412_2482348_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
>prophage 172
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2490752	2524997	4864149	tRNA,integrase,transposase	Enterobacteria_phage(14.29%)	29	2496754:2496768	2510226:2510240
WP_000416404.1|2490752_2493608_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|2493607_2494051_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2494404_2495916_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2496182_2497283_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
2496754:2496768	attL	ATTCCGGACATTTAA	NA	NA	NA	NA
WP_001295681.1|2497282_2498365_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|2498525_2500028_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001299662.1|2500155_2501175_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000772653.1|2501619_2502882_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
WP_001066505.1|2502911_2503550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455467.1|2503927_2504158_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071586185.1|2504219_2504804_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001246998.1|2504796_2505156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027153.1|2505187_2505472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075579.1|2505468_2505852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155331.1|2505848_2508521_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001066218.1|2508921_2509665_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126947.1|2509661_2510213_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185344.1|2510218_2510491_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
2510226:2510240	attR	TTAAATGTCCGGAAT	NA	NA	NA	NA
WP_000993028.1|2511136_2512105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422112.1|2512106_2513039_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_152932165.1|2514522_2514672_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	85.7	5.5e-06
WP_001189123.1|2515200_2516709_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032143699.1|2517017_2517389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049828170.1|2518199_2518589_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|2518639_2518858_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949416.1|2518924_2520086_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000625669.1|2520366_2521644_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|2521706_2523704_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|2523857_2524997_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 173
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2530650	2535349	4864149		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001189123.1|2530650_2532159_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000177057.1|2532809_2533067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|2533624_2534392_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|2534392_2535349_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 174
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2545525	2549841	4864149	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_000998013.1|2545525_2546911_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
WP_000612637.1|2546960_2547308_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
WP_001333468.1|2547304_2547685_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001327357.1|2548730_2548853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991431.1|2548860_2549841_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
>prophage 175
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2556986	2558447	4864149		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208224.1|2556986_2558447_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 176
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2564969	2565524	4864149		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2564969_2565524_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 177
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2578125	2583489	4864149		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919537.1|2578125_2579790_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|2579838_2581200_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091587.1|2581413_2582328_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106027.1|2582466_2583489_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.4	1.6e-11
>prophage 178
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2586716	2587996	4864149		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|2586716_2587454_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|2587456_2587996_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 179
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2595922	2598798	4864149		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|2595922_2597512_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|2597904_2598510_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2598636_2598798_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 180
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2604837	2606160	4864149		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2604837_2606160_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 181
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2612903	2618259	4864149		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093809.1|2612903_2614136_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.2e-82
WP_000046749.1|2614443_2616111_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|2616321_2618259_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 182
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2621595	2623709	4864149		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|2621595_2622285_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219614.1|2622284_2623709_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 183
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2635476	2647340	4864149	transposase	Cyanophage(16.67%)	11	NA	NA
WP_000130185.1|2635476_2636430_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094682.1|2636544_2637132_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|2637166_2637733_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|2637881_2638595_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|2638620_2639025_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|2639401_2641318_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118474.1|2641406_2642537_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_001615628.1|2642799_2643912_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|2643989_2644199_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_085947770.1|2644241_2645611_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000681360.1|2646173_2647340_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 184
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2654380	2657197	4864149	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286892.1|2654380_2657197_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.0e-76
>prophage 185
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2661623	2662772	4864149		Halovirus(100.0%)	1	NA	NA
WP_001352306.1|2661623_2662772_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 186
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2668272	2673922	4864149		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000263451.1|2668272_2669793_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.5	6.4e-33
WP_000349953.1|2669899_2671117_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|2671234_2672377_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|2672407_2673922_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 187
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2681814	2683214	4864149		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|2681814_2682294_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|2682371_2683214_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 188
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2692365	2697788	4864149		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|2692365_2695272_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035678.1|2695436_2697788_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 189
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2704236	2704935	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|2704236_2704935_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 190
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2717637	2719362	4864149		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|2717637_2719362_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 191
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2745463	2746507	4864149		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2745463_2746507_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 192
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2750752	2751304	4864149		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2750752_2751304_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 193
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2759931	2761356	4864149		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2759931_2761356_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 194
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2769102	2775725	4864149		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|2769102_2770653_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|2770854_2773245_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2773450_2773987_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2774027_2774690_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2774798_2775725_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 195
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2778987	2779890	4864149	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|2778987_2779890_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 196
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2789748	2796554	4864149	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|2789748_2791167_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|2791205_2792132_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|2792168_2792624_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|2792801_2793506_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|2793520_2794051_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001360098.1|2794124_2796554_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 197
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2801797	2802595	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|2801797_2802595_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 198
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2808629	2808974	4864149		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2808629_2808974_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 199
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2812903	2814328	4864149	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2812903_2814328_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 200
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2826925	2901408	4864149	tRNA,transposase,protease,plate	uncultured_Caudovirales_phage(18.18%)	61	NA	NA
WP_001295562.1|2826925_2827684_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|2827696_2828554_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|2828565_2829918_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2829947_2832380_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2832501_2832987_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2832990_2834016_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2834120_2834576_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2834579_2835368_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|2835367_2836516_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2836512_2837109_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2837145_2840628_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2840640_2841600_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|2841698_2843840_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|2843896_2844286_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|2844350_2845649_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2845697_2845958_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2845944_2846145_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|2846310_2846856_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|2846852_2847275_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|2847288_2847999_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|2848198_2849023_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|2849076_2850795_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2850906_2851614_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2851610_2852015_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|2852132_2852948_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2852987_2853641_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|2853633_2854665_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|2854852_2855428_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_039023238.1|2861187_2861991_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_000648572.1|2861987_2862902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2863142_2863943_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|2863946_2864570_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|2864617_2865976_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|2866047_2866803_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|2866836_2867559_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2867555_2868023_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|2868087_2868819_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|2869355_2870141_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|2870277_2870757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|2870766_2871681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2871724_2872207_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|2872230_2873583_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|2873593_2877028_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|2877136_2878549_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|2878553_2879297_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|2879293_2882059_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|2882067_2882829_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|2882833_2884165_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2884167_2884692_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|2884688_2885969_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2885993_2887076_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|2887039_2888890_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|2888893_2889307_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|2889313_2890789_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|2890839_2891064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|2891098_2891599_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2892293_2892812_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|2893021_2895163_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_039023185.1|2895238_2899471_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|2899448_2899841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|2900271_2901408_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 201
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2905572	2970341	4864149	terminase,tail,portal,lysis,integrase,transposase,protease	Enterobacteria_phage(40.74%)	75	2903013:2903028	2978658:2978673
2903013:2903028	attL	GCGGCTTCATCTTTAT	NA	NA	NA	NA
WP_000284050.1|2905572_2906151_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|2906356_2907124_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2907094_2907835_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|2907990_2908269_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|2908271_2908532_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|2908741_2909491_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|2909666_2910164_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|2910387_2912127_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|2912086_2912857_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|2912927_2913983_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|2914034_2914328_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|2914330_2914729_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059892.1|2914738_2915191_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|2915496_2915763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|2915695_2916232_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|2916288_2917746_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|2918006_2918465_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|2918556_2919801_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|2919858_2920260_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_039023169.1|2920298_2921354_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|2921641_2922745_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|2922756_2924010_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_039023168.1|2924214_2925378_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	1.7e-227
WP_077873866.1|2925254_2925689_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000206737.1|2925604_2925910_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_001242749.1|2925909_2926272_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|2926262_2926799_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|2926926_2927751_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|2927816_2928179_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|2928881_2929574_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_032198020.1|2929671_2929932_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_032198019.1|2929924_2930476_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_001250272.1|2930651_2930831_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_039023167.1|2930820_2931807_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
WP_001393497.1|2931803_2932298_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_001377816.1|2932297_2932951_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_000210170.1|2932947_2933274_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|2933270_2933660_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_024227971.1|2933679_2934489_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_039023166.1|2934496_2935486_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_085949407.1|2935500_2935869_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001208502.1|2935904_2936354_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|2936375_2937317_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_000917724.1|2937585_2937789_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|2937939_2938992_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|2939059_2939275_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|2939274_2939772_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|2939768_2940236_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_021512737.1|2940223_2940376_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_000349509.1|2941051_2941543_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_025670557.1|2941542_2943645_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|2943641_2943854_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_052249886.1|2943853_2945323_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_023277783.1|2945306_2947334_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_023140705.1|2947420_2947744_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_001283153.1|2947736_2948012_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140704.1|2948023_2948602_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|2948598_2949000_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_021560209.1|2949010_2949754_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001300035.1|2949814_2950201_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2950209_2950539_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_039023165.1|2950510_2953576_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_039023164.1|2953575_2953905_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_001152385.1|2953914_2954613_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032151194.1|2954618_2955362_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_032158484.1|2955259_2955907_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_039023163.1|2955967_2959465_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_001230375.1|2959534_2960134_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_086708942.1|2960198_2963957_+	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_072240810.1|2964011_2964140_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_039023230.1|2964817_2965699_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000371964.1|2965676_2966258_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023231.1|2966953_2967151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023233.1|2967651_2968494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772656.1|2969132_2970341_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
2978658:2978673	attR	GCGGCTTCATCTTTAT	NA	NA	NA	NA
>prophage 202
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2982878	2984432	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001178466.1|2982878_2984432_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	2.9e-12
>prophage 203
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	2988858	2990367	4864149		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189123.1|2988858_2990367_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 204
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3012688	3020442	4864149		Pseudomonas_phage(40.0%)	10	NA	NA
WP_001234565.1|3012688_3013510_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000855059.1|3013851_3014325_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001424026.1|3014340_3014817_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3014885_3015107_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086755.1|3015125_3015770_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
WP_077249034.1|3015873_3016179_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094398.1|3016199_3016568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|3016888_3017299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|3017277_3018234_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|3018243_3020442_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 205
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3040652	3041978	4864149		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|3040652_3041978_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 206
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3047553	3053473	4864149	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|3047553_3049224_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|3049237_3050710_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|3050723_3051311_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3051439_3053473_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 207
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3064860	3065910	4864149		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|3064860_3065910_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 208
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3074682	3076569	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|3074682_3076569_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 209
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3079967	3080867	4864149		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|3079967_3080867_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 210
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3085407	3089687	4864149		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177906.1|3085407_3088482_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000805902.1|3088604_3089687_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 211
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3095097	3097058	4864149		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|3095097_3096048_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|3096044_3097058_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 212
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3100638	3101748	4864149		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842100.1|3100638_3101748_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 213
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3109275	3110043	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|3109275_3110043_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 214
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3116853	3118011	4864149		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3116853_3118011_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 215
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3125426	3126542	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3125426_3126542_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 216
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3130743	3140820	4864149		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3130743_3131655_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|3131779_3132688_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|3132932_3134117_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698951.1|3134242_3137389_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|3137385_3138588_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3138777_3139467_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|3139524_3140820_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 217
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3147772	3156753	4864149	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3147772_3148900_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3148922_3149255_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3149282_3151130_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3151140_3152112_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3152240_3152588_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3152764_3153649_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|3153947_3154487_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3154637_3155087_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|3155090_3156194_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|3156282_3156753_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 218
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3178312	3183359	4864149	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3178312_3178936_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3179061_3180336_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3180523_3182878_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3183086_3183359_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 219
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3186487	3187183	4864149		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|3186487_3187183_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 220
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3190506	3194053	4864149		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|3190506_3192279_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|3192271_3194053_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 221
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3202889	3206039	4864149		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3202889_3206039_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 222
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3213046	3221608	4864149		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3213046_3213598_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|3213726_3215658_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3215710_3216040_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3216039_3216645_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3216754_3218629_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|3218809_3219454_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|3219689_3220652_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|3220648_3221608_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 223
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3229852	3232913	4864149		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|3229852_3230194_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|3230408_3232913_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 224
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3237452	3238130	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|3237452_3238130_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 225
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3241266	3241953	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3241266_3241953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 226
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3255448	3257230	4864149		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|3255448_3257230_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 227
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3263419	3264565	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|3263419_3264565_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 228
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3276142	3328898	4864149	tRNA,transposase	Escherichia_phage(26.67%)	43	NA	NA
WP_000912385.1|3276142_3277528_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143556.1|3277563_3278085_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3278192_3278405_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3278406_3279273_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3279743_3280286_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|3280505_3281198_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|3281228_3283832_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|3283810_3284851_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|3284861_3285377_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3285379_3286012_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001177471.1|3286376_3287138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001224604.1|3287320_3288211_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001333623.1|3288211_3291184_-	phage receptor	NA	NA	NA	NA	NA
WP_039023216.1|3291170_3293408_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253839.1|3293557_3295000_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|3294989_3295673_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|3295829_3297203_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|3297360_3297693_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|3297708_3298932_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|3298943_3302087_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786319.1|3302188_3303565_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|3303645_3304893_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_087920816.1|3305000_3305651_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001310555.1|3305649_3306666_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001067855.1|3307031_3307736_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000609089.1|3308737_3309631_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
WP_000154260.1|3310075_3311092_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
WP_001048111.1|3311125_3313342_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000665069.1|3313338_3314118_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000018742.1|3314124_3314877_+	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
WP_001581568.1|3314942_3315974_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000684771.1|3315983_3317138_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000440491.1|3317185_3318376_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001276168.1|3318379_3320461_+	glycosyltransferase	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
WP_001118619.1|3320678_3321602_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001333498.1|3322245_3322503_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_000217395.1|3322673_3323165_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000262446.1|3323250_3323613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3323697_3324402_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001130654.1|3324539_3325658_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_085947770.1|3326089_3327458_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000956455.1|3327556_3327709_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001615628.1|3327785_3328898_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 229
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3333877	3339920	4864149		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|3333877_3337759_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096707.1|3337974_3339108_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|3339104_3339920_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 230
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3354467	3356290	4864149		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|3354467_3355097_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029825.1|3355069_3356290_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 231
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3359473	3361588	4864149		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3359473_3361039_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|3361159_3361588_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 232
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3377012	3377659	4864149		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3377012_3377222_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|3377275_3377659_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 233
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3382472	3384911	4864149		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3382472_3383684_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|3383822_3384911_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 234
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3391921	3394504	4864149	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|3391921_3394504_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 235
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3401443	3404976	4864149		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|3401443_3403114_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|3403197_3404133_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|3404250_3404976_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 236
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3410859	3411939	4864149		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3410859_3411939_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 237
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3416034	3417699	4864149		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|3416034_3417699_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 238
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3422465	3426279	4864149	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023094.1|3422465_3424412_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|3424614_3426279_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 239
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3439347	3452068	4864149		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|3439347_3440025_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_039023170.1|3440021_3442706_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|3442698_3443271_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|3443279_3445328_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|3445350_3447024_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|3447023_3447113_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|3447425_3447632_+	YbfA family protein	NA	NA	NA	NA	NA
WP_062914703.1|3447874_3452068_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 240
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3457798	3460848	4864149		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|3457798_3459217_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|3459366_3460848_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 241
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3464226	3465018	4864149		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|3464226_3465018_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 242
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3501548	3505068	4864149		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|3501548_3502268_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|3502264_3503206_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|3503319_3503700_-	periplasmic protein	NA	NA	NA	NA	NA
WP_039023123.1|3504015_3505068_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 243
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3509421	3515995	4864149		Tupanvirus(33.33%)	7	NA	NA
WP_039023122.1|3509421_3510438_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.3	3.6e-80
WP_000096869.1|3510698_3512171_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|3512238_3513027_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3513155_3513305_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000101983.1|3513471_3514245_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3514244_3514934_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|3514936_3515995_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 244
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3526350	3527640	4864149		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|3526350_3527640_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 245
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3534121	3535030	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3534121_3535030_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 246
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3545627	3560440	4864149		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_001333396.1|3545627_3547364_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|3547356_3548352_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3548354_3549026_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|3549254_3550619_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|3550850_3551333_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|3551452_3553603_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|3553630_3554593_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|3554733_3555819_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|3556047_3556308_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|3556572_3556839_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|3556912_3557590_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430057.1|3557631_3559914_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|3560179_3560440_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 247
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3564124	3569349	4864149		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|3564124_3564847_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|3564843_3565503_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|3565641_3566388_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3566791_3567295_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|3567593_3568481_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3568715_3568781_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3568833_3569349_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 248
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3574346	3582688	4864149		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|3574346_3575939_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|3576179_3577445_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|3577596_3578412_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|3578557_3580990_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|3580995_3581895_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|3582025_3582688_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 249
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3585903	3587775	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|3585903_3587775_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 250
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3599099	3600302	4864149		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|3599099_3600302_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 251
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3608868	3618009	4864149		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|3608868_3609126_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|3609285_3609573_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189145.1|3609556_3610270_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3610330_3611233_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3611320_3611797_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|3612147_3613260_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|3613354_3614488_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|3614497_3615451_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|3615447_3616293_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3616352_3616841_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|3616881_3618009_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
>prophage 252
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3621369	3624107	4864149		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|3621369_3622098_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|3622315_3622831_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3622956_3623280_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|3623276_3624107_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 253
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3627694	3629413	4864149		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|3627694_3629413_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 254
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3638710	3662395	4864149	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188144.1|3638710_3640657_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|3640729_3640954_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3641276_3641597_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3641627_3643904_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|3644588_3644807_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|3645091_3645796_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|3645837_3647559_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043592.1|3647559_3649326_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_000537418.1|3649448_3650414_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|3650958_3651453_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_039023121.1|3651587_3655577_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3655735_3656347_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|3656357_3657701_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|3657791_3659084_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|3659322_3661767_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|3661777_3662395_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 255
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3668703	3671918	4864149		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|3668703_3669444_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|3669635_3671918_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 256
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3676016	3677105	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|3676016_3677105_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 257
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3682191	3686733	4864149		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|3682191_3682476_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|3682683_3684948_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|3684984_3686733_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 258
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3701438	3712409	4864149	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|3701438_3701987_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|3702013_3702661_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|3702882_3704073_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|3704257_3705346_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3705949_3707350_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|3707518_3708721_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|3708986_3711599_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|3711641_3712409_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 259
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3728328	3730236	4864149		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|3728328_3730236_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 260
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3742835	3744890	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|3742835_3744890_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 261
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3749123	3749783	4864149	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3749123_3749783_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 262
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3769048	3781363	4864149		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|3769048_3769261_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|3769271_3769460_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|3769434_3769665_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3769654_3769828_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|3769876_3770950_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001381077.1|3771021_3773766_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.1e-37
WP_001264933.1|3773848_3774877_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|3774849_3775542_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|3775671_3776844_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|3776843_3779390_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209894.1|3779386_3779986_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|3780137_3780443_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|3780442_3781363_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 263
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3785668	3787942	4864149		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|3785668_3785842_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|3786098_3787427_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|3787447_3787942_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 264
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3802580	3803645	4864149		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|3802580_3803645_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 265
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3810464	3813026	4864149	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409871.1|3810464_3811823_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	7.3e-20
WP_085947771.1|3811863_3813026_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 266
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3818258	3819092	4864149		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3818258_3819092_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 267
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3823227	3823761	4864149		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|3823227_3823761_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 268
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3833069	3833990	4864149		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3833069_3833990_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 269
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3838650	3838896	4864149		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3838650_3838896_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 270
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3854779	3855721	4864149		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|3854779_3855721_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 271
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3868855	3870037	4864149		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|3868855_3869590_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3869800_3870037_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 272
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3873309	3874952	4864149		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|3873309_3873951_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|3873947_3874952_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 273
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3887258	3887516	4864149		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3887258_3887516_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 274
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3894804	3898545	4864149		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|3894804_3895506_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|3895505_3896750_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|3896778_3897690_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952734.1|3897705_3898545_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	9.7e-23
>prophage 275
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3901972	3963099	4864149	terminase,tail,tRNA,portal,holin,integrase,head,capsid	Escherichia_phage(42.55%)	68	3897067:3897081	3903547:3903561
3897067:3897081	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|3901972_3903091_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|3903059_3903329_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|3903390_3905832_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
3903547:3903561	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|3905925_3906117_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|3906113_3906302_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|3906702_3906906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3906870_3907089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|3907181_3907382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|3907813_3908152_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|3908543_3908786_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|3908769_3909195_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|3909266_3910337_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|3910377_3910800_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|3910857_3911214_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|3911307_3911490_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001013636.1|3912524_3912737_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|3912904_3913183_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|3913184_3914243_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|3914243_3914624_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|3914620_3915442_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|3915836_3915923_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001333559.1|3916411_3916624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|3916694_3917030_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|3917290_3917479_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000372595.1|3917786_3918002_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|3918006_3918357_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|3918420_3918954_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|3919170_3919353_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|3919443_3919737_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|3920262_3920613_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|3920760_3921243_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|3921242_3923000_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923134.1|3923147_3924374_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000766109.1|3924979_3926197_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|3926273_3926591_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|3926599_3926938_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|3926934_3927384_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|3927380_3927725_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|3927785_3928490_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001324129.1|3928489_3928876_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077253127.1|3928917_3929178_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|3929224_3932452_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|3932429_3932786_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|3932785_3933484_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|3933489_3934233_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|3934169_3934778_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|3934838_3938318_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|3938385_3938985_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|3942938_3944447_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032143699.1|3944755_3945127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|3945860_3946391_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_000241001.1|3946628_3947297_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|3947851_3948715_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3948698_3949835_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|3950084_3951311_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3951359_3952481_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|3952556_3954017_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|3954016_3954688_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|3954856_3956227_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|3956230_3956872_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|3956907_3958014_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3958067_3958529_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248681.1|3958538_3959192_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444488.1|3959363_3960614_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|3960716_3961040_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|3961579_3961690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3961742_3962147_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|3962367_3963099_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 276
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3970173	3971262	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|3970173_3971262_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 277
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	3979806	3981494	4864149		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3979806_3980226_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|3980225_3981494_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 278
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4008163	4010915	4864149		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4008163_4009843_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4009967_4010915_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 279
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4014051	4018059	4864149		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|4014051_4015134_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|4015133_4015967_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|4015963_4016356_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4016359_4017169_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4017204_4018059_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 280
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4021158	4021389	4864149		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|4021158_4021389_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 281
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4032643	4043184	4864149		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|4032643_4034182_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|4034178_4034889_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4034888_4035566_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|4036821_4037664_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|4037713_4038172_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|4038284_4039190_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4039281_4040295_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4040496_4041405_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4041548_4041962_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|4042566_4043184_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 282
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4052594	4054609	4864149		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|4052594_4053608_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4053604_4054609_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 283
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4066267	4069225	4864149		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001340286.1|4066267_4067626_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|4067629_4069225_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 284
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4076194	4081486	4864149	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|4076194_4076953_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|4077172_4078222_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4078257_4078509_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|4078888_4081486_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 285
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4087186	4087777	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4087186_4087777_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 286
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4095594	4101251	4864149		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|4095594_4097529_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|4097596_4098724_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4098867_4099656_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|4100023_4100377_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|4100444_4101251_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 287
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4114166	4115432	4864149		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|4114166_4115432_+	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 288
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4129437	4130520	4864149		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057985.1|4129437_4130520_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 289
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4147139	4147655	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|4147139_4147655_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 290
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4153981	4161252	4864149	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|4153981_4155214_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4155468_4156452_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|4156929_4158303_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|4158431_4159367_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|4159543_4159978_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|4160118_4161252_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 291
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4166212	4167202	4864149		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|4166212_4167202_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 292
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4189896	4191059	4864149	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|4189896_4191059_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 293
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4206121	4210024	4864149		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|4206121_4210024_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 294
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4213962	4217171	4864149		Escherichia_phage(33.33%)	4	NA	NA
WP_000428998.1|4213962_4214493_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4214737_4214911_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|4214982_4215132_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098562.1|4215530_4217171_+	methyl-accepting chemotaxis protein Trg	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.0	1.6e-05
>prophage 295
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4226717	4236891	4864149	transposase	Escherichia_phage(25.0%)	10	NA	NA
WP_000826421.1|4226717_4227926_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	8.6e-206
WP_001326689.1|4227965_4229180_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|4229232_4229769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303492.1|4229841_4231803_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|4231894_4232125_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001447010.1|4232346_4232523_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	NA	NA	NA	NA
WP_001270286.1|4232568_4232985_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|4233063_4234470_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|4234714_4235860_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|4235877_4236891_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 296
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4244023	4246126	4864149		Salmonella_phage(100.0%)	1	NA	NA
WP_000689371.1|4244023_4246126_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 297
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4251032	4253141	4864149		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103220.1|4251032_4253141_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 298
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4264800	4266345	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|4264800_4266345_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 299
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4273228	4273519	4864149		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|4273228_4273519_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 300
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4279710	4281151	4864149		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|4279710_4279995_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|4280140_4281151_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 301
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4284424	4286330	4864149		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285520.1|4284424_4285351_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-13
WP_000193547.1|4285343_4286330_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 302
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4290646	4294453	4864149		Klosneuvirus(50.0%)	2	NA	NA
WP_024176423.1|4290646_4293046_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|4293070_4294453_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 303
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4299719	4306655	4864149		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001310815.1|4299719_4302515_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_000832437.1|4302559_4304932_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000628576.1|4304969_4306655_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 304
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4319977	4321378	4864149		Escherichia_phage(100.0%)	1	NA	NA
WP_001083595.1|4319977_4321378_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 305
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4328801	4330337	4864149		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|4328801_4330337_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
>prophage 306
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4338218	4339166	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_000878968.1|4338218_4339166_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 307
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4346885	4347269	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|4346885_4347269_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 308
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4350270	4351161	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_039023117.1|4350270_4351161_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 309
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4356525	4371962	4864149		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|4356525_4356729_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|4356763_4358224_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000151243.1|4358312_4359680_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836066.1|4359737_4360757_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|4360768_4361983_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4362188_4362515_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4362649_4362991_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4363025_4363586_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4363588_4364299_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|4364406_4364712_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|4364910_4367337_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|4367397_4369821_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|4369831_4370449_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|4370450_4371305_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|4371347_4371962_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 310
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4389723	4391025	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|4389723_4391025_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 311
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4401101	4402913	4864149		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|4401101_4402913_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 312
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4422789	4424064	4864149	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4422789_4424064_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 313
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4430975	4432474	4864149		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|4430975_4431497_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|4431577_4432474_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 314
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4441276	4450157	4864149		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|4441276_4442092_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|4442219_4442801_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|4443035_4444205_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|4444370_4444460_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|4444758_4445784_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|4445780_4446713_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182332.1|4446825_4448037_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|4448327_4449476_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|4449515_4450157_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 315
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4455661	4457928	4864149		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587530.1|4455661_4456474_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|4456477_4457263_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|4457259_4457928_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 316
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4466217	4471301	4864149		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|4466217_4467438_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|4467434_4468706_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|4468680_4469427_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000089364.1|4469436_4470924_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|4470932_4471301_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 317
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4489891	4509485	4864149	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553704.1|4489891_4491592_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.0e-31
WP_000069375.1|4491648_4494027_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|4494359_4495193_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|4495349_4496396_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|4496527_4496719_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|4496722_4498159_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|4498221_4498935_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|4499181_4499646_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|4499723_4500473_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|4500472_4501024_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|4501086_4502067_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|4502167_4502467_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|4502471_4504859_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|4504873_4505857_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4506140_4506185_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|4506307_4506664_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4506716_4506914_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4507010_4507553_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|4507556_4509485_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 318
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4520781	4523043	4864149		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|4520781_4523043_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 319
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4529372	4530200	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|4529372_4530200_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 320
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4537676	4538897	4864149		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|4537676_4538897_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 321
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4545661	4546315	4864149		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|4545661_4546315_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 322
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4551913	4553875	4864149		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|4551913_4553875_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 323
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4558801	4562886	4864149		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|4558801_4559443_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438803.1|4559535_4560894_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|4561010_4561769_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|4561905_4562886_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 324
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4571696	4572551	4864149		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|4571696_4572551_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 325
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4575869	4580446	4864149		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|4575869_4577153_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|4577299_4578775_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|4578955_4580446_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 326
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4594975	4603082	4864149	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|4594975_4596661_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|4596866_4597448_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|4597487_4598183_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|4598240_4600151_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|4600282_4600627_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|4600988_4601348_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|4601467_4601647_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|4601720_4603082_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 327
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4606940	4608497	4864149		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4606940_4608497_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 328
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4614137	4614347	4864149		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4614137_4614347_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 329
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4619679	4621728	4864149		Moraxella_phage(100.0%)	1	NA	NA
WP_001055811.1|4619679_4621728_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	5.2e-86
>prophage 330
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4629224	4633694	4864149		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|4629224_4629881_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976476.1|4630276_4630618_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879289.1|4630630_4631503_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|4631506_4631881_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4632019_4632250_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|4632351_4633008_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4633031_4633694_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 331
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4641750	4643226	4864149		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|4641750_4643226_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 332
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4647224	4654288	4864149		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|4647224_4648547_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|4648562_4649495_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4649573_4650329_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571457.1|4650325_4651111_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4651257_4652268_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580329.1|4652276_4652888_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|4653026_4653092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|4653162_4653765_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4653766_4654288_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 333
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4658306	4660357	4864149		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|4658306_4659125_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|4659177_4659573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|4659613_4660357_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 334
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4666973	4668707	4864149	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025299.1|4666973_4668707_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	2.0e-86
>prophage 335
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4673872	4679516	4864149		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|4673872_4674262_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|4674276_4675326_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_039023115.1|4675328_4676189_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|4676207_4677809_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001297437.1|4677854_4679516_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 336
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4689602	4691117	4864149		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|4689602_4691117_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 337
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4703108	4703861	4864149		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4703108_4703861_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 338
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4716380	4717052	4864149		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334611.1|4716380_4717052_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	4.3e-82
>prophage 339
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4732234	4744725	4864149		Bacillus_phage(33.33%)	12	NA	NA
WP_001764600.1|4732234_4733929_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	8.5e-18
WP_000009302.1|4734099_4734282_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922688.1|4734360_4735278_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|4735450_4736371_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|4736359_4736830_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157268.1|4736810_4738229_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001445480.1|4738295_4738991_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001330593.1|4739030_4739396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023111.1|4739960_4741142_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	2.0e-106
WP_024232058.1|4741736_4742588_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_039023110.1|4742695_4744054_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001347103.1|4744053_4744725_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 340
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4749915	4774571	4864149	integrase	Bacillus_phage(40.0%)	8	4742362:4742376	4764444:4764458
4742362:4742376	attL	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_039023109.1|4749915_4751178_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	4.5e-72
WP_000703040.1|4751371_4752676_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286284.1|4752703_4753984_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654452.1|4753976_4755779_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_000098391.1|4755765_4757568_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
WP_000970688.1|4757734_4758694_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_039023108.1|4758884_4764992_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.1e-33
4764444:4764458	attR	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_039023107.1|4765079_4774571_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 341
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4807622	4810001	4864149	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001775131.1|4807622_4809224_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.6	2.8e-260
WP_000609174.1|4809273_4809621_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|4809617_4810001_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 342
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4813778	4816081	4864149	transposase	Acidithiobacillus_phage(50.0%)	2	NA	NA
WP_001298859.1|4813778_4815320_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4815334_4816081_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 343
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4823214	4824470	4864149		Bordetella_phage(50.0%)	3	NA	NA
WP_047634712.1|4823214_4823694_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.5e-12
WP_001186773.1|4823709_4824186_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4824248_4824470_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 344
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4828811	4829978	4864149		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830144.1|4828811_4829978_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
>prophage 345
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4837622	4838522	4864149		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131792.1|4837622_4838522_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 346
NZ_CP021736	Escherichia coli strain AR_0150, complete genome	4864149	4847025	4857748	4864149		uncultured_virus(20.0%)	5	NA	NA
WP_052249884.1|4847025_4850532_-	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	29.6	3.1e-22
WP_000704810.1|4851441_4852608_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
WP_039023227.1|4852800_4854207_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	7.3e-39
WP_126851339.1|4854546_4856082_+	hypothetical protein	NA	A0A2H4YGX5	Raoultella_phage	30.1	1.5e-50
WP_039023225.1|4856095_4857748_+	hypothetical protein	NA	H6X4Y2	Enterobacteria_phage	37.5	3.6e-98
>prophage 1
NZ_CP021737	Escherichia coli strain AR_0150 plasmid tig00000255, complete sequence	117703	5617	45878	117703	protease,tRNA,integrase,transposase	Escherichia_phage(33.33%)	39	33616:33675	45882:46701
WP_039023147.1|5617_6016_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_086531934.1|6015_6246_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_039023145.1|6324_11595_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_002431311.1|11870_13412_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|13426_14173_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_052273601.1|14200_14947_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.7e-08
WP_001567328.1|15001_15562_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_039023209.1|15692_15902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702149.1|16313_16940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|17277_18294_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_087920820.1|18302_18860_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001367749.1|19744_19894_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|20177_20435_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|20670_20745_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_029702152.1|20737_21595_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|22533_23187_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|23279_23537_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|23469_23871_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|24007_26905_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|26999_27605_+	DNA invertase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|28381_28774_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|28911_29796_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|29827_31027_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|31105_31783_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|31814_32057_-	hypothetical protein	NA	NA	NA	NA	NA
33616:33675	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|33678_34383_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|34886_35900_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|36057_36531_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|36661_37450_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|37655_38003_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|37996_38836_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|38963_39167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|39322_40528_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|40538_40844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|41070_41835_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|42327_42912_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|42911_44150_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|44146_45052_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|45173_45878_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
45882:46701	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCGACAGCCTGCTCATATCAGAGGGTGAACAACCTTCCCGTCTGGCATGGCTGCTACAGCCTCCGGGTAAAATAAACGGTAAAAATGTGCTGCAACATATCGACCGGCTTAATTCCATCGCTGCGCTGGGGTTGCCTGATGGTATTGCACTTTCCGTTCACCAGAACAGGTTGCTTAAACTGGCGCGTGAGGGCCGGAAAATGAGCAGCAGAGATCTGGCTAAATTCACCGATGTCAGACGTTACGCTACGCTGGTTTGTGTCATTCAGGAAGCGCGGGCCACACTGACTGATGAGGTTATCGAACTGCACGAACGTATTCTGGGCACTCTGTTCAGCCAGGCAAAACGCACACAAGCCGAGAGGCTTCAGCTGACGGGGAAACTCATCCAGAGCAAGTTGAAGCAATATTTTACTGTCGGTCAGGCACTACTGCATGCCAGAGAATCCGGTGAAGATCCCTGGGCAGCGATAGAAGATGTCCTTCCCTGGCAGGAGTTCATCAACAGCCTGGAAGAAACACGGTTTCTGTCCCGTAAGGGCAATTTCGACCCGCTTCACCTGATCACCGAAAAATACAGTACGCTGCGTAAATACGCCCCGCGTATGCTGTCAGCATTGCAGTTCATGGCGACACCTGCGGCGCAGACGCTCAGCGATGCGCTGGACACCATCAGGGAAATGTACCGTAAACAACTTCGTAAAGTGCCGCTATCGGCGCCAACAGGATTTATCCCTGAAAGCTGGCGAAAACTGGTAC	NA	NA	NA	NA
>prophage 1
NZ_CP021738	Escherichia coli strain AR_0150 plasmid tig00000260, complete sequence	46159	0	3979	46159	transposase	Clostridium_phage(33.33%)	4	NA	NA
WP_001549893.1|569_1232_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000343760.1|1320_2541_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549892.1|2642_2882_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067834.1|3274_3979_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP021738	Escherichia coli strain AR_0150 plasmid tig00000260, complete sequence	46159	7241	12605	46159	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_001310555.1|7241_8258_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_039023245.1|8366_9353_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	9.0e-52
WP_004199413.1|9587_12605_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 3
NZ_CP021738	Escherichia coli strain AR_0150 plasmid tig00000260, complete sequence	46159	17769	21940	46159		Streptococcus_phage(33.33%)	3	NA	NA
WP_004199098.1|17769_20097_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|20100_21363_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_001215543.1|21445_21940_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
>prophage 4
NZ_CP021738	Escherichia coli strain AR_0150 plasmid tig00000260, complete sequence	46159	40569	41085	46159		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|40569_41085_-	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 1
NZ_CP021739	Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence	50235	34333	44851	50235	transposase	Enterobacteria_phage(37.5%)	10	NA	NA
WP_000086153.1|34333_35017_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
WP_001134370.1|35401_36328_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|36722_36971_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|36967_37405_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457515.1|37404_38676_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000587689.1|38887_39514_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_005015281.1|39633_39813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|40081_40942_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|41124_41682_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|41845_44851_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
